Ribosome Binding Site/Cat page

Revision as of 21:35, 27 May 2013 by IGEM HQ (Talk | contribs) (Created page with "<div class="Feature_Box" style="width:730px; height:350px; float:left; padding: 5px;"> <div style = "width: 325px; float:right; "> <div class="Part_Icon" style = float:right; ;...")

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
RBS part table RBS part icon: RegistryRBSicon.png
Ribologo-small.gif

Ribosome Binding Sites

The RBS controls the accuracy and efficiency with which the translation of mRNA begins. A ribosome binding site (RBS) is a segment of the 5' (upstream) part of an mRNA molecule that binds to the ribosome to position the message correctly for translation initiation. In bacteria, translation initiation almost always requires both an RBS sequence and a start codon. In the registry, protein coding sequences begin with the start codon. So, if you want to build a BioBrick system that produces a protein, you need to pick an RBS part and put it upstream of the protein coding sequence you want to translate.

Note that an RBS is often defined as just that part of the mRNA sequence that binds to the ribosome, however, the surrounding sequence can also affect the translation initiation rate. Consequently, a BioBrick™ RBS part contains the classic RBS but sometimes additional surrounding sequence.


More...
NameDescriptionEfficiency *Length
BBa_B00291 bp deletion from B0031 15
BBa_B0030RBS.1 (strong) -- modified from R. Weiss0.615
BBa_B0031RBS.2 (weak) -- derivative of BBa_00300.0714
BBa_B0032RBS.3 (medium) -- derivative of BBa_00300.313
BBa_B0033RBS.4 (weaker) -- derivative of BBa_00300.0111
BBa_B0034RBS (Elowitz 1999) -- defines RBS efficiency112
BBa_B0035RBS (B0030 derivative) 14
BBa_B0036Specialized RBS 5
BBa_B0037Specialized RBS 10
BBa_B0038RBS 1 23
BBa_B0039RBS 2 22
BBa_B0041RBS 3 20
BBa_B0064Tuned RBS for Q04401 12
BBa_B0070Specialized RBS modified from that of B0036 (Brink et al.) 16
BBa_B0071Specialized RBS 12
BBa_B0072orthogonal RBS 6
BBa_B0073Specialized RBS 9
BBa_B0074Orthogonal RBS 11
BBa_B0075Orthogonal RBS 8
BBa_B0076Specialized RBS 7
BBa_B0077Specialized RBS 10
BBa_B0078Specialized RBS 12
BBa_B2001T7 RBS 0.3  20
BBa_B2002T7 RBS 0.4 20
BBa_B2003T7 RBS 0.5 20
BBa_B20172.8 RBS from T7 20
BBa_B20224B RBS from T7 20
BBa_B20408 RBS from T7 20
BBa_I11010RBS 11
BBa_I20298RBS from T7 gene 4 20
BBa_I20299RBS from T7 gene 4, optimal aligned spacing 16
BBa_I723012Estimated RBS for DntR 24
BBa_I723014Estimated RBS for DntA 25
BBa_I723019RBS for XylR 20
BBa_I742130Reverse RBS 10
BBa_I742145sam5 native rbs 16
BBa_I742146sam8 native rbs 14
BBa_I742150crtE native rbs 42
BBa_I742153crtY native rbs 19
BBa_I742156crtZ native rbs 16
BBa_I742159crtI native rbs 22
BBa_I742163native ftsK rbs 26
BBa_J100112BD24 C.dog cloned into J100110 191
BBa_J100296rClone Red Version 2 with RBS 2.0: Device for GGA Cloning and Testing RBS elements and Riboswitches  
BBa_J100297rClone Red Version 1.5 with RBS 2.0: Device for GGA Cloning and Testing RBS elements and Riboswitche  
BBa_J100331Mutated RBS 11
BBa_J100335Attempt at the Creation of a Strong RBS 41
BBa_J100339Mutated RBS 11
BBa_J100426BBa_J119028 w/o first 33bp 55
BBa_J100439Lots of As 19
BBa_J100440WC 11
BBa_J100449Testing non-Watson and Crick base pairing within the RBS sequence 19
BBa_J100450This is to test a promoter   
BBa_J100453Examining the effect of a single base mutation in a RBS sequence on RFP production 36
BBa_J100454RBS non Watson-Crick pairing (pairing A-C) 19
BBa_J100457RBS for 16s rClone  20
BBa_J100458Even More As 19
BBa_J100461Our RBS is built off of principles of the 2D shape of mRNA.  31
BBa_J100462The Hy5 36
BBa_J100466E.coli Plasmid Ribosomal Binding Sequence 35
BBa_J100467A new RBS in E. coli to code for mScarlet protein 23
BBa_J100470Examining the effect of a single base mutation in the sequence prior to RBS on RFP production  36
BBa_J100471RBS non-Watson Crick base pairing (A-A) 11
BBa_J107130RC1 RBS (RBS) 29
BBa_J107131RC2 RBS (RBS) 29
BBa_J107132RC3 RBS (RBS) 29
BBa_J119053J23100 Promoter with BD18 RBS w/ leader and RFP reporter 870
BBa_J119390Collection of RBSs from N6 rClone Red Library 8
BBa_J119391Collection of RBSs from N8 rClone Red Library  8
BBa_J119392Collection of Bicistronic RBSs from N6 rClone Red Library  8
BBa_J119393Collection of Bicistronic RBSs from N8 rClone Red Library  8
BBa_J119419BCD1 802
BBa_J119420BCD9 802
BBa_J119421BCD10 802
BBa_J119422BCD17 802
BBa_J119423BCD18 802
BBa_J119424BCD20 802
BBa_J119425BCD24 802
BBa_J119428BCD16 802
BBa_J119429BCD22 802
BBa_J119430BCD6 802
BBa_J119431BCD14 802
BBa_J119432BCD6 with TA 804
BBa_J119433BCD10 with TA 804
BBa_J119434BCD14 with TA 804
BBa_J119435BCD16 with TA 804
BBa_J119436BCD20 with TA 804
BBa_J119437BCD22 with TA 804
BBa_J146000Consensus RBS 37
BBa_J15001strong synthetic E. coli ribosome binding site with SacI site. 10
BBa_J176012Kozak 18
BBa_J18912T7 promoter + RBS + START 83
BBa_J23080b0034 derived RBS to match spacing of J01122 10
BBa_J26002Mario Binding Site  6
BBa_J29048RBS 13
BBa_J329998Short Version of RBS with Predicted TIR of 99 au 14
BBa_J329999RBS with Predicted TIR of 99 au for BBa_C0061 31
BBa_J331018RBS for hsp90 56
BBa_J34801ribosome binding site 12
BBa_J34803ribosome binding site 13
BBa_J34810ribosome binding site 8
BBa_J364100Bicistronic Design Element, Number 2 (BCD2) 84
BBa_J428032BBa_B0030_m0 24
BBa_J428034BCD1 84
BBa_J428037BBa_B0031_m0 23
BBa_J428038BBa_B0034_m1 22
BBa_J428039SpoVG 21
BBa_J4330035UTR13 5prime UTR 22
BBa_J433004uORFs (1x weak) 22
BBa_J433005uORFs (1x) 22
BBa_J433006uORFs (4x) 58
BBa_J434008BCD13 84
BBa_J434141pET RBS for OYC dropout 21
BBa_J435302BN1_Riboj54_F1 114
BBa_J435303BN1_BCD2_pelB 152
BBa_J435305BC_BCD12 84
BBa_J435322BN1_BCD12 89
BBa_J435332BN1_BCD23 89
BBa_J435342BN1_BCD2_His 119
BBa_J435352BN1_RiboJ_B34_His 133
BBa_J435354BN2_RiboJ_B34 101
BBa_J435362BN1_BCD2_DsbA 725
BBa_J435364BC_B0034 21
BBa_J435372BN1_BCD2_OmpT 167
BBa_J435374BC_B0032 22
BBa_J435385BC_BCD23 84
BBa_J435386BC_RiboJ_B34 98
BBa_J435387BC_RiboJ_RBS64 100
BBa_J44001Reverse RBS (RBSrev) -- corresponds to BBa_B0030n/a15
BBa_J56013Rbs2 ribosome binding site  19
BBa_J56016Rbs-orig - ribosome binding site 21
BBa_J59001tuba 34
BBa_J61100Ribosome Binding Site Family Member 12
BBa_J61101Ribosome Binding Site Family Member 12
BBa_J61102Ribosome Binding Site Family Member 12
BBa_J61103Ribosome Binding Site Family Member 12
BBa_J61104Ribosome Binding Site Family Member 12
BBa_J61105Ribosome Binding Site Family Member 12
BBa_J61106Ribosome Binding Site Family Member 12
BBa_J61107Ribosome Binding Site Family Member 12
BBa_J61108Ribosome Binding Site Family Member 12
BBa_J61109Ribosome Binding Site Family Member 12
BBa_J61110Ribosome Binding Site Family Member 12
BBa_J61111Ribosome Binding Site Family Member 12
BBa_J61112Ribosome Binding Site Family Member 12
BBa_J61113Ribosome Binding Site Family Member 12
BBa_J61114Ribosome Binding Site Family Member 12
BBa_J61115Ribosome Binding Site Family Member 12
BBa_J61116Ribosome Binding Site Family Member 12
BBa_J61117Ribosome Binding Site Family Member 12
BBa_J61118Ribosome Binding Site Family Member 12
BBa_J61119Ribosome Binding Site Family Member 12
BBa_J61120Ribosome Binding Site Family Member 12
BBa_J61121Ribosome Binding Site Family Member 12
BBa_J61122Ribosome Binding Site Family Member 12
BBa_J61123Ribosome Binding Site Family Member 12
BBa_J61124Ribosome Binding Site Family Member 12
BBa_J61125Ribosome Binding Site Family Member 12
BBa_J61126Ribosome Binding Site Family Member 12
BBa_J61127Ribosome Binding Site Family Member 12
BBa_J61128Ribosome Binding Site Family Member 12
BBa_J61129Ribosome Binding Site Family Member 12
BBa_J61130Ribosome Binding Site Family Member 12
BBa_J61131Ribosome Binding Site Family Member 12
BBa_J61132Ribosome Binding Site Family Member 12
BBa_J61133Ribosome Binding Site Family Member 12
BBa_J61134Ribosome Binding Site Family Member 12
BBa_J61135Ribosome Binding Site Family Member 12
BBa_J61136Ribosome Binding Site Family Member 12
BBa_J61137Ribosome Binding Site Family Member 12
BBa_J61138Ribosome Binding Site Family Member 12
BBa_J61139Ribosome Binding Site Family Member 12
BBa_J61140{rbs1} Library Member in BBb 15
BBa_J61141{rbs1} Library Member in BBb 15
BBa_J61142{rbs1} Library Member in BBb 15
BBa_J61143{rbs1} Library Member in BBb 15
BBa_J61144{rbs1} Library Member in BBb 15
BBa_J61145{rbs1} Library Member in BBb 15
BBa_J61146{rbs1} Library Member in BBb 15
BBa_J61147{rbs1} Library Member in BBb 15
BBa_J63003designed yeast Kozak sequencen/a18
BBa_J64011invB RBS 19
BBa_J64013sipA RBS 18
BBa_J64015sopA RBS 16
BBa_J64018invJ RBS 17
BBa_J64020invI RBS 20
BBa_J64022sicA RBS 20
BBa_J64024sipC RBS 15
BBa_J64026sigE RBS 18
BBa_J64028sopB RBS 20
BBa_J64030sopD RBS 17
BBa_J64031sptP RBS 20
BBa_J64609creD RBS 22
BBa_J64807RocD RBS 16
BBa_J64808RocE RBS 14
BBa_J64809RocF RBS 14
BBa_J64907creA RBS 21
BBa_J64908RBS for creC in e coli operon 24
BBa_J64968RBS on creB 21
BBa_J70591RFC12 Elowitz RBS 12
BBa_J73036Ethylene Forming Enzyme coding sequence 1065
BBa_J73105Ribosome binding site  
BBa_J90000Weak RBS 11
BBa_J95015Strong RBS for Rhodobacter sphaeroides 12
BBa_J95016Weak RBS for Rhodobacter sphaeroides 12
BBa_J95017Weaker RBS-GGAGG8 for Rhodobacter sphaeroides 12
BBa_J95018Medium RBS-GGAGG10 for Rhodobacter sphaeroides 12
BBa_J95019Medium RBS-GGAGG11 for Rhodobacter sphaeroides 12
BBa_J95021RBS for Rhodobacter sphaeroides 12
BBa_J95028RBS for Rhodobacter sphaeroides 12
BBa_J96040IRES 504
BBa_J96043PS3 50
BBa_J96044PS4 48
BBa_K082000reconstruct strong RBS 17
BBa_K082001RBS medium 15
BBa_K082002RBS defines RBS efficiency 14
BBa_K090505''Bacillus subtilis'' consensus RBS 11
BBa_K090506''Bacillus subtilis'' weak RBS 11
BBa_K1017202Regulation RBS-2 21
BBa_K103015consensus RBS 6
BBa_K104003RBS_spaR 9
BBa_K104005RBS_spaK 9
BBa_K104009RBS_gfp 8
BBa_K1045010RBS BBa_B0034 with inversed Pre- and Suffix 12
BBa_K1074015RBS for Pgrac 16
BBa_K1074016RBS for Pctc 18
BBa_K1084101SD2 33
BBa_K1084102SD4  33
BBa_K1084103SD6 33
BBa_K1084104SD8 33
BBa_K1088055RBS from pKT25 19
BBa_K1100000ALeader 75
BBa_K1100001ALeaderT:The First Artificial Triphase Riboswitch 87
BBa_K1100014ALeaderT (with insulator) 106
BBa_K1100071RNA-IN S1 32
BBa_K1100072RNA-IN S4 32
BBa_K1100073RNA-IN S5 32
BBa_K1100074RNA-IN S31 32
BBa_K1100075RNA-IN S34 34
BBa_K1100076RNA-IN S49 34
BBa_K1114100MoClo format of a modified version of BBa_B0030 with BC fusion sites. 32
BBa_K1114101MoClo format of a modified version of BBa_B0031 with BC fusion sites. 31
BBa_K1114102MoClo format of a modified version of BBa_B0032 with BC fusion sites 30
BBa_K1114103MoClo formatted version of B0033 with BC fusion sites 28
BBa_K1114104MoClo formatted version of B0034 with BC fusion sites 29
BBa_K1114106Bicistronic Design RBS 1, MoClo Format with BC fusion sites 92
BBa_K1114107Bicistronic Design RBS 2, MoClo Format with BC fusion sites 92
BBa_K1114108Bicistronic design RBS 8, MoClo Format with BC fusion sites 92
BBa_K1114109Bicistronic design RBS 12, MoClo Format with BC fusion sites 92
BBa_K1114110Bicistronic design RBS 13, MoClo Format with BC fusion sites 92
BBa_K1114111Bicistronic design RBS 16, MoClo Format with BC fusion sites 92
BBa_K1123010Ribosoom Binding Site 22
BBa_K1130003L. plantarum RBS 33
BBa_K1145003A ribosome switch which can be opened by atrazine. 87
BBa_K1159300Polioviral Internal Ribosome Entry Site (IRES) for polycistronic expression in eukaryotes 627
BBa_K118012Synthetic ribosome binding site added by Son of Babel procedure 4
BBa_K121016Tokyo Standard prefix suffix RBS 64
BBa_K1231002Lpp-RBS is a constitutive promoter 90
BBa_K1323016Translational initiation region (RBS) for Staphylococcus aureus 28
BBa_K1323022Ribosome binding site from the sodA Staphylococcus aureus gene 18
BBa_K1341023LTT-rbs 13
BBa_K1351028LMU Bacillus RBS collection 1 11
BBa_K1351029LMU Bacillus RBS collection 2 11
BBa_K1351030LMU Bacillus RBS collection 3 11
BBa_K1351031LMU Bacillus RBS collection 4 11
BBa_K1351032LMU Bacillus RBS collection 5 11
BBa_K1351033LMU Bacillus RBS collection 6 11
BBa_K1351034LMU Bacillus RBS collection 7 11
BBa_K1362090strong T7 RBS 29
BBa_K1379015B0032 derivate for RBS used in Lock 3C 12
BBa_K1403008sRBS 35
BBa_K1403010RBS for agaA in E coli 35
BBa_K1403011sRBS 35
BBa_K1403020sRBS  35
BBa_K1419003Universal riboregulatable RBS 39
BBa_K143020GsiB ribosome binding site (RBS) for B. subtilis 11
BBa_K143021SpoVG ribosome binding site (RBS) for B. subtilis 12
BBa_K1442000Test 28
BBa_K1442008EMCV IRES  
BBa_K1442023EMCV IRES 625
BBa_K1442024NKRF IRES 667
BBa_K1442109EMCV IRES with forward GFP 1432
BBa_K1442110NKRF IRES with forward GFP 1498
BBa_K1453790try  
BBa_K1453791try  
BBa_K1461000crRBS 52
BBa_K1463100GvpA, K737016, RBS 8
BBa_K1463560Reverse RBS 10
BBa_K1471011RBS (Arabidopsis Thaliana). 11
BBa_K1479003Just for upload test  
BBa_K1479004Just for upload test 431
BBa_K1479006Just for upload test 32
BBa_K1479007Just for upload test 32
BBa_K1479015Just for test 16
BBa_K150005ribosome binding site of pTrc99a 13
BBa_K1529948abe 24
BBa_K1529997aa 12
BBa_K1583008RBS 12
BBa_K1583058RBS  12
BBa_K1583061RBS  12
BBa_K1605002 nifZ RBS 15
BBa_K1605004nifE RBS 15
BBa_K1605006nifH RBS 15
BBa_K1605008Ptet mRFP nifS RBS 15
BBa_K1605010nifK RBS 15
BBa_K1605012nifB RBS 15
BBa_K1605014nifD RBS 15
BBa_K1605016nifN RBS 15
BBa_K1605018hesB RBS 16
BBa_K1605020hesA RBS 15
BBa_K1605022cysE2 RBS 15
BBa_K1605024nifV RBS 15
BBa_K1616011RBS reversed 14
BBa_K1624003RBS 7
BBa_K1638001RBS from pKT25 and pUT18 19
BBa_K1638017RBS from pKT25 and pUT18C with consensus Shine-Dalgarno 19
BBa_K1642004SD sequence of cpcB 20
BBa_K165002Kozak sequence (yeast RBS) 18
BBa_K1650034RBS 12
BBa_K1676001RBS Mutant 1AC 12
BBa_K1676002RBS Mutant 1AG 12
BBa_K1676003RBS Mutant 1AT 12
BBa_K1676004RBS Mutant 2AC 12
BBa_K1676005RBS Mutant 2AG 12
BBa_K1676006RBS Mutant 2AT 12
BBa_K1676007RBS Mutant 3AC 12
BBa_K1676008RBS Mutant 3AG 12
BBa_K1676009RBS Mutant 3AT 12
BBa_K1676010RBS Mutant 4GA 12
BBa_K1676011RBS Mutant 4GC 12
BBa_K1676012RBS Mutant 4GT 12
BBa_K1676013RBS Mutant 5AC 12
BBa_K1676014RBS Mutant 5AG 12
BBa_K1676015RBS Mutant 5AT 12
BBa_K1676016RBS Mutant 6GA 12
BBa_K1676017RBS Mutant 6GC 12
BBa_K1676018RBS Mutant 6GT 12
BBa_K1676019RBS Mutant 7GA 12
BBa_K1676020RBS Mutant 7GC 12
BBa_K1676021RBS Mutant 7GT 12
BBa_K1676022RBS Mutant 8AC 12
BBa_K1676023RBS Mutant 8AG 12
BBa_K1676024RBS Mutant 8AT 12
BBa_K1676025RBS Mutant 9GA 12
BBa_K1676026RBS Mutant 9GC 12
BBa_K1676027RBS Mutant 9GT 12
BBa_K1676028RBS Mutant 10AC 12
BBa_K1676029RBS Mutant 10AG 12
BBa_K1676030RBS Mutant 10AT 12
BBa_K1676031RBS Mutant 11AC 12
BBa_K1676032RBS Mutant 11AG 12
BBa_K1676033RBS Mutant 11AT 12
BBa_K1676034RBS Mutant 12AC 12
BBa_K1676035RBS Mutant 12AG 12
BBa_K1676036RBS Mutant 12AT 12
BBa_K1676073Mutant RBS Opt 12
BBa_K1705011rCHU_1284 32
BBa_K1725301Member of the RBS library - derived from BBa_B0032 13
BBa_K1725302Member of the RBS library - derived from BBa_B0032 13
BBa_K1725303Member of the RBS library - derived from BBa_B0032 13
BBa_K1725304Member of the RBS library - derived from BBa_B0032 13
BBa_K1725305Member of the RBS library - derived from BBa_B0032 13
BBa_K1725306Member of the RBS library - derived from BBa_B0032 13
BBa_K1725307Member of the RBS library - derived from BBa_B0032 13
BBa_K1725308Member of the RBS library - derived from BBa_B0032 13
BBa_K1725309Member of the RBS library - derived from BBa_B0032 13
BBa_K1725310Member of the RBS library - derived from BBa_B0032 13
BBa_K1725311Member of the RBS library - derived from BBa_B0032 13
BBa_K1725312Member of the RBS library - derived from BBa_B0032 13
BBa_K1725313Member of the RBS library - derived from BBa_B0032 13
BBa_K1725314Member of the RBS library - derived from BBa_B0032 13
BBa_K1725315Member of the RBS library - derived from BBa_B0032 13
BBa_K1725316Member of the RBS library - derived from BBa_B0032 13
BBa_K1725317Member of the RBS library - derived from BBa_B0032 13
BBa_K1725318Member of the RBS library - derived from BBa_B0032 13
BBa_K1725319Member of the RBS library - derived from BBa_B0032 13
BBa_K1725320Member of the RBS library - derived from BBa_B0032 13
BBa_K1725321Member of the RBS library - derived from BBa_0032 13
BBa_K1725322Member of the RBS library - derived from BBa_B0032 13
BBa_K1725323Member of the RBS library - derived from BBa_B0032 13
BBa_K1725324Member of the RBS library - derived from BBa_B0032 13
BBa_K1725325Member of the RBS library - derived from BBa_B0032 13
BBa_K1725326Member of the RBS library - derived from BBa_B0032 13
BBa_K1725327Member of the RBS library - derived from BBa_B0032 13
BBa_K1725328Member of the RBS library - derived from BBa_B0032 13
BBa_K1725329Member of the RBS library - derived from BBa_B0032 13
BBa_K1725330Member of the RBS library - derived from BBa_B0032 13
BBa_K1725331Member of the RBS library - derived from BBa_B0032 13
BBa_K1725332Member of the RBS library - derived from BBa_B0032 13
BBa_K1759900try  
BBa_K1789002RBS30 15
BBa_K1799011LsrA RBS 10
BBa_K1799012LsrC RBS 10
BBa_K1799013LsrD RBS 10
BBa_K1799014LsrB RBS 10
BBa_K1799028RBS.2 50
BBa_K1799029RBS.4 48
BBa_K1841003ribosome binding site for lactobacillus casei 16
BBa_K1841012rbs (lactobacillus casei)  12
BBa_K1875001This part contains a Kozak sequence 9
BBa_K1893033Strong ribosome binding site (RBS) 20
BBa_K1895001rpoH 16
BBa_K1897031B0033 with flanking Scar sites 25
BBa_K1897032B0032 with flanking Scar sites 27
BBa_K1897034B0032-Scar site 19
BBa_K1897036B0033-Scar site 17
BBa_K1906010Ribothermometer A1 42
BBa_K1906011Ribothermometer JB2-B1 42
BBa_K1906012RNAT Mut 42
BBa_K1906013Ribothermometer JB2-C6 42
BBa_K1906014Ribothermometer JB1-A8 42
BBa_K1906015Ribothermometer JB1-B2 42
BBa_K1906016Ribothermometer JB1_B5 37
BBa_K1906017Ribothermometer JB2-B6 42
BBa_K1906018Ribothermometer JB1-G3 42
BBa_K1906019Ribothermometer JB1-G4 42
BBa_K1906020ribothermometer modified A1 to work as positive cpntrol 42
BBa_K1906021ribothermometer  
BBa_K1925000sdasd  
BBa_K1928006jdklajkfl  
BBa_K1968002Synechocystis RBS* Phytobrick 23
BBa_K1992000Tar native RBS 24
BBa_K1993016IRES 588
BBa_K1994002RBS 173k TIRv1 30
BBa_K1994004RBS 28.4k_NEQ RBSCv1.1 47
BBa_K1994007synRBS 9675 TIRv(1 or 2)  30
BBa_K2018026Ribosomal binding site for hlyB 71
BBa_K2018028RBS for hlyD 18
BBa_K2018032RBS for panK 21
BBa_K2027073(pMS-AFa-DEa) pAKP444 RBS 1 extraction 28
BBa_K2027074(pMS-AFa-DEa) pAKP444 RBS 2 extraction 26
BBa_K2042003RBS 7
BBa_K2066510Strong RBS from Lou et. al 2012 12
BBa_K2066515RBS2 (weak) 12
BBa_K2066526B0034 with scar TACTAG  
BBa_K2066527B0034 with scar TACTAG 18
BBa_K2066549Synthetic Enhancer Project: RBS 1
BBa_K208100Rhodobacter sphaeroides RBS 21
BBa_K208101Rhodobacter sphaeroides RBS 21
BBa_K208102Rhodobacter sphaeroides RBS 21
BBa_K208103Rhodobacter sphaeroides RBS 21
BBa_K208104Rhodobacter sphaeroides RBS 21
BBa_K208105Rhodobacter sphaeroides RBS 21
BBa_K208106Rhodobacter sphaeroides RBS 21
BBa_K208107Rhodobacter sphaeroides RBS 21
BBa_K208108Rhodobacter sphaeroides RBS 21
BBa_K2116019RBS designed for sfgfp 35
BBa_K2116020RBS for mNectarine 32
BBa_K2116031RBS for sfGFP 41
BBa_K2116033RBS_esaR 17
BBa_K2116094Salis RBS for BB assembly 32
BBa_K2116999RBS for EsaR 17
BBa_K2138000RNA thermometer and RBS (40C) 2187
BBa_K2138001RNA thermometer and RBS (39C) 2283
BBa_K2138002RNA thermometer and RBS (33C) 2175
BBa_K2182004RBS for BBa_K2182003 22
BBa_K22009991H2IU3G  
BBa_K2205098B0034 (Reversed) 12
BBa_K2232030RBS of B.subtilis 26
BBa_K2241000233?  
BBa_K2284026strong_RBS_including_spacer_Notts 18
BBa_K2285021RBS on sfGFP 24
BBa_K2290004Ribosome Binding Site 14
BBa_K2302012Ribosome Binding Sites 18
BBa_K2306014Efficient RBS from bacteriophage T7 gene 10 and Shine Dalgarno 30
BBa_K2328014RBS I for E.coli 24
BBa_K2328015RBS II  25
BBa_K2328016RBS III for B.longum (with ATG) 26
BBa_K2333008mScarlet-I no stop codon 696
BBa_K2340008Guide RNA construct of human Pkp4 (2) 535
BBa_K234001 -- No description --   
BBa_K234090 -- No description --   
BBa_K2355219Strong promoter with RFC[25] scars and a startcodon 30
BBa_K2378010aaaaaaaaaaaaaaaaaa  
BBa_K2380024RBS B0034 with BpiI recognition site 18
BBa_K2387051RBS with Scars 28
BBa_K2389004RBS for pT8O 15
BBa_K2390002S. Mutans B-9 Responsive Riboswitch 223
BBa_K239008RBS from RpoS  567
BBa_K2406216MoClo RBS B0034 21
BBa_K2417009Extended ribosome binding site 33
BBa_K2418005Extended Ribosome Binding Site (RBS) 45
BBa_K2442210Wild Type RBS from P.fluorescens 83
BBa_K2448000B0034 with scars AGGA and AGATCA 22
BBa_K2448002B0034 like RBS with scars AATT and CAGCT 20
BBa_K2448019RBS (pET like) 25
BBa_K2448020B0034 with scars TAC and CAT 18
BBa_K2448039B0034 with scars GTAC and TACCAT 22
BBa_K2448049B0034 with scars GTAC and CTCGAGG 23
BBa_K2448060B0034 with scars AAATGGAGGA and AGATCA 28
BBa_K2449033SDparM 7
BBa_K2462001RBS 10
BBa_K2462002RBS 10
BBa_K2491021Promoter with RBS (100) 47
BBa_K2491022Promoter with RBS (101) 47
BBa_K2491023Promoter with RBS (110) 47
BBa_K252015f  
BBa_K2541001Heat-inducible RNA-based thermosensor-1 23
BBa_K2541002Heat-inducible RNA-based thermosensor-2 33
BBa_K2541003Heat-inducible RNA-based thermosensor-3 29
BBa_K2541004Heat-inducible RNA-based thermosensor-4 35
BBa_K2541005Heat-inducible RNA-based thermosensor-5 27
BBa_K2541006Heat-inducible RNA-based thermosensor-6 27
BBa_K2541007Heat-inducible RNA-based thermosensor-7 37
BBa_K2541008Heat-inducible RNA-based thermosensor-8 35
BBa_K2541009Heat-inducible RNA-based thermosensor-9 41
BBa_K2541010Heat-inducible RNA-based thermosensor-10 30
BBa_K2541011Heat-inducible RNA-based thermosensor-11 39
BBa_K2541012Heat-inducible RNA-based thermosensor-12 39
BBa_K2541013Heat-inducible RNA-based thermosensor-13 38
BBa_K2541014Heat-inducible RNA-based thermosensor-14 27
BBa_K2541015Heat-inducible RNA-based thermosensor-15 27
BBa_K2541016Heat-inducible RNA-based thermosensor-16 24
BBa_K2541017Heat-inducible RNA-based thermosensor-17 24
BBa_K2541018Heat-inducible RNA-based thermosensor-18 27
BBa_K2541019Heat-inducible RNA-based thermosensor-19 28
BBa_K2541020Heat-inducible RNA-based thermosensor-20 35
BBa_K2541021Heat-inducible RNA-based thermosensor-21 35
BBa_K2541025Heat-inducible RNA-based thermosensor-25 41
BBa_K2541026Heat-inducible RNA-based thermosensor-26 30
BBa_K2541027Heat-inducible RNA-based thermosensor-27 29
BBa_K2541028Heat-inducible RNA-based thermosensor-28 39
BBa_K2541029Heat-inducible RNA-based thermosensor-29 34
BBa_K2541030Heat-inducible RNA-based thermosensor-30 33
BBa_K2541031Heat-inducible RNA-based thermosensor-31 39
BBa_K2541032Heat-inducible RNA-based thermosensor-32 39
BBa_K2541033Heat-inducible RNA-based thermosensor-33 38
BBa_K2541034Heat-inducible RNA-based thermosensor-34 39
BBa_K2541035Heat-inducible RNA-based thermosensor-35 39
BBa_K2541036Heat-inducible RNA-based thermosensor-36 27
BBa_K2541037Heat-inducible RNA-based thermosensor-37 24
BBa_K2541038Heat-inducible RNA-based thermosensor-38 24
BBa_K2541039Heat-inducible RNA-based thermosensor-39 28
BBa_K2541040Heat-inducible RNA-based thermosensor-40 28
BBa_K2541041Heat-inducible RNA-based thermosensor-41 28
BBa_K2541042Heat-inducible RNA-based thermosensor-42 24
BBa_K2541043Heat-inducible RNA-based thermosensor-43 34
BBa_K2541044Heat-inducible RNA-based thermosensor-44 29
BBa_K2541045Heat-inducible RNA-based thermosensor-45 31
BBa_K2541046Heat-inducible RNA-based thermosensor-46 35
BBa_K2541047Heat-inducible RNA-based thermosensor-47 41
BBa_K2541048Heat-inducible RNA-based thermosensor-48 30
BBa_K2541049Heat-inducible RNA-based thermosensor-49 34
BBa_K2541050Heat-inducible RNA-based thermosensor-50 40
BBa_K2541051Heat-inducible RNA-based thermosensor-51 39
BBa_K2541101Heat-repressible RNA-based thermosensor-1 69
BBa_K2541102Heat-repressible RNA-based thermosensor-2 70
BBa_K2541103Heat-repressible RNA-based thermosensor-3 74
BBa_K2541104Heat-repressible RNA-based thermosensor-4 75
BBa_K2541105Heat-repressible RNA-based thermosensor-5 79
BBa_K2541106Heat-repressible RNA-based thermosensor-6 80
BBa_K2541108Heat-repressible RNA-based thermosensor-8 74
BBa_K2541109Heat-repressible RNA-based thermosensor-9 78
BBa_K2541110Heat-repressible RNA-based thermosensor-10 60
BBa_K2541111Heat-repressible RNA-based thermosensor-11 60
BBa_K2541112Heat-repressible RNA-based thermosensor-12 61
BBa_K2541113Heat-repressible RNA-based thermosensor-13 65
BBa_K2541114Heat-repressible RNA-based thermosensor-14 66
BBa_K2541115Heat-repressible RNA-based thermosensor-15 70
BBa_K2541116Heat-repressible RNA-based thermosensor-16 61
BBa_K2541117Heat-repressible RNA-based thermosensor-17 65
BBa_K2541118Heat-repressible RNA-based thermosensor-18 54
BBa_K2541119Heat-repressible RNA-based thermosensor-19 53
BBa_K2541120Heat-repressible RNA-based thermosensor-20 54
BBa_K2541121Heat-repressible RNA-based thermosensor-21 58
BBa_K2541122Heat-repressible RNA-based thermosensor-22 53
BBa_K2541123Heat-repressible RNA-based thermosensor-23 59
BBa_K2541201Cold-repressible RNA-based thermosensor-1 69
BBa_K2541202Cold-repressible RNA-based thermosensor-2 69
BBa_K2541203Cold-repressible RNA-based thermosensor-3 69
BBa_K2541204Cold-repressible RNA-based thermosensor-4 69
BBa_K2541205Cold-repressible RNA-based thermosensor-5 69
BBa_K2541206Cold-repressible RNA-based thermosensor-6 69
BBa_K2541207Cold-repressible RNA-based thermosensor-7 69
BBa_K2541208Cold-repressible RNA-based thermosensor-8 69
BBa_K2541209Cold-repressible RNA-based thermosensor-9 69
BBa_K2541210Cold-repressible RNA-based thermosensor-10 69
BBa_K2541301Cold-inducible RNA-based thermosensor-1 169
BBa_K2541302Cold-inducible RNA-based thermosensor-2 169
BBa_K2541303Cold-inducible RNA-based thermosensor-3 169
BBa_K2541304Cold-inducible RNA-based thermosensor-4 169
BBa_K2541305Cold-inducible RNA-based thermosensor-5 169
BBa_K2541306Cold-inducible RNA-based thermosensor-6 163
BBa_K2541307Cold-inducible RNA-based thermosensor-7 163
BBa_K2541308Cold-inducible RNA-based thermosensor-8 163
BBa_K2550200RBS for Toehold Switches 8
BBa_K2556021RBS from bacteriophage T7 gene 10 39
BBa_K2556022RBS 25
BBa_K2560008Phytobrick version of BBa_B0034 21
BBa_K2560010Phytobrick version of BBa_B0032 22
BBa_K2560013Phytobrick version of BBa_B0031 23
BBa_K2560016Phytobrick version of BBa_B0030 24
BBa_K2560084Phytobrick version of RBS Dummy 24
BBa_K2586008RBS: Ribosome Binding Site  13
BBa_K2586010Palf4-RBS: Palf4 linked to a RBS 51
BBa_K2593005 its a strong Ribosome Binding Site which is commonly used in bacteria. 17
BBa_K2596010RBS+Spacer from PpsbA2 (Synechocystis sp. 6803) 17
BBa_K2598999111 4089
BBa_K2619012internal ribosome entry site/IRES from Cloning vector pPKm-244 578
BBa_K2621038CAT-Seq Ribosome Binding Site (RBS) 6
BBa_K2633004RBS + scar 30
BBa_K2656008Very Weak Ribosome Binding Site J61100  24
BBa_K2656009Strong Ribosome Binding Site B0030 25
BBa_K2656010Weak Ribosome Binding Site B0032  27
BBa_K2656011Medium Ribosome Binding Site B0034  22
BBa_K2656012Very Low Ribosome Binding Site J61101 22
BBa_K2675010Synthetic RBS designed for AimR of phage phi3T 44
BBa_K2675011Synthetic RBS designed for AimP of Phi3T 38
BBa_K2675012Synthetic RBS designed for OmpA-SAIRGA 41
BBa_K2675013Synthetic RBS designed for PelB-SAIRGA 38
BBa_K2675014Synthetic RBS designed for Tat-SAIRGA 35
BBa_K2675015Synthetic RBS designed for sfGFP 45
BBa_K2675016Synthetic RBS designed for sfGFP 30
BBa_K2675017Synthetic RBS designed for sfGFP 30
BBa_K2680529BCD12 84
BBa_K2680530B0033m 20
BBa_K2680531B0032m 22
BBa_K2680561BCD8 84
BBa_K2685025RBS 12
BBa_K2686007T7 RBS 36
BBa_K2715009C.acetobutylicum thiolase gene RBS 27
BBa_K2715020C.sporogenes ferredoxin gene RBS 36
BBa_K2715022C.difficile Toxin A promoter RBS 29
BBa_K2715024C.difficile Toxin B promoter RBS 30
BBa_K2717029RBS2000 reverse 28
BBa_K2717030RBS2000 28
BBa_K2753036RBSsp1 20
BBa_K2753037RBSsp2 20
BBa_K2753053RBStrGPPS 56
BBa_K2753054Charles RBS 14
BBa_K2753070RBSobGES 24
BBa_K2760006RBS for Lactobacillus rhamnosus GG 45
BBa_K2761006RBS for Cas1-Cas2  12
BBa_K27650241000bp Homologous arm+ura(△yno1) 2804
BBa_K2779906RBS from pBAD 33
BBa_K2782000Ribosome binding site preceding the repressor protein sequence of the fatty acid operon 29
BBa_K2782003Ribosome binding site before the red fluorescent protein sequence 15
BBa_K2782009Glyoxylate operon ribosome binding site 15
BBa_K2787035orthogonal ribosome binding site A2 17
BBa_K2787036orthogonal ribosome binding site B8 18
BBa_K2787037orthogonal ribosome binding site C9 18
BBa_K2796071Its a RBS  
BBa_K2797000RBS for streptomycin resistance 12
BBa_K2800016RBS2 15
BBa_K2800019RBS1 12
BBa_K2800031RBS strength is 10 24
BBa_K2800032RBS strength is 1000 27
BBa_K2800033RBS strength is 10000 26
BBa_K2800034RBS strength is maximum 20
BBa_K2809001Kozak sequence (Pichia pastoris) 7
BBa_K2814014complement of BBa_B0034 15
BBa_K2842671RBS 24
BBa_K2842684RBS 22
BBa_K2842698RBS afafafafowoeodek 27
BBa_K2842704RBS 18
BBa_K285201mrgA rbs 27
BBa_K2857013P1-GFP RBS (Salis lab) 25
BBa_K2857014P2-GFP RBS (Salis lab) 36
BBa_K2857015P3-GFP RBS (Salis lab) 35
BBa_K2857016P4-GFP RBS (Salis lab) 37
BBa_K2857017P5-GFP RBS (Salis lab) 26
BBa_K2857018P6-GFP RBS (Salis lab) 27
BBa_K2857019P70-GFP RBS (Salis lab) 20
BBa_K2857020P71-GFP RBS (Salis lab) 24
BBa_K2857021P9-GFP RBS (Salis lab) 29
BBa_K2857022P8-GFP RBS (Salis lab) 23
BBa_K2888011Test RBS 600
BBa_K2906017RBS from T7 bacteriophage  8
BBa_K2918013BBa_B0032 RBS and SarJ 98
BBa_K2918014Universal RBS 10
BBa_K2918035BBa_B0032 RBS and RiboJ 94
BBa_K2918036SarJ and Universal RBS 89
BBa_K2918038RiboJ and Universal RBS 85
BBa_K2924009RBS* 24
BBa_K2924053RBS from pET22b 44
BBa_K2927001Ribosome binding site 23
BBa_K2933024RBS 7
BBa_K2933039RBS a 6
BBa_K29340075' UTR derived from pBE-S for Bacillus subtilis 40
BBa_K2935004nnn 44
BBa_K294120nasa  
BBa_K2942701a kind of riboswitch developed from the hammerhead ribozyme from the satellite RNA of tobacco ringsp 125
BBa_K2943900Improved RBS  21
BBa_K2943903an improved rbs 21
BBa_K2943905an improved rbs 19
BBa_K2963006RBS - recognized by Corynebacterium glutamicum 9
BBa_K2963010RBS18 - a designed SD sequence for racE 36
BBa_K2963011RBS20 - a designed SD sequence for racE 35
BBa_K2963025RBS180 - a designed SD sequence for racE 36
BBa_K2963026RBS200 - a designed SD sequence for racE 33
BBa_K2963027RBS2000 - a designed SD sequence for racE 33
BBa_K2963028RBS18000 - a designed SD sequence for racE 31
BBa_K2963034RBS-H - recognized by Corynebacterium glutamicum 27
BBa_K2963035RBS-L - recognized by Corynebacterium glutamicum 25
BBa_K2967001strong rbs site 28
BBa_K2969990RBS=3000 24
BBa_K2969994RBS-4 14
BBa_K2969997RBS-3 14
BBa_K2969998RBS-2 32
BBa_K2969999RBS-1 33
BBa_K2971011Ribosomal binding site 42
BBa_K2974701trial 1 9
BBa_K2978102Strong RBS 18
BBa_K2978207Lactobacillus spp Ribosomal Binding Site 17
BBa_K2978306Ribosomal Binding Site Reverse Complement 17
BBa_K2985008RBS->a designed SD sequence for sacB 18
BBa_K2992011RBS region for botR gene from C. botulinum  20
BBa_K2992031RBS region for the ctfA gene from C. acetobutylicum 20
BBa_K2992032RBS region for the ctfA gene from C. botulinum 20
BBa_K2992033RBS region for the adc gene from C. acetobutylicum. 20
BBa_K3003044RBS 12
BBa_K3027005RBS in pBAD24-MoClo (Golden Gate compatible)  12
BBa_K3033002Ribosome binding site (pET11a) 23
BBa_K3033003Ribosome binding site (pBAD24) 31
BBa_K3059412MSMEG_2389 5' UTR 39
BBa_K3059413MSMEG_3050 5' UTR 74
BBa_K3059601RBSII 9
BBa_K3059608RBSG 19
BBa_K3059615RBSH 17
BBa_K3059620pre-csgE RBS 38
BBa_K3076801RBS derived from pET151 expression vector 23
BBa_K3078008RBS in front of hpaA 9
BBa_K3078011RBS from pVE5523 95
BBa_K3083005RBS for pBAD promoter 41
BBa_K3083008Ptac RBS 21
BBa_K3086004Ribosome binding site 19
BBa_K3086006Ribosome binding site 36
BBa_K3096000RBS 15
BBa_K3098004Rbs of Gluconacetobacter xylinus 13
BBa_K3105111RBS with ribosome standby site  30
BBa_K3113003kozak 9
BBa_K3120010IRES 576
BBa_K3127007RBS for CcaS 13
BBa_K3135002(Elowitz 1999) -- defines RBS efficiency 12
BBa_K3135003x0 59
BBa_K3135004y0 38
BBa_K3135011y1 37
BBa_K3135012y2 36
BBa_K3135013y3 35
BBa_K3135014y4 39
BBa_K3135015y5 40
BBa_K3135016y6 41
BBa_K3135017y7 42
BBa_K3135018y8 43
BBa_K3135019y9 38
BBa_K3135020y10 38
BBa_K3135021y11 38
BBa_K3135022y12 38
BBa_K3135023y13 38
BBa_K3135024y14 38
BBa_K3135025y15 39
BBa_K3135026y16 39
BBa_K3135027y17 39
BBa_K3135028y18 39
BBa_K3135029y19 39
BBa_K3136003B0034-typeIIS 12
BBa_K3136010B0034-RBS-A 18
BBa_K3136011B0034-RBS-B 17
BBa_K3136012B0034-RBS-C 26
BBa_K3136013B0034-RBS-D 25
BBa_K3137001Improved RBS 4 11
BBa_K3143683RBS-1 18
BBa_K3143685RBS-2 15
BBa_K3143687RBS-3 31
BBa_K3158003B0034 12
BBa_K3158025B0034-RBS-A 18
BBa_K3158027B0034-RBS-B 17
BBa_K3158029B0034-RBS-C 26
BBa_K3158031B0034-RBS-D 25
BBa_K3165004sRBS (250) 34
BBa_K3165005sRBS (30000) 35
BBa_K3183020Operon Spacer for E. coli 32
BBa_K3183026Spacer between AgrA and AgrC 65
BBa_K3189007RBS 36
BBa_K3192000Custom RBS Optimized for BBa_K3192020 25
BBa_K3192001Custom RBS Optimzed for BBa_K3192021 25
BBa_K3192002Custom RBS Optimzed for BBa_K3192022 25
BBa_K3192004Custom RBS Optimzed for BBa_K3192015 25
BBa_K3192005Custom RBS Optimzed for BBa_K3192016 25
BBa_K3192006Custom RBS Optimzed for BBa_K3192017 25
BBa_K3192007Custom RBS Optimzed for BBa_K3192019 25
BBa_K3192008Custom RBS Optimzed for BBa_K2259018 54
BBa_K3192009Custom RBS Optimzed for BBa_K2259019 32
BBa_K3192030Custom RBS Optimzed for BBa_K3192018 25
BBa_K3196001Kozak 11
BBa_K3197002oxidase->RBS 20
BBa_K3202021RBS1 45
BBa_K3202026RBS2 38
BBa_K3202028B0034 12
BBa_K3206013pET RBS 13
BBa_K3215000phnE RBS 54
BBa_K3222002RBS for PURE system 14
BBa_K3228054pMC_0_3_12_riboJ_B0034 97
BBa_K3228055pMC_0_3_13_riboJ_B0034_noScar 91
BBa_K3228056pMC_0_3_14_SarJ_B0034 101
BBa_K3228057pMC_0_3_15_PlmJ_B0034 104
BBa_K3229294BBa_0030 RBS reverse complement 15
BBa_K3247012Type IIS compatible BBa_B0034 with RFC10 scar context 23
BBa_K3252025Medium Ribosome Binding Site BBa_B0034 12
BBa_K3252026Medium Ribosome Binding Site BBa_B0032 13
BBa_K3252027Very Weak Ribosome Binding Site BBa_B0033 11
BBa_K3254019A RBS used in BBa_K3254011 25
BBa_K3254020A RBS used in BBa_K3254012 27
BBa_K3254021A RBS used in BBa_K3254013 34
BBa_K3254028A RBS used in BBa_K3254026 21
BBa_K3254029A RBS used in BBa_K3254027 40
BBa_K3257010Bacterial RBS 12
BBa_K3257011T7 RBS 23
BBa_K3265022RBS 63
BBa_K3286013RBS_11 14
BBa_K3286014RBS_C7 14
BBa_K3286015RBS_B10 14
BBa_K3286016RBS_D2 15
BBa_K3286017RBS_B6 14
BBa_K3286018RBS_A12 14
BBa_K3286019RBS_A9 14
BBa_K3288005Cdog (strong rbs) 95
BBa_K3288006NO29 (strong abs) 42
BBa_K3288007strong RBS derived from pDawn 38
BBa_K3296002B0034 RBS 12
BBa_K3308042T7 derived Ribosome Binding Site  16
BBa_K3308062T7 Translational Ribosome Binding Site  17
BBa_K3308094pKLD66 (pTEV6) Ribosome Binding Site 17
BBa_K3317015RBS designed for Protocatechuate decarboxylase (aroY) with sp 29
BBa_K3317016RBS designed for Catechol 1,2-dioxygenase (catA) with ps 31
BBa_K3317017RBS designed for Vanillate O-demethylase (LigM gene)   
BBa_K3317018RBS designed for Vanillate O-demethylase (LigM gene) with sp 33
BBa_K3317019RBS designed for pduU mod 36
BBa_K3317021RBS designed for VanR repressor 35
BBa_K3317022RBS designed for pCaU repressor 38
BBa_K3317055RBS designed to maximize NucE expression in E.coli K12 32
BBa_K3317056RBS designed to maximize NucD expression in E.coli K12 32
BBa_K3317057RBS designed to maximize NucA expression in E.coli K12 35
BBa_K3317058RBS designed for φX174E overexpression in E.coli K12 35
BBa_K331706737 C inducible RNA thermometer 121
BBa_K3317068Synthetic RBS in pMF35 24
BBa_K3317072MF002 24
BBa_K3320012RBS (J. Anderson, 2005) 13
BBa_K3331026araBAD RBS 7
BBa_K3332036RBS1 9
BBa_K3338004Internal ribosome entry site (IRES) for use in eukaryotic cells 574
BBa_K3351001A ribosome binding site from pet28a plasmid. 23
BBa_K3352002Extended RBS 23
BBa_K3356000RBS region for bdhA 20
BBa_K3360006synthetic rbs 27
BBa_K3365002RBS 20
BBa_K3386005RBS associated with pMphR 12
BBa_K3395003RBS 23
BBa_K3395012RBS2 28
BBa_K3425031RBS for Type IIS iGEM Standard Assembly 18
BBa_K3425032RBS for Type IIS iGEM Standard Assembly 17
BBa_K3425033RBS for Type IIS iGEM Standard Assembly 20
BBa_K3425048Juniper GFP for Type IIS iGEM standard assembly 705
BBa_K3453005Synthetic RBS stem-loop designed for standard toehold switches 25
BBa_K3457007RBS0034 12
BBa_K3463003 RBS eGFP and RhlR (RhlR construction) 25
BBa_K3463009RBS eGFP 25
BBa_K3463010RBS LacI 25
BBa_K3463012Ptac RBS GFP low 25
BBa_K3463013Ptac RBS GFP high 25
BBa_K3463014Ptac RBS GFP low 25
BBa_K3463015Ptac RBS E7 50% 25
BBa_K3463016Ptac RBS E7 25% 25
BBa_K3463021RBS mCherry High 26
BBa_K3463022 RBS mCherry low 26
BBa_K3498014Evolved RBS for VanRAM 29
BBa_K3498015RBS for Rsn-2 34
BBa_K3498016RBS for Rsn-3 25
BBa_K3498017RBS for Rsn-4 25
BBa_K3498018RBS for Rsn-5 25
BBa_K3498019RBS for PhrC 25
BBa_K3498020RBS for sfp 25
BBa_K3498021RBS for Spo0E 25
BBa_K3498022RBS for AbrB 25
BBa_K3498023RBS for SinI 25
BBa_K3498024RBS for AbbA 25
BBa_K3520008Flavobacteria RBS 5
BBa_K3552030GGAGG 5
BBa_K3560003DrRBS 5
BBa_K356105Desinged RBS 14
BBa_K356106Desinged RBS 16
BBa_K3579001RBS_sodA 64
BBa_K3579003EpiFlex_SaTIR 74
BBa_K3579004EpiFlex_gsiB 63
BBa_K3584007RBS in tyrP 29
BBa_K3585000the RBS in pMTL83151 14
BBa_K3587002RBS for Ada protein  
BBa_K3587003RBS for Ada protein  
BBa_K3587004RBS for Ada protein 15
BBa_K3590001RBS R0 24
BBa_K3590002RBS R1 21
BBa_K3590003RBS R2 20
BBa_K3594100an interesting gene 49
BBa_K3596002hofB RBS 20
BBa_K3596004hofM RBS 44
BBa_K3596006ppdA RBS 18
BBa_K3596008ppdA RBS mut1 18
BBa_K3596009ppdA RBS mut2 18
BBa_K3596010hofB RBS mut1 20
BBa_K3596011hofB RBS mut2 20
BBa_K3596012hofM RBS mut 44
BBa_K3598014RBS 20
BBa_K3598023RBS0 20
BBa_K3598024RBS1 20
BBa_K3598025RBS3 20
BBa_K3598026RBS5 20
BBa_K3598027RBS7 20
BBa_K3598028RBS9 20
BBa_K3598029RBS11 20
BBa_K3598030RBS13 20
BBa_K3598031RBS15 20
BBa_K3598032RBS15 20
BBa_K3598033RBS19 20
BBa_K3598034RBS21 20
BBa_K3598035RBS23 20
BBa_K3598036RBS25 20
BBa_K3598037RBS27 20
BBa_K3598038RBS29 20
BBa_K3599000Ribosome Binding Site 23
BBa_K3599013RBS 2 12
BBa_K360031Strong RBS with spacer. 11
BBa_K3601004Strong RBS 23
BBa_K3612029RBS of Pasp promoter 6
BBa_K3612030RBS of pSHAB 4
BBa_K3612031RBS of pMAV promoter 72
BBa_K3628013RBS1 between HpaB and HpaC 17
BBa_K3628014RBS2 control HpaB 45
BBa_K3628015RBS3 between HpaB SMS and HpaC SMS 34
BBa_K3630002A ribosome binding site, or ribosomal binding site (RBS) 6
BBa_K3665006RBS4 ，Regulating the expression of atLCD  25
BBa_K3665007Regulating the expression of atLCD 25
BBa_K3665008Regulating the expression of atLCD 25
BBa_K3712012pR/pL RBS 11
BBa_K3715082RBS 7
BBa_K3716001RBS(pet28a) 23
BBa_K3726006RBS_PhaB^173S 25
BBa_K3726007RBS_ccr 26
BBa_K3726008RBS_PhaJ 38
BBa_K3726009RBS_PduP_MediumExpression 25
BBa_K3726010RBS_Slr1192_MediumExpression 25
BBa_K3726020RBS_pKpA 33
BBa_K3726022RBS_mdh  
BBa_K3726024RBS_garK 29
BBa_K3726026RBS_garR 25
BBa_K3726030RBS_gcl 25
BBa_K3726032RBS_mtkA 31
BBa_K3726034RBS_mtkB 25
BBa_K3726036RBS_mcl 25
BBa_K3726082RBS BCD2(Mod)  
BBa_K3726086RBS BCD2(Mod) 93
BBa_K3726088RBS_NphT7 33
BBa_K3726089RBS_Slr1192_HighExpression 25
BBa_K3726090RBS_PduP 38
BBa_K3726091RBS_ppc 33
BBa_K3726092RBS_PtaBs 55
BBa_K3726093RBS* 10
BBa_K3740008RBS009 12
BBa_K3740010RBS010 12
BBa_K3740018RBS004 12
BBa_K3740025RBS150 28
BBa_K3740026RBS300 27
BBa_K3740027RBS II 10
BBa_K3740028RBS1000 27
BBa_K3740039RBS400 24
BBa_K3745004RBS on pSC101 12
BBa_K3745005EC6015/Bujard RBS for biosensor 57
BBa_K3758070atpB 5-UTR (Nicotiana tabacum) 255
BBa_K3758071atpB 5-UTR (+10) (Nicotiana tabacum) 265
BBa_K3758072atpB 5-UTR (-90 to +10 processed) (Nicotiana tabacum) 100
BBa_K3758073atpB 5-UTR (TCR processed -90) (Nicotiana tabacum) 132
BBa_K3758074atpH 5-UTR (-45 processed) (Nicotiana tabacum) 45
BBa_K3758075psbN 5-UTR (Nicotiana tabacum) 47
BBa_K3758076psbN 5-UTR (processed) (Nicotiana tabacum) 39
BBa_K3758077psbB 5-UTR (Nicotiana tabacum) 175
BBa_K3758078ndhD 5-UTR (Nicotiana tabacum) 118
BBa_K3758079rps2 mAAGA 5-UTR (Nicotiana tabacum) 42
BBa_K3758080rps2 mCCUC 5-UTR (Nicotiana tabacum) 42
BBa_K3758081rps2 mAAGA 5-UTR (-20 to -10 deletion) (Nicotiana tabacum) 32
BBa_K3758082rps2 mCCUC 5-UTR (-20 to -10 deletion) (Nicotiana tabacum) 32
BBa_K3758083psbH 5-UTR (Startcodon + 1AA) (Nicotiana tabacum) 58
BBa_K3758084psbA 5-UTR (SNM) (Nicotiana tabacum) 88
BBa_K3758085psbA 5-UTR (SEM) (Nicotiana tabacum) 88
BBa_K3758086psbA 5-UTR (deltaSL) (Nicotiana tabacum) 53
BBa_K3758087psbA 5-UTR (delta5-SL) (Nicotiana tabacum) 48
BBa_K3758088psbA-rbcL 5-UTR (R-SLWT) (Nicotiana tabacum) 108
BBa_K3758089rps14 5-UTR (Nicotiana tabacum) 122
BBa_K3758090rbcL 5-UTR (Nicotiana tabacum) 182
BBa_K3758091rbcL 5-UTR (processed) (Nicotiana tabacum) 58
BBa_K3758092rbcL 5-UTR (+14AA) (Nicotiana tabacum) 100
BBa_K3758093rrn16 5-UTR (Nicotiana tabacum) 114
BBa_K3758094rrn16 5-UTR (+37) (Nicotiana tabacum) 37
BBa_K3758095psbA 5-UTR (Nicotiana tabacum) 88
BBa_K3758096Synthetic 5-UTR (Nicotiana tabacum) 56
BBa_K3758097psbC 5-UTR (Nicotiana tabacum) 230
BBa_K3758098accD 5-UTR (Nicotiana tabacum) 180
BBa_K3758099clpP 5-UTR (Nicotiana tabacum) 48
BBa_K3758100rbcL 5-UTR (Spinacia oleracea) 162
BBa_K3758101ndhC 5-UTR (Spinacia oleracea) 270
BBa_K3758102ndhB 5-UTR (Spinacia oleracea) 214
BBa_K3758103atpB 5-UTR (Spinacia oleracea) 453
BBa_K3758104psaC 5-UTR (Oryza sativa) 264
BBa_K3758105psbA 5-UTR (Oryza sativa) 78
BBa_K3758106psbB 5-UTR (Oryza sativa) 197
BBa_K3758107rpl23 5-UTR (Oryza sativa) 73
BBa_K3758108rpl32 5-UTR (Oryza sativa) 198
BBa_K3758109rps12 5-UTR (Oryza sativa) 397
BBa_K3758110rps19 5-UTR (Oryza sativa) 107
BBa_K3758111T7 gene10 5-UTR 63
BBa_K3758113rpl33 5'UTR Triticum aestivum 277
BBa_K3758114rps4 5-UTR (Triticum aestivum) 128
BBa_K3758115rps12 5-UTR (Triticum aestivum) 222
BBa_K3758116rps19 5-UTR (Triticum aestivum) 130
BBa_K3758117rbcL 5-UTR (full) Triticum aestivum 317
BBa_K3758118psbA 5-UTR Triticum aestivum 81
BBa_K3758119atpB 5-UTR Triticum aestivum 297
BBa_K3758120psaC 5-UTR Tritcum aestivum 377
BBa_K3758121atpB 5-UTR (Quercus robur) 506
BBa_K3758122psbA 5-UTR (Quercus robur) 92
BBa_K3758123rbcL 5-UTR (Quercus robur) 140
BBa_K3758124Synthetic 5-UTR 115
BBa_K3758125Synthetic 5-UTR 2 125
BBa_K3758126Synthetic 5-UTR 3 86
BBa_K3758127Synthetic 5-UTR 4 51
BBa_K376001Super RBS 24
BBa_K3763000RBS improved on the basis of BBa_B0030 15
BBa_K3763046RBS（EBW25113/RBS_fumB） 52
BBa_K3766031RBS for TetR in reverse orientation 18
BBa_K3766032RBS from pET26b with XbaI and SalI 29
BBa_K3766033Synthetic RBS designed for mCherry (reverse orientation) 24
BBa_K3766034Synthetic RBS designed for sfGFP 27
BBa_K3766035Synthetic RBS designed for LacI 29
BBa_K3766190LacI in the Evolution.T7 mutational region 1694
BBa_K3769011T7RBS 23
BBa_K3773007clpB RBS native to E. coli 9
BBa_K3773008RBS-containing region provided by Ceroni et al., 2015 for TL sensor 32
BBa_K3773015RBS-containing region following P70a 35
BBa_K37770301 28
BBa_K3778013RBS (Ribosome-binding site ) 23
BBa_K3782013crRNA leader sequence 133
BBa_K3782018cspA 5′-UTR 134
BBa_K3790084RBS for Gram-positive species (Schofield, 2003) 17
BBa_K3793001Ribosomal Binding site for E. coli 12
BBa_K3796001Corynebacterium glutamicum strong RBS 9
BBa_K3796005Corynebacterium glutamicum weak RBS 10
BBa_K3796212A strong strength RBS 9
BBa_K3798018RBS for B. subtilis 5
BBa_K3799051DEMO 2 134
BBa_K3812011RBS 64
BBa_K3814011PilE + RBS, ACIAD3314 447
BBa_K3814047RBS for TcR gene 9
BBa_K3820010Xanthomonas Oryzae RBS 20
BBa_K3822000Toehold Switch 84
BBa_K3831005Synthetic RBS_a 22
BBa_K3831006Synthetic RBS_b 33
BBa_K3831007Native RBS R2 21
BBa_K3831008RBS R6 22
BBa_K3831009Synthetic RBS_c 27
BBa_K3831014Native RBS R1 21
BBa_K3831018Native RBS R0 24
BBa_K3831020Artificial RBS R3 22
BBa_K3831047Synthetic RBS_c - reversed 27
BBa_K3831049RBS R6 - reversed 22
BBa_K3831051RBS R2 - reversed 21
BBa_K3831053Synthetic RBS_b - reversed 33
BBa_K3831055Synthetic RBS_a - reversed 22
BBa_K3832003medium RBS 10
BBa_K3832004medium RBS 14
BBa_K3832005weak RBS 11
BBa_K3842013RBS 25
BBa_K3846102Strong RBS (Phytobrick) 20
BBa_K3854000Yeast RBS 12
BBa_K3858008PYD1 RBS  
BBa_K3858009PYD1 RBS 40
BBa_K3861009sicP RBS 46
BBa_K3861014fimH RBS 14
BBa_K3875028RBS: aggaga 6
BBa_K3875029RBS: aacaattgaaattattcctc 21
BBa_K3885111UTR1 40
BBa_K3885112UTR2 35
BBa_K3885113UTR3 35
BBa_K3892009Spacer-RBS-Spacer 45
BBa_K3892010G-10 leader and RBS 36
BBa_K3893019Reverse of BBa_B0034 / RBS2 o RBS 12
BBa_K3893021Reverse of BBa_K3893000 / ShineDalgarno for E. coli 11
BBa_K3893022Reverse of BBa_B0032 / RBS3 13
BBa_K38950135' UTR/RBS_KerA 59
BBa_K3898200P-M122 729
BBa_K389820134 3
BBa_K389820433 3
BBa_K3900015'UTR and native RBS from psbA2 in Synechocystis sp. PCC 6803 49
BBa_K3900025'UTR and consensus RBS from psbA2 in Synechocystis sp. PCC 6803 49
BBa_K3910010Ribosomal Binding Site 3 11
BBa_K3910998P1 Ribosome Binding Site 22
BBa_K3914007Ribosome bingding site of Esa box 12
BBa_K3929035RBS_pSEVA238-Intimin 6
BBa_K3929040RBS_pSEVA238-Intimin  
BBa_K3929041RBS_pSEVA228-Intimin 4
BBa_K393002short RBS 12
BBa_K3933008RBS optimized for TetR 48
BBa_K3933009RBS optimized for Ldh 50
BBa_K3937009RBS_on_pHT01 8
BBa_K3940012RBS T7 Gene 10 23
BBa_K3946015Trc-RBS (RN) 67
BBa_K39720065-UTR with g10-L RBS 54
BBa_K3978043neget-cI-RBS  
BBa_K3978044neget-cIDN -RBS  
BBa_K3985008E. coli consensus RBS 6
BBa_K3985014E. coli consensus RBS 9
BBa_K3985023RBS strong for B. subtilis 21
BBa_K3985029E. coli RBS 12
BBa_K4011990RBS test 4
BBa_K4011992zsrbs 12
BBa_K4011995zsrbs2 8
BBa_K4017002Ribosome Binding Site 12
BBa_K4019007RBS (upstream of 4-coumarate-CoA ligase) 39
BBa_K4023002RBS  15
BBa_K4046050Kozak Sequence (Human RBS) 6
BBa_K4054001T7 RBS 23
BBa_K4056013Reverse RBS with 6bp spacer 21
BBa_K4059006RBS for T7 promoter  
BBa_K4062005lacZ RBS 17
BBa_K4062007lacY RBS 30
BBa_K4062018lacZ RBS mutation 17
BBa_K4065001RBS designed for CFP protein in B. subtilis 30
BBa_K4065003RBS designed for CAS9 protein in B. subtilis 34
BBa_K4065004RBS designed for YokF protein in B. subtilis 43
BBa_K4074002SpoVG (rbs) 12
BBa_K4078000RBS Region from pTrc-trGPPS(CO)-LS 32
BBa_K4108000RBS part for testing the judging form 30
BBa_K4117666RNA Thermometer (U23-) 42
BBa_K4132004Ribosome binding site for silicateins and urease 6
BBa_K4133004RBS_tuf33 (Lactobacillus plantarum) 76
BBa_K4133008RBS_Lp (Lactobacillus plantarum WCFS1) 14
BBa_K4133011RBS_Lc (Lactococcus lactis) 12
BBa_K4137015pET28a(+) RBS + 5' UTR 12
BBa_K4140002TyrR RBS 14
BBa_K4144001An intrinsic RBS in pHT01K for inserted fragments to be translated. 10
BBa_K4144012An improved RBS to reduce the leakage expression of promoter Pxyl 17
BBa_K4149222RBS in Escherchia 7
BBa_K4150000g10.RBS 58
BBa_K415145p8Acid  
BBa_K4156081RBS spoVG 21
BBa_K4156093BCD2 85
BBa_K4159001RBS (Olins and Rangwala, 1989) 23
BBa_K4162006T7_RBS 17
BBa_K4165016PGS-21a Ribosomal binding site 44
BBa_K4165075RBS 5 42
BBa_K4165095RBS 6 22
BBa_K4165260Ubiquitin WT RBS 24
BBa_K4165261RBS 1 43
BBa_K4165262RBS 2 61
BBa_K4165263RBS 3 41
BBa_K4165264RBS4 60
BBa_K4165265RBS 5 44
BBa_K4169023a theophylline-inducible riboswitch 63
BBa_K4170018RBS from bacteriophage T7 gene 10 23
BBa_K4170053RBS derived from E.coli (for RhaS expression) 24
BBa_K4171026RBS for tyrP 15
BBa_K4177000shiyizhongqidongzi   
BBa_K4190001Shine-Dalgarno Sequence 23
BBa_K4192000Strong RBS of Pseudomonas fluorescens 5
BBa_K4192001RBS of E.coli 6
BBa_K4192002RBS of Pseudomonas fluorescens 4
BBa_K4194009RBS 6
BBa_K4205114RBS 26
BBa_K4209015RBS 9
BBa_K4209017RBS 6
BBa_K4211029TATA 5
BBa_K4212016RBS1 13
BBa_K4212017RBS2 13
BBa_K4212018RBS3 6
BBa_K4212019Optimal_RBS 16
BBa_K4216012U2m (BCD11) 84
BBa_K4216013U4m (BCD) -> Very Srong RBS 34
BBa_K4216014U6m (BCD)->Medium Rbs (0.2-0.5) 84
BBa_K4216015U8m (BCD) -> weak RBS (Weak (0.08 - 0.2)) 84
BBa_K4216016U1d (NON BCD) -> Medium Weiss RBS 22
BBa_K4216017U2d (NON BCD) -> Weak Weiss RBS 20
BBa_K4216018U3d (NON BCD) ->Strong Weiss RBS 21
BBa_K4229004RBS pCDF-Duet-1 MCS1 and MCS2 6
BBa_K4229005RBS for FRE 25
BBa_K4229006RBS for TnaB 25
BBa_K4229038RBS for the T proteins in the BMCs 12
BBa_K4229039RBS for the H protein of the BMCs 20
BBa_K4229058RBS for sfGFP 17
BBa_K4241012TIR-2 translation initiation region 2 38
BBa_K4253010ribosome binding site 12
BBa_K4256106ribosome binding site 23
BBa_K4271006pNP RBS 21
BBa_K4271016AsPhoU RBS 21
BBa_K4274013Synthetic RBS1 in pJOE8999 8
BBa_K4274014Synthetic RBS2 in pJOE8999 8
BBa_K4274015Synthetic RBS1 in pHY300PLK 18
BBa_K4274016Synthetic RBS1 in pHT43 34
BBa_K4274017Synthetic RBS2 in pHT43 23
BBa_K4274018Synthetic RBS3 in pHT43 41
BBa_K4286527cbh1 leader sequence 17
BBa_K4288004GsiB RBS 11
BBa_K4291004RBS_tnaC  
BBa_K4294004Synthetic RBS Ath4 29
BBa_K4294005RBS Ath5 29
BBa_K4294010Synthetic RBS Ath10 29
BBa_K4294011Synthetic RBS Ath11 29
BBa_K4294012Synthetic RBS Ath12 28
BBa_K4294013Synthetic RBS Ath13 29
BBa_K4294101BCD1 84
BBa_K4294102BCD2 88
BBa_K4294114BCD14 88
BBa_K4294151RBS lac1 28
BBa_K4294190tet1 synthetic RBS 28
BBa_K4294559Elowitz RBS with modified spacer region 27
BBa_K4294596Elowitz RBS with modified spacer region 26
BBa_K4294659Elowitz RBS with modified spacer region and an upstream Epsilon motif 36
BBa_K4294696Elowitz RBS with modified spacer region and an upstream Epsilon motif 39
BBa_K4310003Kozak sequence for Chlorella Vulgaris 23
BBa_K4324200RBS for E. coli 15
BBa_K4325002RBS070 12
BBa_K4325006RBS003422 (B0034 derivative) 10
BBa_K4344028Kozak Sequence (human RBS) 11
BBa_K4344061Shine-Dalgarno 7
BBa_K4345015pSynSens2.5000 RBS 35
BBa_K4348059ADC A RBS 35
BBa_K4348060ADC D RBS 35
BBa_K4348061ADC C RBS 35
BBa_K4348062ismA RBS 35
BBa_K4348063AKR1D1 RBS 35
BBa_K4348064AKR1C4 RBS 35
BBa_K4348120blah 5
BBa_K4358015Ribosome binding site 10
BBa_K4358998Test  
BBa_K4358999Test  
BBa_K4370007RBS_STREPTO 20
BBa_K43730055'UTR including RBS for Bacillus subtilis 75
BBa_K4382009RBS for Bacillus Subtilis 15
BBa_K4387020Strong Ribosome Binding Site 12
BBa_K4388011Strong RBS with Upstream Linker Sequence Replacing Promoter 53
BBa_K4392000Ribosome binding site associated with the T7 system from the T7 bacteriophage 57
BBa_K4401001RBS 10
BBa_K4402001RBS 10
BBa_K4408000RBS of adhE2   
BBa_K4408001RBS of adhE2  6
BBa_K4415004Human kozak sequence 13
BBa_K4417008RBS in pCT5c 28
BBa_K4432010Synthetic RBS designed for CrtW 28
BBa_K4432011Synthetic RBS designed for CrtO 27
BBa_K4432012Synthetic RBS designed for idi 36
BBa_K4432013Synthetic RBS designed for dxs 32
BBa_K4432014Synthetic RBS designed for Pseudomonas aeruginosa PhzA1-G1 operon 27
BBa_K4432015Synthetic RBS designed for Pseudomonas aeruginosa PhzA2-G2 operon 25
BBa_K4435015TU_RBS 20
BBa_K4437500DeadRBS (non-coding) 15
BBa_K4450008Ribosomal binding site 19
BBa_K4458999The Alverno_Ca team characterized BBa_K2066035, which contains BBa-B0034, as well as a series of oth 12
BBa_K4462010RBS.15 12
BBa_K4472997RBS 1 8
BBa_K4477006RBS for expression of human/mouse anti-apoB(MDA) antibody light chain 27
BBa_K4477007RBS for expression of human/mouse anti-apoB(MDA) antibody heavy chain 26
BBa_K4477008RBS for scFv expression (IK17) 30
BBa_K4477009RBS for scFv expression (McPC603) 31
BBa_K4477010RBS for camelid anti-mouse VHH expression 39
BBa_K4488015RBS  20
BBa_K4514043RBS(KanR) 10
BBa_K4575016efficient ribosome binding site from bacteriophage T7 gene 10 23
BBa_K4578011Ribosome binding site for B. burgdorferi specific surface proteins 6
BBa_K4578012Ribosome binding site for B. burgdorferi specific salivary protein 6
BBa_K4587104RBS from pRSF 6
BBa_K4587113RBS (GFP) 6
BBa_K4587118vicA RBS 6
BBa_K4591006Reversed RBS_BBa_B0034 12
BBa_K4592003Synthetic RBS for Microcystis-optimized eGFP Expression 62
BBa_K4595029RBS-lldp 22
BBa_K4595030RBS-ladhA 22
BBa_K4595031RBS-dsup 22
BBa_K4595032RBS-omcs 22
BBa_K4595033RBS-gshA 22
BBa_K4595034RBS-gshB 22
BBa_K4595035RBS-ycel 12
BBa_K4595036RBS-pncB 12
BBa_K4595037RBS-nadE 12
BBa_K4595038RBS-nadD 12
BBa_K4595039RBS-nadM 12
BBa_K4595040RBS-dsup 12
BBa_K4595041RBS-sodA 12
BBa_K4595042RBS-oprf 14
BBa_K4601100Synthetic RBS designed for CatCh 27
BBa_K4601101Synthetic RBS designed for ChrimsonR 27
BBa_K4601102Synthetic RBS designed for Jaws 25
BBa_K4601103Synthetic RBS designed for NpHR 25
BBa_K4601105Synthetic RBS designed for NpSR 25
BBa_K4601106Synthetic RBS designed for NpHTRII-EnvZ 27
BBa_K4601131Synthetic RBS designed for LacZalpha 28
BBa_K4601132Synthetic RBS designed for LacZalpha 28
BBa_K4601133Synthetic RBS designed for LacZalpha 28
BBa_K4601134Synthetic RBS designed for LacZalpha 28
BBa_K4601141Synthetic RBS designed for AmpR 30
BBa_K4601142Synthetic RBS designed for AmpR 30
BBa_K4601143Synthetic RBS designed for AmpR 30
BBa_K4601144Synthetic RBS designed for AmpR 30
BBa_K4601151RBS for CmR 29
BBa_K4604004modified T7 RBS 14
BBa_K4604030RBS for piG_01a 12
BBa_K4604038MazE RBS 25
BBa_K4604044Riboswitch RBS 28
BBa_K4605013Shine-Dalgarno sequence 9
BBa_K4609058RBS 23
BBa_K4611020RBS from bacteriophage T7 gene 10 23
BBa_K4613098RBS 7
BBa_K4613099RBS(pQE80L) 6
BBa_K4614109RBS for E.coli 6
BBa_K4632013BBa_B0032X（medium）  26
BBa_K4632021RBS32Z 46
BBa_K4632023BBa_B0033 gain from literature 24
BBa_K4633005RBS paraR - the RBS from the promoter for the araR gene from Bacillus subtilis 168 12
BBa_K4633007RBS paraE - the RBS from the promoter for the araE gene from Bacillus subtilis 168 14
BBa_K4634001RBS 23
BBa_K4635009This is the RBS1 of Escherichia coli, which can bind to ribosomes and start the translation of downs 6
BBa_K4635010This is the RBS2 of Escherichia coli, which can bind to ribosomes and start the translation of downs 5
BBa_K4635011This is the RBS3 of Escherichia coli, which can bind to ribosomes and start the translation of downs 5
BBa_K4635012This is the RBS4 of Escherichia coli, which can bind to ribosomes and start the translation of downs 4
BBa_K4635013This is the RBS5 of Escherichia coli, which can bind to ribosomes and start the translation of downs 4
BBa_K4643009Strong RBS 12
BBa_K4645010a new ribosome-binding site 34
BBa_K4645011a new ribosome-binding site 2 32
BBa_K4660004promotor-VbrR 302
BBa_K4660005promotor-BlaI  83
BBa_K4662000RBS initiation 20'000 28
BBa_K4662001RBS initiation 80'000 27
BBa_K4662002RBS initiation 140'000 27
BBa_K4662003RBS initiation 200'000 28
BBa_K4666023RBS-9K 25
BBa_K4691001Modified RBS30 27
BBa_K4691002Modified RBS35 26
BBa_K4691003Modified RBS64 24
BBa_K4691004Modified RBS33 23
BBa_K4696005kink turns (k-turns) are RNA structural motifs that can be bound by a varieties of RNA-binding prote 65
BBa_K4696008(IRES) Internal Ribosome Entry Site 611
BBa_K4701230Synthetic RBS for tpaK 25
BBa_K4701231Synthetic RBS for tphA2 25
BBa_K4701232Synthetic RBS for tphA3 25
BBa_K4701233Synthetic RBS for tphB 25
BBa_K4701234Synthetic RBS for tphA1 25
BBa_K4705000This gene is designed in our system 1. With the function of N-acetyltransferase in lactobacillus pla 149
BBa_K470600410bp Kozak 6
BBa_K4711015alkB(RBS) 25
BBa_K4711016alkG(RBS) 28
BBa_K4711017alkT(RBS) 31
BBa_K4711018GDH(RBS) 6
BBa_K4719006RBS2 12
BBa_K4719007RBS3 12
BBa_K4719008RBS4 12
BBa_K4721010RBS to combine with PV10 promoter 13
BBa_K4721013RBS to combine with Pbla-mut1T  9
BBa_K4728015PhaJ (Hydratase)  
BBa_K4729100RBS FL_A 42
BBa_K4729101RBS T1_A 32
BBa_K4729102RBS T3_A 19
BBa_K4729103RBS FL_G 42
BBa_K4729104RBS GGT 15
BBa_K4729105RBS3 16
BBa_K4733001B. Subtilis RBS 8
BBa_K4735001rbs sequence 37
BBa_K4735009rbs for sfgfp 52
BBa_K4755002pET22B(+) RBS 28
BBa_K4757002synthetic RBS to maximize translation of Gel.Exp.-LCC 27
BBa_K4757003synthetic RBS to maximize translation of mKate2 43
BBa_K4757004synthetic RBS to maximize translation of AlkB 49
BBa_K4757005synthetic RBS to maximize translation of SPpstu-FAST-PETase 42
BBa_K4769606T7 g10-L RBS  
BBa_K4769607T7 g10-L RBS 21
BBa_K4790079RBS 23
BBa_K4796003Strong 5'UTR for Vibrio natriegens (BBa_K3187014 derivative)  
BBa_K4796004Synthetic strong 5'UTR for Vibrio natriegens  
BBa_K4796005Strong 5'UTR for Vibrio natriegens (BBa_K3187014 derivative) 49
BBa_K4807029RBS from pETDuet-1 43
BBa_K4811000repressible RBS (BRA) 24
BBa_K4813019Modified RBS for T7 promoter 41
BBa_K4813021RBS for wild-type hxlAB operon transcription 8
BBa_K4814012Strong RBS 20
BBa_K4818106RBS 5
BBa_K4822995sae_RBS for BBa_K4822005 19
BBa_K4831004RBS_S3* (Thiel et al. 2018) 54
BBa_K4831005RBS_S5* (Thiel et al. 2018) 54
BBa_K4831008RBS_S4* (Thiel et al.) 54
BBa_K4833020This gene transcribes an mRNA sequence which is a ribosome binding site. 14
BBa_K4841014PesaS RBS 27
BBa_K4877018minimal 6bp Kozak sequence 6
BBa_K4891022RBS 5
BBa_K48959985' UTR from genomic E.coli 11
BBa_K48959995 213
BBa_K4902007Modifed Shine-Dalgrano RBS 16
BBa_K4907041T7 RBS 29
BBa_K4911000Modified sequence of a part BBa_J433006 with modified BsaI 3 86
BBa_K4911001Modified sequence of a part BBa_J433003 with modified BsaI 3' fusion site AATG  50
BBa_K4916002trpL Shine-Dalgarno (RBS) sequence 13
BBa_K4927048RBS 23
BBa_K4927056RBS 6
BBa_K4930009Shine-Dalgarno-Sequence  7
BBa_K4931005RBS5 37
BBa_K4931006RBS6 37
BBa_K4931007RBS7 37
BBa_K4931008RBS8 37
BBa_K4931009RBS9 37
BBa_K4931010RBS10 37
BBa_K4931011RBS11 44
BBa_K4931012RBS12 44
BBa_K4931013RBS13 44
BBa_K4931015RBS15 44
BBa_K4931016RBS16 44
BBa_K4934005RBS 18
BBa_K4934006RBS 18
BBa_K4934007RBS 18
BBa_K4934008RBS 18
BBa_K4934009RBS 18
BBa_K4934010RBS 18
BBa_K4934011RBS 18
BBa_K4937012Kozak sequence 6
BBa_K4940004RBS in pCDFDuet-1 6
BBa_K4940006RBS in pQE-80L-Kan 12
BBa_K4940007RBS in pET-28a 7
BBa_K4942003PluxCDABEG 377
BBa_K4943058Riboswitch with Cas9 nuclease (codon optimized) 1039
BBa_K4947007RBS for At4CL1, expressed in E. coli 35
BBa_K4947008RBS for Gu4CL1, expressed in E. coli 35
BBa_K4947009RBS for GmCHS8, expressed in E. coli 35
BBa_K4947010RBS for GmCHR5, expressed in E. coli 35
BBa_K4947011RBS for GuCHR1, expressed in E. coli 35
BBa_K4947012RBS for GmCHIB2, expressed in E. coli 35
BBa_K4947013RBS for GuCHI1, expressed in E. coli 35
BBa_K4947014RBS for MsCHI1, expressed in E. coli 35
BBa_K4947015RBS for CrCPR, expressed in E. coli 34
BBa_K4947016RBS for GmCPR, expressed in E. coli 35
BBa_K4947017RBS for Ge2-HIS, expressed in E. coli 35
BBa_K4947018RBS for TpIFS, expressed in E. coli 35
BBa_K4947019RBS for GmHID, expressed in E. coli 35
BBa_K4948004creRBS 19
BBa_K4948016Strong ribosome binding site from pET vector 23
BBa_K4951000KanR Toehold 1 167
BBa_K4951001KanR Toehold 2 167
BBa_K4951002KanR Toehold 3 167
BBa_K4951003KanR Toehold 4 167
BBa_K4951004KanR Toehold 5 167
BBa_K4951005KanR Toehold 6 167
BBa_K4951006KanR Toehold 7 167
BBa_K4951007KanR Toehold 8 167
BBa_K4951008KanR Toehold 9 167
BBa_K4951009KanR Toehold 10 167
BBa_K4951010AmpR Toehold 1 158
BBa_K4951011AmpR Toehold 2 158
BBa_K4951012AmpR Toehold 3 158
BBa_K4951013AmpR Toehold 4 158
BBa_K4951014KanR Riboswitch 1 176
BBa_K4951015KanR Riboswitch 2 176
BBa_K4951016KanR Riboswitch 3 176
BBa_K4951017KanR Riboswitch 4 176
BBa_K4951018KanR Riboswitch 5 176
BBa_K4951019KanR Riboswitch 6 176
BBa_K4951020KanR Riboswitch 7 176
BBa_K4951021KanR Riboswitch 8 176
BBa_K4951022KanR Riboswitch 9 176
BBa_K4951023KanR Riboswitch 10 176
BBa_K4951024KanR Riboswitch 11 176
BBa_K4951025KanR Riboswitch 12 176
BBa_K4951026KanR Riboswitch 13 159
BBa_K4986001Suicide system: temperature-controlled promoter +SRRZ cutting gene 3021
BBa_K4998024RBS for VapC15 gene 12
BBa_K5038000RBS 8
BBa_K5044012RBS 23
BBa_K5044037pQQC7_RBS 12
BBa_K5044101taccD 5 180
BBa_K5044108CrTrbcl 450
BBa_K5044304CrTrbcl 450
BBa_K5048063RBS(On pET-28a backbone) 23
BBa_K5048064RBS(On pBAD backbone) 6
BBa_K5061021Synthetic RBS designed for M13 gI 30
BBa_K5061022Synthetic RBS designed for M13 gIII 22
BBa_K5061023Synthetic RBS designed for M13 gVI 22
BBa_K5061024Synthetic RBS designed for XylS 26
BBa_K5062038Internal Ribosome Entry Site (IRES) 568
BBa_K5076113vioA RBS 6
BBa_K5076203viaA RBS  6
BBa_K5084006Thiosulfate biosensor-A-RBS of thsS 34
BBa_K5084007Thiosulfate biosensor-A-RBS of thsR 33
BBa_K5084008Thiosulfate biosensor-B-RBS of thsS 28
BBa_K5084009Thiosulfate biosensor-B-RBS of thsS 33
BBa_K5097012RBS BBa_B0034 with spacer nucleotides 26
BBa_K5108006aprA RBS from Pseudomonas protegens (CHA0) 24
BBa_K5108007hcnA RBS from Pseudomonas protegens (CHA0) 25
BBa_K5108008hcnA RBS from Pseudomonas aeruginosa (PAO1) 25
BBa_K5117000BsRBS 15
BBa_K5133001Ribosome binding site (RBS, from plasmid pJL1) 17
BBa_K5136045SD7  7
BBa_K5136049SD17 7
BBa_K5160001Short Description  
BBa_K5166022UreA RBS1 25
BBa_K5166023UreB RBS2 25
BBa_K5166024UreC RBS3 25
BBa_K5166025UreE RBS4 25
BBa_K5166026UreF RBS5 25
BBa_K5166027UreG RBS6 25
BBa_K5166028UreD RBS7 25
BBa_K5175014RBS for T7 promoter 12
BBa_K5211004The ribosome-binding site is a sequence on the mRNA that is located upstream of the start codon (usu 24
BBa_K5211005Optimized ribosome-binding site sequences. 26
BBa_K5226019RBS for TD-gcvT 35
BBa_K5226020RBS for TD-gcvH 35
BBa_K5226021RBS for TD-gcvP 35
BBa_K5226022RBS for TD-sdaA 35
BBa_K5226023RBS for Vib-folD 35
BBa_K5226024RBS for Vib-gcvT 35
BBa_K5226025RBS for Vib-gcvH 35
BBa_K5226026RBS for Vib-gcvP 35
BBa_K5226027RBS for Vib-sdaA 35
BBa_K5226035RBS for 4hbD 35
BBa_K5226036RBS for sucD 35
BBa_K5226040RBS for cysNC 35
BBa_K5246000RBS_1MCS_HB 6
BBa_K5246053RBS 6
BBa_K5248013RBS 23
BBa_K5254009RBS Derived using Geneious Prime  11
BBa_K5269034SD-sequence 16
BBa_K5270006RBS in L.reuteri 6
BBa_K5280410A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280411 A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280412A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280413A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280414A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280415A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280416A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280417A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280418A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280419A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280420A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280421A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280422A RNA thermosensor that turns on protein translation at high temperatures. 71
BBa_K5280423A RNA thermosensor that turns on protein translation at high temperatures. 73
BBa_K5280424A RNA thermosensor that turns on protein translation at high temperatures. 73
BBa_K5280425A RNA thermosensor that turns on protein translation at high temperatures. 73
BBa_K5280426A RNA thermosensor that turns on protein translation at high temperatures. 73
BBa_K5280427 A RNA thermosensor that turns on protein translation at high temperatures. 100
BBa_K5280428A RNA thermosensor that turns on protein translation at high temperatures. 103
BBa_K5280429A RNA thermosensor that turns on protein translation at high temperatures. 103
BBa_K5280430A RNA thermosensor that turns on protein translation at high temperatures. 103
BBa_K5280431A RNA thermosensor that turns on protein translation at high temperatures. 107
BBa_K5282006RBS 13
BBa_K5282009RBS 13
BBa_K5282010TfCa CDS 1530
BBa_K5291012BCD1 bicistronic design 85
BBa_K5291013BCD2 bicistronic design 83
BBa_K5291014BCD5 bicistronic design 88
BBa_K5293010RBS T7 30
BBa_K5293021pHREAC RBS 33
BBa_K5300003RBS1 40
BBa_K5300006RBS2 40
BBa_K5300008RBS3 40
BBa_K5300010RBS4 40
BBa_K5300012Ribosome binding site of VapC 22
BBa_K5303057RBS 6
BBa_K5303101SRBS 21
BBa_K5311004Strong synthetic RBS 29
BBa_K5327000AVBBAA 1065
BBa_K5348001B0034-mutant 1 15
BBa_K5348002B0034-mutant 2 12
BBa_K5348003B0034-mutant 3 12
BBa_K5357000E. coli Ribosome Binding Site (RBS)  23
BBa_K5359000SYFP2 RBS 39
BBa_K5366070RBS 6
BBa_K5366072RBS (J23119 promoter) 23
BBa_K5369105Ribosome binding site 6
BBa_K5377001ribA RBS 27
BBa_K5377003ribB RBS 28
BBa_K5377005ribD RBS 26
BBa_K5377007ribE RBS 33
BBa_K5377009ribC RBS 35
BBa_K5377504efficient RBS 23
BBa_K5378016RBS 26
BBa_K5382102RBS 23
BBa_K5398004RBS (before 5' intron) 15
BBa_K5422002RBS with spacers  30
BBa_K5427000RBS 1_12000 14
BBa_K5427005RBS 2_220 14
BBa_K5427006RBS 3_126 32
BBa_K5427007RBS 4_59 33
BBa_K5431009RBS (MP6) 28
BBa_K5431013RBS (from T7) 69
BBa_K5432012RBS(Ribosome binding site) 43
BBa_K5436002Optimized RBS for BIND-System 24
BBa_K5436005Optimized RBS for BIND-System 24
BBa_K5441008RBS 12
BBa_K545005fha 0.1137
BBa_K545006mag 0.0432
BBa_K545666rpos leader sequence 223
BBa_K5487103RBS 23
BBa_K5487117RBS 23
BBa_K5490016RBS 30
BBa_K5490030IRES2 587
BBa_K5490031kozak for casrx 24
BBa_K5498012RBS 67
BBa_K566037RBS.3 (Inverted) 13
BBa_K606061SpoVG Ribosome Binding Site (RBS) for B. subtilis 12
BBa_K619892mutated prfA thermosensor from listeria 140
BBa_K624012RBS from Pmsp3 31
BBa_K624013RBS (6 bps truncated) from Pmsp3 22
BBa_K641001rbs for ffGFP 30
BBa_K641004rbs for ToxR 25
BBa_K737020Cyanobacteria gene ribosome binding site  5
BBa_K737033galK is the leader sequence of galactokinase (GalK) 127
BBa_K780001Strong RBS for Bacillus Subtilis 16
BBa_K780002Strong RBS for Bacillus Subtilis 16
BBa_K783047This is a MoClo converted version of BBa_B0030 15
BBa_K783048This is a MoClo converted version of BBa_B0031 14
BBa_K783049This is a MoClo converted version of BBa_B0032 13
BBa_K783050This is a MoClo converted version of BBa_B0033 11
BBa_K783051This is a MoClo converted version of BBa_B0034 12
BBa_K784007Spacer + RBS from theophylline riboswitch 46
BBa_K784012Spacer2 + RBS from theophylline riboswitch 51
BBa_K792001Kozak sequence from yeast α-factor mating pheromone (MFα1) 21
BBa_K809008RBS sequence of yeast mitochondrial gene AI1 54
BBa_K809009RBS sequence of yeast mitochondrial gene OLI1 114
BBa_K812053RBS B0034 with GoldenBrick sequence 47
BBa_K812058A GoldenBricked-medium strenght RBS J61107 48
BBa_K812059A GoldenBricked version of week RBS J61117  48
BBa_K821009Orthogonal RBS 1 6
BBa_K879021rbs based on B0034 26
BBa_K879022Rbs 2 29
BBa_K879023Rbs 3 29
BBa_K879024rbs 4 29
BBa_K879025Rbs 5 29
BBa_K879026Rbs 6 29
BBa_K892005Strong RBS  16
BBa_K896599Strophurus rankini voucher AMS R140490 NADH dehydrogenase subunit 4 (ND4) gene, partial cds; tRNA-Hi 435
BBa_K899009Doubble ribosomal binding site (FFT) (shine-dalgarno and kozak sequence) 13
BBa_K899010Doubble ribosomal binding site (SST) (shine-dalgarno and kozak sequence) 13
BBa_K923005Ribosome Binding Site in pET14b plasmid 5
BBa_M1105Pyrene degradation enzyme RBS 11
BBa_M114025' UTR and RBS of psbA2 gene in Synechocystis sp. PCC 6803 49
BBa_M13501M13K07 gene I RBS 16
BBa_M13502M13KO7 gene II RBS 16
BBa_M13503M13K07 gene III RBS 16
BBa_M13504M13K07 gene IV RBS 16
BBa_M13505M13KO7 gene V RBS 16
BBa_M13506M13K07 gene VI RBS 16
BBa_M13507M13KO7 gene VII RBS 16
BBa_M13508M13K07 gene VIII RBS 16
BBa_M13509M13Ko7 gene IX RBS 16
BBa_M13510M13KO7 gene X RBS 16
BBa_M13511M13K07 gene XI RBS 15
BBa_M1694Ribosome binding site 14
BBa_M1782Synechocystis RBS Site 10
BBa_M360005' Bicistronic UTR (weak), does not include ATG start 47
BBa_M360015' Bicistronic UTR (medium), does not include ATG start  47
BBa_M360095' Bicistronic UTR (strong), does not include ATG start  47
BBa_M36034BCD02 - Bicistronic Design 02 85
BBa_M36068Adapted fnr binding site 130
BBa_M36070Bicistronic RBS - BIOFAB ID: apFAB681 (BCD1) 88
BBa_M361205' Bicistronic UTR (strong) contains ATG start Codon.  88
BBa_M36204Bicistronic RBS (BD14) 85
BBa_M362365' Bicistronic UTR (no ATG) 85
BBa_M362375' Bicistronic UTR (no ATG) 85
BBa_M36269RBS: modified BBa_B0034 15
BBa_M362825' Bicistronic UTR, includes ATG start codon 88
BBa_M36288medium 5' Bicistronic UTR (BD21) 88
BBa_M36289medium 5' Bicistronic UTR (BD8) 88
BBa_M362935' Bicistronic UTR, includes ATG start  88
BBa_M363615' Bicistronic UTR (apFAB866, GENE10_BCD2), No ATG Start 83
BBa_M36405Bicistronic RBS (medium) pFAB1646 88
BBa_M36450Bicistronic RBS - pFAB1692 85
BBa_M36452RBS - MCD 6 29
BBa_M36454MCD 20 30
BBa_M36516Bicistronic RBS #5 88
BBa_M36521strong 5' bicistronic UTR, with ATG at end 86
BBa_M36542BCD22 - RBS 88
BBa_M365565' Bicistronic UTR (medium), does not include ATG start 85
BBa_M36559RBS and Spacer 19
BBa_M36583Strong RBS - BBa_J61100 28
BBa_M36595Bicistronic design RBS 87
BBa_M367245' Bicistronic UTR (strong), does not include ATG start  85
BBa_M36771Strong RBS from DNA 2.0 Gene Designer 13
BBa_M36781BCD13 92
BBa_M36804pRBS-SD1+6A 13
BBa_M36913takes PoPs input 88
BBa_M36917Zinc Promoter (ZntR regulated) with own RBS 91
BBa_M36925Bicistronic RBS (medium) apFAB682 88
BBa_M45193E. coli RBS 14
BBa_M45214Physcomitrella patens ribosome binding site 207
BBa_M45406minimal TATA Box 64
BBa_M50007U1 Thermosensitive 5'-UTR (includes RBS) 38
BBa_M50008U10 Thermosensitive 5'-UTR (includes RBS) 39
BBa_M50019Strong ribosome binding site 15
BBa_M50024RBS for Gold detection plasmid 10
BBa_M50062Strong RBS 13
BBa_M50080Strong RBS 13
BBa_M50422Strong RBS 13
BBa_Z0261Strong T7.2 RBS 20
BBa_Z0262Medium strength T7.2 RBS 20