Search results (Hint: Try the special 'Search Parts' system on the main page)
Create the page "Synthesis" on this wiki! See also the search results found.
Page title matches
- ==Plasmids used in DNA synthesis of BioBrick parts== ...t DNA synthesis. Here is a list of plasmid backbones used by assorted DNA synthesis companies.981 B (133 words) - 16:41, 22 December 2008
-
32 B (4 words) - 19:06, 9 June 2020
Page text matches
- ...indicates the CrtEBIY with constitutive promoter (R001) DNA fragment. The synthesis system composite was transformed into DH5-alpha E. coli for further experim ===Demonstration of Synthesis System [contains the part BBa_k419012 (constitutive promoter-CrtEBIY) in th5 KB (760 words) - 13:37, 6 November 2010
- ==1. <i>in vivo</i> monoterpene synthesis== ...s.png|1500px|thumb|center|Fig. 1-1 Schematic of <i>in vivo</i> monoterpene synthesis]]13 KB (1,932 words) - 00:43, 3 December 2020
- #'''Rate of GFP synthesis''' of 100nM AHL #'''Transfer Function'''- [AHL] vs rate of GFP synthesis6 KB (1,037 words) - 00:37, 27 October 2007
- ==1. <i>in vivo</i> monoterpene synthesis== ...s.png|1500px|thumb|center|Fig. 1-1 Schematic of <i>in vivo</i> monoterpene synthesis]]11 KB (1,666 words) - 00:44, 3 December 2020
- ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu12 KB (1,776 words) - 13:44, 21 October 2021
- ...acterial cellulose-PHB polymer</b>. This was achieved introducing this PHB synthesis operon into <i> K. xylinus</i>. Therefore, after transformation with plasmi This construct is a polyhydroxybutyrate synthesis operon (<i>phaC, phaA, phaB</i>) producing PHB along with bacterial cellulo12 KB (1,760 words) - 22:09, 11 October 2023
- ...mated with the algorithm described in ''Data analysis to estimate the HSL synthesis rate per cell'' section. ...oach was proposed to estimate many interesting parameters, such as the HSL synthesis rate per cell, and an algorithm was proposed in order to evaluate the O.D.s28 KB (4,317 words) - 01:43, 28 October 2010
- ...estimated with the algorithm described ''Data analysis to estimate the HSL synthesis rate per cell'' section; ...oach was proposed to estimate many interesting parameters, such as the HSL synthesis rate per cell, and an algorithm was proposed in order to evaluate the O.D.s34 KB (5,311 words) - 03:18, 28 October 2010
- ...estimated with the algorithm described ''Data analysis to estimate the HSL synthesis rate per cell'' section; ...oach was proposed to estimate many interesting parameters, such as the HSL synthesis rate per cell, and an algorithm was proposed in order to evaluate the O.D.s35 KB (5,352 words) - 00:35, 28 October 2010
- A circuit for efficient exopolysaccharide synthesis ...enzymes GalU and PmgA under the regulation of LacI-Ptrc promoter. The EPS synthesis circuit was as below:10 KB (1,547 words) - 11:04, 12 October 2023
- ...er conservation and sand fixation of soil. We designed and constructed EPS synthesis circuit by overexpression of pgmA (phosphoglucose mutase)and galU (UDP gluc ...enzymes GalU and PmgA under the regulation of LacI-Ptrc promoter. The EPS synthesis circuit was as below:7 KB (982 words) - 04:10, 14 October 2022
- ..._SFLS_SPBS--Indigo Synthesis--Pathway.png|600px|center|thumb|Fig 1. Indigo Synthesis Pathway]] ...l had lots of drawbacks that it can cause pollution and the substrates for synthesis were harmful to people's health.<br>8 KB (1,242 words) - 07:06, 4 October 2021
- ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu11 KB (1,611 words) - 13:43, 21 October 2021
- To facilitate the modularized design of plasmids, we named the EPS synthesis verification plasmid 4, which will be referred to as plasmid 4 in the follo ...n gene progenitor contains the EPS synthesis gene, LacI regulatory protein synthesis gene + Ptrc promoter, as shown in Figure 1.7 KB (1,089 words) - 05:57, 12 October 2022
- === Origin: Saccharomyces cerevisiae, synthesis === Origin: synthesis14 KB (2,015 words) - 06:49, 20 October 2021
- ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co14 KB (2,217 words) - 03:24, 28 October 2020
- ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o9 KB (1,390 words) - 13:34, 21 October 2021
- ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o9 KB (1,383 words) - 13:39, 21 October 2021
- ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o9 KB (1,382 words) - 13:41, 21 October 2021
- === Origin: Saccharomyces cerevisiae, synthesis === Origin: synthesis14 KB (1,932 words) - 16:53, 21 October 2021
- ...eered bacterium <i> S.o oneidensis</i> MR-1, strengthening the common NAD+ synthesis pathway, and adding a new exogenous pathway for de novo NAD+ synthesis. Thus, the intracellular NAD+7 KB (1,109 words) - 03:02, 12 October 2023
- <li><b>The synthesis of Proteinase-K starts if our ECN senses arabinose by its pBAD promoter</b> ...ow ammonia level, activated NtrC induce the glnAp2 promoter to start TetR synthesis</li>20 KB (2,866 words) - 02:37, 22 October 2021
- ...hesis method to synthesize zinc responsive promoter (pzntR) and riboflavin synthesis gene (ribB). ...lavin synthesis gene (ribB) by direct DNA synthesis method. The riboflavin synthesis gene for riboflavin expression promotes electron transfer from the cell to7 KB (1,056 words) - 08:27, 12 October 2022
- ...d, we can calculate the total synthesis rate of GFP and hence the per cell synthesis rate of GFP without considering dilution due to cell growth. ...r sec). We defined the output of <partinfo>BBa_E0240</partinfo> to be the synthesis rate of mature GFP, S_{cell} (GFP molecules per cell sec). The model inclu8 KB (1,329 words) - 17:16, 11 February 2008
- <p>This part was designed to allow the rapid synthesis of the alarmone ppGpp, responsible for the stringent response in E. coli. I <p>When <em>Escherichia coli</em> cells are exposed to extreme starvation, synthesis of their rRNA is quickly curtailed for adapting the undernourished environm8 KB (1,297 words) - 22:12, 27 October 2020
- ...R and then to the P<sub><i>lux</i></sub> promoter, which will activate the synthesis of the lysis protein E from the bacteriophage phiX174. ...ivity, which is necessary for catalysis of lipid I, a factor for cell wall synthesis (<strong>Cytolysis</strong>) (1) </li>10 KB (1,599 words) - 00:38, 18 October 2018
- ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...the identified interactions of nsP3 with host factors influence viral RNA synthesis or whether they are indicative of another nsP3 function that regulates the5 KB (713 words) - 20:35, 26 October 2020
- ..._SFLS_SPBS--Indigo Synthesis--Pathway.png|600px|center|thumb|Fig 1. Indigo Synthesis Pathway]] ...l had lots of drawbacks that it can cause pollution and the substrates for synthesis were harmful to people's health.<br>4 KB (618 words) - 10:13, 27 October 2020
- ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy10 KB (1,600 words) - 13:36, 21 October 2021
- ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy10 KB (1,548 words) - 13:40, 21 October 2021
- GDP-L-fucose is a key precursor for the synthesis of 2-FL, and it can be synthesized through two pathways. One is the de novo ...using the enzyme-catalyzed synthesis route, the yield of enzyme-catalyzed synthesis of 2'-FL is not high due to the expensive substrate guanosine 5’-diphosph16 KB (2,401 words) - 14:44, 12 October 2022
- ...yl-CoA dehydrogenase are rate-limiting enzymes in the butyrate and butanol synthesis pathway. ...engineer C. tyrobutyricum to overexpressed several enzymes to enhance the synthesis pathway of butyrate and butanol. BBa_K4885002 were constructed to enhance t6 KB (828 words) - 13:29, 12 October 2023
- ==Plasmids used in DNA synthesis of BioBrick parts== ...t DNA synthesis. Here is a list of plasmid backbones used by assorted DNA synthesis companies.981 B (133 words) - 16:41, 22 December 2008
- ===The mechanism of A/U-rich 5'-UTR to promote protein synthesis=== Fig.1. The mechanism of A/U-rich 5'-UTR to promote protein synthesis.<BR>4 KB (565 words) - 01:26, 22 October 2019
- Origin: synthesis ...We thus decided to create a completely new biobrick, responsible for Il-12 synthesis. The IL-12 gene is used by [http://2011.igem.org/Team:UNICAMP-EMSE_Brazil U8 KB (1,266 words) - 07:53, 6 October 2022
- Bacterial cellulose-PHB composite was achieved by introducing PHB synthesis operon into <i> K. xylinus</i>. This way, bacteria are able to simultaneous ...719017">BBa_K4719017</a>, containing <i>phaA</i>, is a polyhydroxybutyrate synthesis operon (<i>phaC, phaA, phaB</i>), producing PHB along with bacterial cellul4 KB (591 words) - 14:50, 12 October 2023
- ...ethod in molecular biology. Production of proteins using cell-free protein synthesis usually takes a few hours, in contrast to production of proteins in cells, ...reeening of enzymes activities. In the post-genomic era, cell-free protein synthesis has rapidly become the preferred approach for high-throughput functional an6 KB (859 words) - 12:03, 20 October 2016
- ...ve the implementation of a system that allows us to control externally the synthesis and turn-down of c-diGMP, we had cloned both genes pleD* and yhjH separatel ...of PleD* increases the intracellular concentration of c-diGMP, whereas the synthesis of YhjH decreases the intracellular concentration of this second messenger.10 KB (1,550 words) - 22:52, 19 October 2016
- ...ve the implementation of a system that allows us to control externally the synthesis and turn-down of c-diGMP, we had cloned both genes pleD* and yhjH separatel ...of PleD* increases the intracellular concentration of c-diGMP, whereas the synthesis of YhjH decreases the intracellular concentration of this second messenger.10 KB (1,526 words) - 22:50, 19 October 2016
- ...s: League of Enhanced MicroGladiators." One of our methods of nanoparticle synthesis and attachment to cells is titled the recombinant method. Through the use o With this data, we intended to perform nanoparticle synthesis with L-tyrosine and MelA-transformed <i>E. coli</i> cells, and have these c11 KB (1,605 words) - 15:27, 12 October 2022
- ...y designed by Shin and Noireaux (2010) for expression in cell-free protein synthesis systems and is more efficiently translated than other variants. ...characteristics of an experiment, such as sensitivity, leakage, etc. DeGFP synthesis rate differs for the same element in different chassis. <br>6 KB (892 words) - 14:29, 21 October 2021
- ...-Proinsulin, both cell lines showed significantly higher rates of glycogen synthesis than basal levels (Figure 3 and 4), and showed some glucose oxidation activ ...eated with Ecotin-Proinsulin showed significantly higher rates of glycogen synthesis than those at basal levels, and a slight increase in glucose oxidation was7 KB (1,008 words) - 01:55, 1 November 2017
- ...-Proinsulin, both cell lines showed significantly higher rates of glycogen synthesis than basal levels (Figure 3 and 4), and also showed significantly greater g ...with Cytoplasmic-Proinsulin showed significantly higher rates of glycogen synthesis and glucose oxidation than basal levels. Significance calculated using an u6 KB (804 words) - 01:56, 1 November 2017
- ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co11 KB (1,720 words) - 08:21, 27 October 2020
- .... We validated the function of KPD+CFPPK by performing intracellular polyP synthesis using phosphite as the substrate. ...P, +3 valance) as the solo phosphorus source was adopted to evaluate polyP synthesis.8 KB (1,161 words) - 13:32, 11 October 2022
- Polyphosphate kinase (PPK) catalyzes the synthesis of polyphosphate (polyP). PolyP is a polyanionic biopolymer and generally s ...K. We validated the effectiveness of PPK-M on enhanced intracellular polyP synthesis by comparison with PPK.5 KB (695 words) - 12:18, 27 September 2022
- ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...the identified interactions of nsP3 with host factors influence viral RNA synthesis or whether they are indicative of another nsP3 function that regulates the7 KB (1,096 words) - 08:37, 21 October 2021
- ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy ...". It exists widely in nature. ACC is a rate-limiting enzyme for ab initio synthesis of fatty acids, which catalyzes acetyl-CoA to malonyl-CoA, which eventually8 KB (1,337 words) - 13:38, 21 October 2021
- ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy ...". It exists widely in nature. ACC is a rate-limiting enzyme for ab initio synthesis of fatty acids, which catalyzes acetyl-CoA to malonyl-CoA, which eventually8 KB (1,333 words) - 13:38, 21 October 2021
- ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy ...". It exists widely in nature. ACC is a rate-limiting enzyme for ab initio synthesis of fatty acids, which catalyzes acetyl-CoA to malonyl-CoA, which eventually8 KB (1,329 words) - 13:41, 21 October 2021
- ...characteristics of an experiment, such as sensitivity, leakage, etc. DeGFP synthesis rate differs for the same element in different chassis. <br> ...2">(BBa_K2205002)</a> registered by iGEM17_Newcastle in the Parts, but the synthesis rate of deGFP in the Cell-Free system was lower than that in a cell-based s9 KB (1,462 words) - 18:13, 21 October 2021
- ...using the enzyme-catalyzed synthesis route, the yield of enzyme-catalyzed synthesis of 2'-FL is not high due to the expensive substrate guanosine 5’-diphosph ...gmd, wcaG and Wbgl, are encoding the important enzymes involving the 2'-FL synthesis. Amongst these enzymes, gmd and wcaG are converted the abundant intracellul16 KB (2,326 words) - 10:22, 27 September 2022
- ...cloning of a PCR amplified backbone and an insert obtained by solid phase synthesis. Primers for pUC19 backbone amplification were analysed on a temperature gr ...se synthesis derived cassette. Both cassettes derived from the solid-phase synthesis did not yield any visible dsRNA, while our cassette produced a dsRNA at a s8 KB (1,375 words) - 15:02, 12 October 2022
- ...hesis method to synthesize zinc responsive promoter (pzntR) and riboflavin synthesis gene (ribB). ...lavin synthesis gene (ribB) by direct DNA synthesis method. The riboflavin synthesis gene for riboflavin expression promotes electron transfer from the cell to5 KB (683 words) - 08:31, 12 October 2022
- ...a greater yield of AdoCbl, the naturally occurring gene <i>bluB</i> of the synthesis pathway of <i>sinorhizobium meliloti</i> 2011 [3]. ...ogen source despite ethanolamine. Since nitrogen is crucial for amino acid synthesis and ultimately cell survival, <i>E. coli</i> is unable to grow in such a me35 KB (5,319 words) - 14:18, 12 October 2023
- ...growth and replication of ''E. coli'', the processes of DNA design and DNA synthesis cannot be easily decoupled.2 KB (304 words) - 17:17, 22 March 2008
- ...artinfo>pSB1A3</partinfo>). The results are shown here as the relative RFP synthesis rate per cell. |[[Image:PV_hc_r001110LB.png|500px|thumb|Relative RFP synthesis rate per cell in <partinfo>pSB1A2</partinfo>-<partinfo>BBa_J107010</partinf22 KB (3,531 words) - 15:09, 11 October 2022
- ...hesis method to synthesize zinc responsive promoter (pzntR) and riboflavin synthesis gene (ribB). ...lavin synthesis gene (ribB) by direct DNA synthesis method. The riboflavin synthesis gene for riboflavin expression promotes electron transfer from the cell to5 KB (715 words) - 08:29, 12 October 2022
- ...artinfo>pSB1A3</partinfo>). The results are shown here as the relative RFP synthesis rate per cell. |[[Image:PV_hc_r001110LB.png|500px|thumb|Relative RFP synthesis rate per cell in <partinfo>pSB1A2</partinfo>-<partinfo>BBa_J107010</partinf9 KB (1,400 words) - 11:20, 30 October 2010
- [[Image:metabolism.png|thumb|right|200px|Fig.1 synthesis mechanism of P(3HB)]] The pathway and regulation of Poly[(R)-3-hydroxybutyrate] ,P(3HB) synthesis in <I>Ralstonia eutropha</I> H16 is shown in Fig1. Pyruvic acid is metaboli8 KB (1,279 words) - 05:49, 13 December 2019
- ==== Origin: Saccharomyces cerevisiae, Saccharomycopsis fibuligera, synthesis ==== ==== Origin: Saccharomycopsis fibuligera, synthesis ====15 KB (2,134 words) - 03:55, 22 October 2021
- The riboflavin synthesis gene cluster (''rib''-gene-cluster) consists of four different genes that f ...ielefeld 2013 Rib cluster2.png|500px|thumb|left|'''Figure 4:''' Riboflavin synthesis gene cluster, cloned from ''Shewanella oneidensis'' MR-1, 3697 bp; with non27 KB (3,978 words) - 04:33, 17 December 2021
- ===Synthesis of SerA Gene=== ===Plasmid Synthesis===5 KB (714 words) - 00:55, 17 October 2016
- ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co10 KB (1,547 words) - 17:46, 25 October 2020
- ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co8 KB (1,262 words) - 07:30, 17 October 2018
- ...gy that not only circumvents the use of toxic reagents for indigo chemical synthesis but also removes the need for a reducing agent for dye solubilization. .... The hidden pathway for production is encoded by the VioABCDE operon. Bio-synthesis starts from L-tryptophan, converted into protodeoxyviolaceinic acid by VioA25 KB (3,706 words) - 18:25, 21 October 2021
- ...ge, 1981). When sugars are used as the carbon source, cytosolic acetyl-CoA synthesis in S. cerevisiae occurs via the concerted action of pyruvate decarboxylase ...ynthesis corresponds to 1 mol of glucose that needs to be respired for the synthesis of 1 mol of product.87 KB (12,171 words) - 05:10, 21 October 2021
- In E. coli, the presence of glucose inhibits the synthesis of many catabolic enzymes, a phenomenon called "glucose effect" or "glucose ...strain contained pMTL83151-J23100-butyrate plasmids and expressed butyrate synthesis gene cluster; placY represents that the host strain contained p15A-J23200-l6 KB (839 words) - 14:01, 27 October 2020
- ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...olutely conserved N-terminal tyrosine interacts with nsP1 for minus-strand synthesis. Stollar and colleagues have determined several determinants of promoter bi5 KB (714 words) - 21:23, 26 October 2020
- ...l had lots of drawbacks that it can cause pollution and the substrates for synthesis were harmful to people's health.<br> ...ncluding FMO and sty gene group were discovered useful for bacteria indigo synthesis (Choi et al., 2003, Han, Bang, Lim and Kim, 2010). To achieve our goal of p4 KB (564 words) - 10:13, 27 October 2020
- ..., including drug detoxification, xenobiotic metabolism and bio-catalytic synthesis by catalyzation of the oxygenation of many nitrogen-, sulfur-, pho <h5>3.2.3 Involvement in Bio-indigo Synthesis</h5>27 KB (4,094 words) - 13:20, 21 October 2021
- ...ref><ref name="x">Rustad M, Eastlund A, Marshall R, Jardine P, Noireaux V. Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression Syste ...><ref name="x">Rustad M, Eastlund A, Jardine P, Noireaux V. Cell-free TXTL synthesis of infectious bacteriophage T4 in a single test tube reaction. Synth Biol (28 KB (4,272 words) - 08:05, 19 October 2021
- <li><b>The synthesis of SUMO-PGLa-AMI starts if our ECN senses the presence of ammonia</b></li> First of all, synthesis of an active AMP inside a bacteria will negatively affect the host (our E.25 KB (3,713 words) - 21:36, 21 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Herpetosiphon aurantiacus</i> TAL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the non-o3 KB (401 words) - 08:07, 19 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Glycine max</i> 4CL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze phenylpro3 KB (393 words) - 08:17, 19 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Arabidopsis thaliana</i> CHS gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the conve3 KB (393 words) - 08:22, 19 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Medicago sativa</i> CHI gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyzes the intr3 KB (410 words) - 08:27, 19 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...ter and <i>Herpetosiphon aurantiacus</i> TAL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the non-o4 KB (531 words) - 17:33, 21 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...ing slpA promoter and <i>Glycine max</i> 4CL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently synthesize 3,4',5-4 KB (519 words) - 17:31, 21 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...ter and <i>Herpetosiphon aurantiacus</i> TAL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the non-o3 KB (407 words) - 07:28, 19 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...promoter and <i>Arabidopsis thaliana</i> CHS gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the conve3 KB (398 words) - 07:37, 19 October 2021
- ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...slpA promoter and <i>Medicago sativa</i> 4CL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the intra3 KB (411 words) - 07:58, 19 October 2021
- ...slated into 4-Coumarate:Coenzyme A Ligase,which is the key enzyme in the synthesis of lycopene. It participates in the transformation from ferulic acid to p-C ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy4 KB (656 words) - 12:59, 21 October 2021
- ==== Origin: Saccharomyces cerevisiae, Saccharomycopsis fibuligera, synthesis ==== ==== Origin: Saccharomycopsis fibuligera, synthesis ====11 KB (1,502 words) - 03:54, 22 October 2021
- ...2(Cpa fdx terminator). In our program, we use this device to construct the synthesis pathways of butanol in Clostridium tyrobutyricum. By introducing adhE2ʌ ...lizing a de novo synthesis pathway of butanol while maintaining the native synthesis pathway of butyrate (Figure 3).8 KB (1,084 words) - 16:37, 11 October 2023
- This is an improvements on the previous pGPP synthesis circuit (BBa_K3052010) by the replicon optimization from p15Aori (5-10 copi This is an improvements on the previous pGPP synthesis circuit (BBa_K3052010) by the replicon optimization from p15Aori (5-10 copi7 KB (1,072 words) - 03:32, 14 October 2022
- ...rene monooxygenase pKARA_RT3 into one operon. <b>This composite allows the synthesis of a self-dyeing plastic-like polymer</b>. This construct is a combination of a polyhydroxybutyrate synthesis operon (<i>phaC, phaA, phaB</i>) producing PHB along with bacterial cellulo5 KB (796 words) - 15:25, 12 October 2023
- ...ing the catalytic efficiency of AGPase, the rate-limiting enzyme in starch synthesis. The modified AGPase exhibits higher specific activity and substrate affini ...iting step in starch synthesis in ''Chlamydomonas'', so we promoted starch synthesis by expressing more efficient AGPase in ''Chlamydomonas''.11 KB (1,624 words) - 11:43, 12 October 2023
- ...we tried to increase intracellular heme content by strengthening the heme synthesis pathway of Endogenous synthesis of heme3 KB (501 words) - 07:02, 10 October 2023
- ...we tried to increase intracellular heme content by strengthening the heme synthesis pathway of Endogenous synthesis of heme3 KB (501 words) - 07:04, 10 October 2023
- ...ucial element within messenger RNA (mRNA) that plays a key role in protein synthesis, particularly in prokaryotic organisms like bacteria. It is also sometimes Here's how the RBS works and its significance in protein synthesis:2 KB (380 words) - 22:00, 5 October 2023
- ...engineer C. tyrobutyricum to overexpressed several enzymes to enhance the synthesis pathway of butyrate and butanol. BBa_K4885002 were constructed to enhance t ...tter product ratio. In this way, we directly and indirectly reinforced the synthesis of butyrate and butanol in C. tyrobutyricum.7 KB (979 words) - 13:30, 12 October 2023
- ...color in organisms is melanin. We hope to darken hair by promoting melanin synthesis. The Tyr gene encodes a tyrosinase enzyme, which can convert tyrosine into .... This observation can serve as a reference for subsequent, cost-effective synthesis decisions4 KB (611 words) - 08:18, 12 October 2023
- is responsible for introducing NAMN synthesis pathway with Na as a precursor into ...e downstream pathway expression. We got a sequence of it through corporate synthesis.5 KB (795 words) - 14:52, 12 October 2023
- ylER and LhYida expression plasmids for the de novo synthesis of erythritol. The plasmids carry the Amp resistance gene, URA screening ma ...e the expression of erythrose 4-phosphate (E4P) and facilitate the de novo synthesis of erythritol, thereby increasing its yield.7 KB (1,063 words) - 08:35, 12 October 2023
- ...nthesis difficulties largely stemmed from the dependence of commercial DNA synthesis processes on cloning, assembly and propagation of synthesized DNA in ''E. c1 KB (152 words) - 23:26, 24 January 2008
- ...me="Second">Shen, G., Rajan, R., Zhu, J., Bell, C. E. & Pei, D. Design and Synthesis of Substrate and Intermediate Analogue Inhibitors of S -Ribosylhomocysteina AI-2 synthesis:9 KB (1,335 words) - 14:15, 17 December 2020
- ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu <h2>'''Pigment synthesis'''</h2>10 KB (1,539 words) - 12:14, 21 October 2021
- ...ch well, the S<sub>cell</sub> signal (proportional to the reporter protein synthesis rate per cell) was computed as (1/OD600*dXFP/dt), where OD600 is the normal ...xpressing clones. Note: as a reference, typical values of the relative RFP synthesis rate measured for PconRFP in a low copy vector (~5 plasmids per cell) are a25 KB (3,992 words) - 17:39, 25 January 2013
- ...Bacillus subtilis levansucrase, which catalyses hydrolysis of sucrose and synthesis of levans (high molecular weight fructose polymers). It is lethal to gram-n ...creted enzyme levansucrase. The enzyme catalyzes hydrolysis of sucrose and synthesis of levans, which are high-molecular-weight fructose polymers. In the gram-n11 KB (1,577 words) - 15:48, 12 October 2022
- Gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus). ...nition site according to life technologies manual (AcTEV TM Protease),gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus)1 KB (137 words) - 10:36, 24 September 2012
- ...the phosphate level in the medium by its incorporation into polyphosphate synthesis inside the bacteria. We test the constructs' efficiency from 2 parameters: poly-P synthesis efficiency and phosphate removal efficiency from the medium.3 KB (465 words) - 06:35, 5 October 2013
- ...verproduction of tyrosine: <i>tyrA-aroG-tktA-ppsA</i>/pet-28a for vanillin synthesis <b>BBa_K4256011</b>. ...ed aroG-fbr (BBa_K4146502) to enhance the synthesis pathway in the de novo synthesis of 2-phenylethyl alcohol.'''<br>10 KB (1,537 words) - 08:55, 12 October 2022
- ...e which catalyzes the synthesis of cytokinin. The mechanisms of cytokinin synthesis are shown in Fig. 1 (Takei et al., 2001). We ordered a DNA sequence of <i> ...00_main_Fig1.jpg|thumb|center|500px|<b>Fig. 1.</b> Mechanisms of cytokinin synthesis]]1 KB (211 words) - 06:40, 27 September 2013
- ...e which catalyzes the synthesis of cytokinin. The mechanisms of cytokinin synthesis are shown in Fig. 1 (Takei et al., 2001). We ordered a DNA sequence of <i> ...01_main_Fig1.jpg|thumb|center|500px|<b>Fig. 1.</b> Mechanisms of cytokinin synthesis]]1 KB (211 words) - 06:42, 27 September 2013
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind18 KB (3,014 words) - 12:18, 20 September 2018
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind18 KB (3,014 words) - 03:31, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind18 KB (3,014 words) - 03:32, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind18 KB (3,014 words) - 03:32, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind18 KB (3,014 words) - 03:32, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind12 KB (2,033 words) - 03:41, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:42, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:43, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:43, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:43, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:43, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:45, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:44, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind12 KB (1,954 words) - 03:44, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:44, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind13 KB (2,082 words) - 03:44, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,041 words) - 12:58, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,041 words) - 12:58, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,041 words) - 12:59, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,040 words) - 12:59, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,097 words) - 20:33, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,041 words) - 13:03, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,041 words) - 13:03, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,041 words) - 13:04, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,040 words) - 13:03, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,041 words) - 13:03, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,040 words) - 13:03, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,097 words) - 20:35, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind6 KB (1,097 words) - 20:35, 1 November 2017
- .... coli by inserting TPH and TDC genes, so that it can become the exogenous synthesis pathway of 5-HT, so as to increase the amount of 5-HT. .... coli by inserting TPH and TDC genes, so that it can become the exogenous synthesis pathway of 5-HT, so as to increase the amount of 5-HT.19 KB (2,740 words) - 15:20, 20 October 2021
- ===Cytochrome c for the synthesis of organosilicons=== .../Team:Heidelberg/Predcel">PREDCEL</a>}}) approach to improve organosilicon synthesis by cytochrome engineering.4 KB (638 words) - 01:37, 2 November 2017
- ...treatment with YncM Winsulin, these cells showed higher rates of glycogen synthesis than basal levels, and showed glucose oxidation activity above basal level ...xidation. Cells treated with YncM-Winsulin showed higher rates of glycogen synthesis than those at basal levels, and an increase in glucose oxidation was observ6 KB (952 words) - 05:28, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind12 KB (1,951 words) - 03:44, 2 November 2017
- ...GEM teams to further build upon the application of the gshF in glutathione synthesis in industry and hence, increase the resistance of engineered cells to react20 KB (2,942 words) - 12:17, 27 October 2020
- ...ing gluconuronic acid and acetaminoglucose transfer reaction. In vivo, the synthesis of hyaluronic acid is achieved by the alternating aggregation of monosaccha ...ase to produce the main precursor, glucose-6-phosphate (G6P).From here, HA synthesis pathway can then be divided into two distinct pathways that syntheses the t4 KB (660 words) - 01:10, 18 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:17 KB (2,616 words) - 01:21, 22 October 2019
- ...th our <i>in vitro</i> translation kit (PURExpress <i>In vitro</i> Protein Synthesis Kit), as it cannot be expressed with any of the usual <i>in vitro</i> trans ...i> experiments were performed with the PURExpress <i>Ιn Vitro</i> Protein Synthesis Kit provided by New England Biolabs (NEB). We followed the standard protoco13 KB (1,973 words) - 14:19, 21 October 2019
- In our study, we aim to achieve limonene and linalool synthesis in <i>E.coli</i> DH5<i>α</i>. According to 2018 GreatBay_China team’s ex ...HINA--project3.png |700px|thumb|center|<b>Figure 1:</b> (A)MVA pathway. (B)Synthesis of limonene and linalool]]</div>4 KB (548 words) - 03:19, 22 October 2019
- ..., L109G, L110E, H281V, Q282F and A460M. BFD-M7 can catalyze glycolaldehyde synthesis from formaldehye, then the glycolaldehyde reacts with formaldehyde to form ...(DHA) from formaldehyde, catalyzed by BFD-M7. This enzyme can catalyze the synthesis of two compounds Glycolaldehyde and Dihydroxyacetone, using formadehyde.2 KB (352 words) - 00:21, 21 October 2019
- ...s more, we alternated a short region on HPI gene to increase its protein synthesis and secretion. ..., suppression of hepatic glucose production(HGP), and the induction of the synthesis of fatty acids for energy storage and further utilization. We can assume pr3 KB (517 words) - 22:36, 20 October 2019
- ...49p.</ref><ref>Rustad M, Eastlund A, Jardine P, Noireaux V. Cell-free TXTL synthesis of infectious bacteriophage T4 in a single test tube reaction. Synth Biol ( ...hyeon Shin<ref name="a">Shin J, Jardine P, Noireaux V. Genome replication, synthesis, and assembly of the bacteriophage T7 in a single cell-free reaction. ACS S23 KB (3,556 words) - 07:29, 19 October 2021
- ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...olutely conserved N-terminal tyrosine interacts with nsP1 for minus-strand synthesis. Stollar and colleagues have determined several determinants of promoter bi5 KB (751 words) - 17:45, 19 October 2021
- ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...roles, nsP2 is intimately involved in the shutoff of host macro-molecular synthesis.nsP2 functions as a helicase to unwind RNA secondary structures formed duri6 KB (879 words) - 20:32, 26 October 2020
- ...enter|Fig. 1 Parts and metabolic pathways in the experiment of monoterpene synthesis and a schematic diagram of the experiment ]] In this cell-free monoterpene synthesis, we mixed two E. coli extracts each of which has either first 7 or last 2 e5 KB (842 words) - 01:02, 28 October 2020
- ...enter|Fig. 1 Parts and metabolic pathways in the experiment of monoterpene synthesis and a schematic diagram of the experiment ]] In this cell-free monoterpene synthesis, we mixed two E. coli extracts each of which has either first 7 or last 2 e5 KB (810 words) - 01:01, 28 October 2020
- ...ible for helping galactose pass through the cell membrane and the butyrate synthesis cluster is responsible for accelerating the degradation of galactose (Fig2) ...strain contained pMTL83151-J23100-butyrate plasmids and expressed butyrate synthesis gene cluster; placY represents that the host strain contained p15A-J23200-l5 KB (800 words) - 07:54, 27 October 2020
- ...bly, and mainly synthesize GTP. The ppk1 codes PPK1, which can promote the synthesis(major function) and decomposition(minor function) of polyP with the residue ...er, if the concentration of ATP is lower than 5 μM, there is virtually no synthesis of polyP for 20 min.2 KB (282 words) - 08:55, 14 September 2021
- In <i>E. coli</i>, chorismate is a branching point for the synthesis of aromatic amino acids, and we intend to insert four related genes that fa ...l pterin cycle (MH4 cycle) can be formed to ensure the final step of 5-HTP synthesis.<br>3 KB (551 words) - 16:32, 19 October 2021
- ...ence the selectivity and specificity of taste responses.We acquire it from synthesis company. ====1. Modification and synthesis of T1R1 gene====5 KB (694 words) - 11:24, 17 October 2021
- The riboflavin synthesis gene cluster consists of the genes <i>ribd</i> ([https://parts.igem.org/wik The riboflavin gene synthesis cluster comprises genes that are integral in the riboflavin biosynthesis pa18 KB (2,837 words) - 04:34, 17 December 2021
- ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu <h1>'''Pigment synthesis'''</h1>9 KB (1,463 words) - 13:31, 21 October 2021
- ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy9 KB (1,439 words) - 13:07, 21 October 2021
- ...to Geranylgeranyl pyrophosphate synthase,which is the key enzyme for the synthesis of curcumin. It participates in the transformation from Farnessee pyrophosp ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu3 KB (463 words) - 12:54, 21 October 2021
- ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy2 KB (336 words) - 09:45, 21 October 2021
- ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy3 KB (489 words) - 10:32, 21 October 2021
- .... coli by inserting TPH and TDC genes, so that it can become the exogenous synthesis pathway of 5-HT, so as to increase the amount of 5-HT. ...(such as in Parkinson's disease), and the rate-limiting step of serotonin synthesis in people treated with 5-HTP (such as in mild depression or dysthymia). AAD14 KB (2,079 words) - 03:52, 22 October 2021
- <p style="text-align:center;">Fig. 1. Melanin synthesis pathway</p> <p style="text-align:center;">Fig. 2. Selenomelanin synthesis pathway</p>7 KB (933 words) - 15:28, 12 October 2022
- ...improving enzyme activity to enhance the synthesis pathway in the de novo synthesis of 2-phenylethyl alcohol. ...yzes the synthesis of DAHP, which directs carbon flow to the phenylalanine synthesis pathway. The phenylalanine-bound hydrophobic pocket consists of 12 amino ac4 KB (587 words) - 10:14, 12 October 2022
- ...1]. The technique for synthesizing DNA has developed, with the cost of DNA synthesis dropping annually. With this, the use of DNA as an information storage medi [1] Hughes, Randall A. and Ellington, Andrew D. Synthetic DNA Synthesis and Assembly: Putting the Synthetic in Synthetic Biology. Cold Spring Harb5 KB (792 words) - 21:54, 9 October 2022
- ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed19 KB (2,724 words) - 08:27, 13 October 2022
- ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed19 KB (2,724 words) - 08:26, 13 October 2022
- ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed19 KB (2,753 words) - 09:12, 13 October 2022
- ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed19 KB (2,753 words) - 09:12, 13 October 2022
- ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed19 KB (2,724 words) - 08:27, 13 October 2022
- ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed19 KB (2,724 words) - 08:27, 13 October 2022
- == Induction of anthocyanin synthesis == ...solution was added in liquid M medium. The results showed that anthocyanin synthesis was successfully induced in the IA hairy roots on the 1st and 5th day, impl6 KB (864 words) - 04:54, 8 October 2022
- == Induction of anthocyanin synthesis == ...ution was added in liquid M medium. The results showed that no anthocyanin synthesis was induced in the NC hairy roots on the 1st and 5th day, implying that the6 KB (882 words) - 04:55, 8 October 2022
- ...igments. Chloroplasts are an example of plastids that are involved in food synthesis and they contain the green pigment chlorophyll.</p> ...ed as a chloroplast import sequence, but due to SS4’s function in starch synthesis, the sequence could target amyloplasts as well. Upon advice from Dr. Hsou-m4 KB (680 words) - 05:16, 10 October 2022
- ...igments. Chloroplasts are an example of plastids that are involved in food synthesis and they contain the green pigment chlorophyll.</p> ...an enzyme involved in the starch biosynthesis pathway, specifically in the synthesis of amylose, one of the two distinct polymers within statolith starch granul5 KB (715 words) - 05:18, 10 October 2022
- ...ing dihydroxylation-dehydase (DHAD) in the plant branched-chain amino acid synthesis pathway (BCAA). Its biosynthetic path is shown in the following figure: Figure 1: Precursor synthesis4 KB (608 words) - 04:15, 14 October 2022
- ...ing dihydroxylation-dehydase (DHAD) in the plant branched-chain amino acid synthesis pathway (BCAA). Its biosynthetic path is shown in the following figure: Figure 1: Precursor synthesis3 KB (510 words) - 04:41, 11 October 2022
- The AA synthesis circuit (Plasmid 3) was constructed based on the medium-copy number backbon ...esults of Yan Y et al). AA targets dihydroxylation dehydrase (DHAD) in the synthesis pathway branched-chain amino acid and leads to the growth inhibition of pla4 KB (652 words) - 04:00, 14 October 2022
- ...ing dihydroxylation-dehydase (DHAD) in the plant branched-chain amino acid synthesis pathway (BCAA). Its biosynthetic path is shown in the following figure: Figure 1: Precursor synthesis4 KB (666 words) - 07:15, 12 October 2022
- ...gi (Yan Y et al, 2018). AA targets dihydroxylation dehydrase (DHAD) in the synthesis pathway branched-chain amino acid and leads to the growth inhibition of pla ...esults of Yan Y et al). AA targets dihydroxylation dehydrase (DHAD) in the synthesis pathway branched-chain amino acid and leads to the growth inhibition of pla5 KB (765 words) - 03:58, 14 October 2022
- ...engineer C. tyrobutyricum to overexpressed several enzymes to enhance the synthesis pathway of butyrate and butanol. BBa_K4885002 were constructed to enhance t ...tter product ratio. In this way, we directly and indirectly reinforced the synthesis of butyrate and butanol in C. tyrobutyricum.5 KB (670 words) - 13:29, 12 October 2023
- ...By expressing adhE2 gene in C. tyrobutyricum, we can construct the butanol synthesis pathway. We used a strong transcriptional promoter, Pthl, in C. tyrobutyric ...acetate and indirectly enhance the metabolic flux of butyrate and butanol synthesis.2 KB (263 words) - 06:14, 10 October 2023
- ...By expressing adhE2 gene in C. tyrobutyricum, we can construct the butanol synthesis pathway. We used a strong transcriptional promoter, Pthl, in C. tyrobutyric ...adhE2, crt and bcd in C. tyrobutyricum to enhance the butyrate and butanol synthesis pathway.2 KB (253 words) - 06:49, 30 September 2023
- ...By expressing adhE2 gene in C. tyrobutyricum, we can construct the butanol synthesis pathway. We used a strong transcriptional promoter, Pthl, in C. tyrobutyric ...etylase, we can enhance the acetylation and deacetylation interplay in the synthesis pathway of butyrate and butanol, and thus improve the efficiency of the pat2 KB (257 words) - 06:41, 30 September 2023
- ...the reaction is the availability of electron donors or acceptors. Pyruvate synthesis by PFOR requires electron donors (reduced ferredoxin) while pyruvate breakd ...ACS Publications). This is because PFOR can assimilate CO2 in the pyruvate synthesis reaction and convert CO2 into a central metabolite, pyruvate, which can be3 KB (419 words) - 08:42, 11 October 2023
- ...e downstream pathway expression. We got a sequence of it through corporate synthesis. ...thetaseto promote the efficient expression of this pathway and improve the synthesis efficiency of13 KB (1,978 words) - 15:07, 12 October 2023
- ...inator Tpsbc. gshA and gshB are responsible for the high expression of Gsh synthesis, thus the synthesis of Damage suppressor protein in cells, improving the DNA strength of engine6 KB (806 words) - 13:20, 12 October 2023
- ...e the expression of erythrose 4-phosphate (E4P) and facilitate the de novo synthesis of erythritol, thereby increasing its yield. To enable the de novo synthesis of erythritol in Y. lipolytica, we selected the Yida and ER genes from Y. l7 KB (1,064 words) - 09:27, 12 October 2023
- ...ential phase transcriptional control device produced an initially high GFP synthesis rate which dropped off as cell density increased. Data shown are averages1 KB (178 words) - 00:28, 8 March 2008
- 10. Synthesis details (if part was created by DNA synthesis). 12. Synthesis details (if part was made by DNA synthesis).6 KB (898 words) - 17:23, 18 March 2008
- ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o ...precursors, only in photosynthetic organisms and some microorganisms. The synthesis of carotenoids is encoded by plasmids or chromosome genes. The genes that e10 KB (1,580 words) - 12:19, 21 October 2021
- ...ommend you use <span style="color:red">DNA synthesis</span> . We recommend synthesis for the following reasons: #'''Life is too short'''. DNA Synthesis is available to iGEM Teams. Check out the iGEM partner programs.5 KB (655 words) - 12:58, 1 August 2018
- Odvs003 Gene Synthesis of CBK basic part CCATAGAATTCATGAGATCTGGTTCTGGTCCGACCCAGTCTCACTACGGTCAGTGCG Odvs004 Gene Synthesis of CBK basic part CGCAAACGGTCGGACCAGAGTAACCGATACCACCGCACTGACCGTAGTGAGACTG1 KB (126 words) - 23:14, 10 May 2009
- ...sub>2</sub>). It constitutes the first class in the three classed flagella synthesis cascade. Class II consist of genes encoding proteins that make up the basal4 KB (558 words) - 22:48, 27 October 2010
- ...n of cytosine to uracil. Subsequently, cytosine can be used for pyrimidine synthesis [Kilstrup et al., 1989, Anderson et al., 1989]. The expression of codA is r ...ymidylate synthetase and subsequently loss of dTTPs. Hence, during the DNA synthesis, both FdUTP as well as uridine throphosphate become incorporated into the D4 KB (593 words) - 00:39, 28 October 2010
- ...sub>2</sub>). It constitutes the first class in the three classed flagella synthesis cascade. Class II consist of genes encoding proteins that make up the basal4 KB (552 words) - 23:09, 27 October 2010
- ...sub>2</sub>). It constitutes the first class in the three classed flagella synthesis cascade. Class II consist of genes encoding proteins that make up the basal10 KB (1,489 words) - 19:07, 5 November 2010
- ...y continued with PCR and cloning, because they knew by experience that DNA synthesis could possibly take long. ...because the ordered rebellious ITRs didn’t arrive until now – even DNA synthesis seems to be difficult….<br/>12 KB (1,828 words) - 19:56, 23 October 2010
- ...y continued with PCR and cloning, because they knew by experience that DNA synthesis could possibly take long. ...because the ordered rebellious ITRs didn’t arrive until now – even DNA synthesis seems to be difficult….<br/>12 KB (1,771 words) - 23:53, 22 October 2010
- Enzyme in the pathway required for B-Carotene Synthesis. This enzyme is a combination, it is the full Phytoene Synthase enzyme spli ...r cell basis for different combinations of parts involved in beta-carotene synthesis. These are compared with a wild type control. tHMG1 is used to funnel more7 KB (961 words) - 19:15, 8 October 2020
- 3. GFP synthesis rate was then obtained by calculating the slope of linear regression line o ...t inducer concentrations were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;16 KB (2,311 words) - 22:15, 26 September 2015
- ...feine synthesis can go on. To support this irreversible, stepwise caffeine synthesis, we used the strongest promoter for this enzyme, to establish high concentr ...On the Specificity of Caffeine Effects, MGG, 1972), but previous caffeine synthesis experiments (see below) have only led to a concentration of about 5 µg/g (7 KB (1,114 words) - 10:11, 24 October 2012
- ...and 4 areas and structurally are really diverse. 28 is involved in the synthesis of flagell in E.coli(Paget, 2015). For that work of sigma factor the great ...iciency of synthesis differed for two promoters as well: the efficiency of synthesis for flgMp was higher than that one for modAp1.7 KB (1,051 words) - 14:15, 27 October 2017
- ...icular pathway was chosen so that one less enzyme would be required in the synthesis (compared to three in C. arabica). ====Origin: Saccharomyces cerevisiae, E. coli, synthesis, genome====14 KB (1,998 words) - 06:28, 20 October 2021
- ...that the overexpression of adrA can help increase the ability of cellulose synthesis.</p> ...ll these results indicated that AdrA can increase the ability of cellulose synthesis.Actually, BcsB can be activated by c-di-GMP. But till the deadline, we have2 KB (337 words) - 16:52, 26 October 2012
- ...activity of [[Part:BBa_K1045003|BBa_K1045003]]'''. (A) SDS PAGE confirmed synthesis of DAC using [[Part:BBa_K1045003|BBa_K1045003]] in three independent biolog ...molecules as an indirect marker. Each PP that is released during c-di-AMP synthesis was cleaved by the PP phosphatase to yield 2 P molecules. Consequently, 4 P42 KB (5,560 words) - 22:49, 28 October 2013
- ...sible for the synthesis of enzymes involved in production of peptidoglycan synthesis. Disruption of this pathway can be utilised to down-regulate production of ...s can be seen shortening and widening over time as peptidoglycan cell wall synthesis is down-regulated and insufficient amounts of cell wall are able to maintai15 KB (2,148 words) - 12:08, 26 October 2013
- We test the constructs' efficiency from 2 parameters: poly-P synthesis efficiency and phosphate removal efficiency from the medium. ==='''Efficiency of poly-P synthesis and phosphate removal from environment'''===3 KB (394 words) - 06:38, 5 October 2013
- ...mic membrane, activation of autolysin, inhibition of DNA, RNA, and protein synthesis, and inhibition of certain enzymes. One emerging technique for the study of2 KB (354 words) - 16:20, 15 October 2018
- ...mic membrane, activation of autolysin, inhibition of DNA, RNA, and protein synthesis, and inhibition of certain enzymes. One emerging technique for the study of3 KB (371 words) - 16:23, 15 October 2018
- ...evel is increased thereby up-regulating genes whose products catalyze NADH synthesis. Therefore the augmented pool size of NAD<sup>+</sup>(H) result in promotio <strong>Fig. 1 De novo synthesis and salvage pathway of NAD biosynthesis.</strong>4 KB (532 words) - 14:45, 12 October 2023
- .../Science/Proto">here</a>, was codon-optimized for <em>E. coli</em> K12 and synthesis was requested along with the BioBrick prefix and suffix. While we were able ...h data for the toxicity issues that they encountered. In summary, in-vitro synthesis presented no particular problems, but when the sequence was cloned into the7 KB (1,083 words) - 21:43, 17 October 2018
- ...It can inhibit one of the Hfs protein family-HfsJ. So it can block up the synthesis of polysaccharide. HfiA, It is regulated downstream of lovK-lovR and the re ...evelopment via direct interaction with an enzyme required for holdfast bio-synthesis.</p>2 KB (243 words) - 02:21, 2 November 2014
- ...It can inhibit one of the Hfs protein family-HfsJ. So it can block up the synthesis of polysaccharide. HfiA, It is regulated downstream of lovK-lovR and the re ...evelopment via direct interaction with an enzyme required for holdfast bio-synthesis.</p>2 KB (300 words) - 05:38, 1 November 2014
- ...r the organism's enoyl acyl-carrier-protein reductase in type 2 fatty acid synthesis. The enzyme this encodes for uses NADH and crotonyl COA as substrates. Triclosan inhibits type 2 fatty acid synthesis (FASII), an essential pathway in the Bacterial and Eukaryotic domains by in7 KB (952 words) - 23:16, 18 September 2015
- ...ns et al. 1989]), is especially helpful in ''in vitro'' cell free protein synthesis. The 5'-UTR sequence contains a spacer of 10 adenine bases which has been s ...we developed cell-free biosensors with the help of <i>in vitro</i> protein synthesis. This part became our positive control due to superior performance compared4 KB (691 words) - 19:16, 19 September 2015
- ...eviously. We conducted a <a data-toggle="tooltip" title="Cell free protein synthesis">CFPS</a> with extract from strain constitutivly expressing BlcR. As report ...andard cell extract. For GHB the effect was even greater, stopping protein synthesis completely at 3% (v/v) final concentration as depicted in the graphs. </p>14 KB (2,174 words) - 19:55, 19 September 2015
- ...cholesterol into Pregnenolone. With her help we designed the pregnenolone synthesis biobrick, but there were some problems. Firstly, for pregnenolone to be syn ...10 working days we have left in the competition. In point of fact the DNA synthesis will take longer than 10 working days.'15 KB (2,405 words) - 19:36, 18 October 2016
- ===Synthesis of the napDABC operon=== <p>Synthesis of the napDABC operon BioBrick was complicated due to the presence of an il4 KB (639 words) - 21:33, 19 October 2016
- ...s a bit different because it is optimized for E.Coli DH5-Alpha and for IDT synthesis. <br> ...llowed by 6 histidines and optimized it for a use in <i>E.coli</i> and IDT synthesis. In our plasmid, this gene is positioned after an inducible promoter, the P25 KB (3,824 words) - 21:17, 20 October 2016
- ...r-RBS-XylR-RBS-mRFP-Terminator. This BioBrick was designed to monitor XylR synthesis by our cells. <br/> ...of the red protein mRFP meaning that the Pr promoter trigger XylR and mRFP synthesis.2 KB (309 words) - 01:42, 20 October 2016
- ...P favors polyphosphate hydrolysis, and PPK2’s affinity for hydrolysis or synthesis varies by homolog. [2] We have selected four PPK homologs from <i>M. phosph ...een previously characterized, the affinity for polyphosphate hydrolysis or synthesis could be predicted by phylogenetic analysis for PPK1, PPK2 homolog A, and P10 KB (1,586 words) - 21:40, 29 October 2016
- <u><font size="+0.5">Optimising conditions for EutM synthesis using 'Design of Experiments'</font></u> <li>concentration of Tetracyclin inducer (induces EutMN synthesis)</li>13 KB (2,025 words) - 10:35, 21 October 2019
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind3 KB (426 words) - 19:53, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind3 KB (444 words) - 12:52, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind3 KB (502 words) - 17:05, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind3 KB (445 words) - 12:55, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind3 KB (538 words) - 17:31, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind7 KB (1,075 words) - 23:42, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind7 KB (1,075 words) - 23:42, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind7 KB (1,149 words) - 23:42, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind7 KB (1,075 words) - 23:41, 1 November 2017
- ...taneously oxidized into diacetyl (figure 1). This enzyme is crucial in the synthesis pathway of diacetyl in <i>Lactococcus lactic</i>. ...trong RBS (BBa_B0034) and a terminator (BBa_B1006). IDT performed the DNA synthesis and delivered the part as gBlock.6 KB (916 words) - 09:31, 31 October 2017
- ...ular closure. In our project we were using BLS for activating our chemical synthesis by formation of a β-lactam ring in vitro. In order to simplify purificatio <tr> <td>Source</td> <td>IDT (DNA synthesis) </td></tr>2 KB (326 words) - 20:26, 1 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind9 KB (1,485 words) - 03:47, 2 November 2017
- ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind9 KB (1,414 words) - 03:46, 2 November 2017
- ...GEM teams to further build upon the application of the gshF in glutathione synthesis in industry and hence, increase the resistance of engineered cells to react7 KB (1,100 words) - 12:19, 27 October 2020
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,676 words) - 15:53, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,679 words) - 03:01, 19 October 2019
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,703 words) - 06:20, 17 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,676 words) - 15:53, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,676 words) - 15:53, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,676 words) - 16:01, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,719 words) - 16:06, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,676 words) - 16:01, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,676 words) - 16:01, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:11 KB (1,676 words) - 16:02, 16 October 2018
- ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:13 KB (1,956 words) - 03:41, 17 October 2018
- ...n the G2 phase decreased. This indicated that mir-135b-3p affected the DNA synthesis of gastric cancer cell MKN45, i.e. S phase.8 KB (1,210 words) - 12:49, 16 October 2018
- ...n the G2 phase decreased. This indicated that mir-135b-3p affected the DNA synthesis of gastric cancer cell MKN45, i.e. S phase.5 KB (766 words) - 09:55, 16 October 2018
- ...iously codon-optimised for expression in Escherichia coli of the Cellulose Synthesis elements CmcAx and CcpAx. This part should be used together with the Parts ...els of BcsB and BcsC which are proteins members of the bacterial cellulose synthesis complex indicating CcpAx also plays a regulatory role in BC biosynthesis.2 KB (268 words) - 03:09, 15 October 2018
- ===Experiment results of crRNA synthesis=== As fig. 7 shows, we synthesis the band between 200 bp and 100 bp, which is the correct size of crRNA temp2 KB (315 words) - 14:00, 21 October 2019
- ...omposed of PgsB、PgsC and PgsA. PgsB catalyzes poly-γ-glutamic acid synthesis.And PgsC links PgsB and PgsA in the membrane. While PgsA transports 2. Peng Yingyun. Study on the production, synthesis mechanism and antifreeze of γ-polyglutamic acid. Diss. Jiangnan University9 KB (1,312 words) - 02:27, 22 October 2021
- ...erse Transcriptase (MLRT) co-expressed in E. Coli cells. It allows in vivo-synthesis of ssDNA due to the reverse transcription, and also RNA template degradatio .... This part design is modified from a previously described method of ssDNA synthesis using this HTBS sequence and B0054 terminator.<ref>Elbaz, J., Yin, P. & Voi10 KB (1,407 words) - 18:44, 21 October 2019
- ...erse Transcriptase (MLRT) co-expressed in E. Coli cells. It allows in vivo-synthesis of ssDNA due to the reverse transcription, and also RNA template degradatio .... This part design is modified from a previously described method of ssDNA synthesis using this HTBS sequence and B0054 terminator.<ref>Elbaz, J., Yin, P. & Voi10 KB (1,410 words) - 18:43, 21 October 2019
- ...erse Transcriptase (MLRT) co-expressed in E. Coli cells. It allows in vivo-synthesis of ssDNA due to the reverse transcription, and also RNA template degradatio .... This part design is modified from a previously described method of ssDNA synthesis using this HTBS sequence and B0054 terminator.<ref>Elbaz, J., Yin, P. & Voi10 KB (1,407 words) - 18:46, 21 October 2019
- ...erse Transcriptase (MLRT) co-expressed in E. Coli cells. It allows in vivo-synthesis of ssDNA due to the reverse transcription, and also RNA template degradatio .... This part design is modified from a previously described method of ssDNA synthesis using this HTBS sequence and B0054 terminator.<ref>Elbaz, J., Yin, P. & Voi10 KB (1,409 words) - 18:46, 21 October 2019
- ...erse Transcriptase (MLRT) co-expressed in E. Coli cells. It allows in vivo-synthesis of ssDNA due to the reverse transcription, and also RNA template degradatio .... This part design is modified from a previously described method of ssDNA synthesis using this HTBS sequence and B0054 terminator.<ref>Elbaz, J., Yin, P. & Voi10 KB (1,407 words) - 18:47, 21 October 2019
- ...erse Transcriptase (MLRT) co-expressed in E. Coli cells. It allows in vivo-synthesis of ssDNA due to the reverse transcription, and also RNA template degradatio .... This part design is modified from a previously described method of ssDNA synthesis using this HTBS sequence and B0054 terminator.<ref>Elbaz, J., Yin, P. & Voi10 KB (1,411 words) - 18:48, 21 October 2019
- ====Replication of Cell-Free Protein Synthesis (CFPS) of <partinfo>BBa_K2686002</partinfo>==== First, we decided to replicate the cell-free synthesis and heat purification of T. maritima encapsulins that we received from plas15 KB (2,220 words) - 02:00, 19 October 2019
- ...we present the cloning of thioesterase I (TesA), an enzyme involved in the synthesis of free fatty acids in <i>E. coli</i>. ...produced to create a composite part with other gene involved in 2-nonanone synthesis. The promoter will therefore be associated with the design of the last gene2 KB (315 words) - 15:04, 21 October 2019
- In our study, we aim to achieve limonene and linalool synthesis in <i>E.coli</i> DH5<i>α</i>. According to 2018 GreatBay_China team’s ex ...HINA--project3.png |700px|thumb|center|<b>Figure 1:</b> (A)MVA pathway. (B)Synthesis of limonene and linalool]]</div>8 KB (1,240 words) - 16:15, 27 October 2020
- In our study, we aim to achieve limonene and linalool synthesis in <i>E.coli</i> DH5<i>α</i>. According to 2018 GreatBay_China team’s ex ...HINA--project3.png |700px|thumb|center|<b>Figure 1:</b> (A)MVA pathway. (B)Synthesis of limonene and linalool]]</div>5 KB (775 words) - 03:18, 22 October 2019
- Fig.1 The mechanism of A/U-rich 5'-UTR to promote protein synthesis.<BR> ...to the RBS, promoting the translation process and accelerating the protein synthesis.<BR>4 KB (603 words) - 02:38, 22 October 2019
- ...regulated by p15A-MVA provides substrates for GPPS, which allows linalool synthesis to occur. We used IPTG to induce bacteria cotransformed to E. Coli DH5α wi ...are not treated with glucose. This indicates that glucose may promote the synthesis of linalool in E.coli DH5α. We do not need to knock out the gene in5 KB (737 words) - 01:49, 28 October 2020
- ...regulated by p15A-MVA provides substrates for GPPS, which allows linalool synthesis to occur. We used IPTG to induce bacteria cotransformed to E. Coli DH5α wi ...are not treated with glucose. This indicates that glucose may promote the synthesis of linalool in E.coli DH5α. We do not need to knock out the gene in5 KB (735 words) - 01:46, 28 October 2020
- ...antibiotic molecules, which enhances the interference with normal protein synthesis, causing greater damage to the cell membrane, forming an "autocatalytic typ The fidelity of the bacterial protein synthesis process is maintained by "monitoring" the base pairing between the mRNA cod7 KB (1,032 words) - 04:56, 22 October 2020
- ...antibiotic molecules, which enhances the interference with normal protein synthesis, causing greater damage to the cell membrane, forming an "autocatalytic typ The fidelity of the bacterial protein synthesis process is maintained by "monitoring" the base pairing between the mRNA cod7 KB (1,079 words) - 18:42, 27 October 2020
- ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...roles, nsP2 is intimately involved in the shutoff of host macro-molecular synthesis.nsP2 functions as a helicase to unwind RNA secondary structures formed duri8 KB (1,194 words) - 08:37, 21 October 2021
- ===Synthesis=== When trying to order this code it was far too complex for IDT to synthesis, even with codon optimisation.3 KB (405 words) - 03:08, 28 October 2020
- As an oxidase, laccase has been used to catalyze dye synthesis from plant-derived pigment precursors (Jeon et al., 2010). In the study, 15 ...n in hair dyeing: Enzymatic colourations driven by homo- or hetero-polymer synthesis", Microbial Biotechnology, vol. 3, no. 3, pp. 324-335, 2010. Available: 10.6 KB (901 words) - 01:18, 22 October 2021
- ...S_SPBS--Dopamine Synthesis--Pathway.png|600px|center|thumb|Fig 1. Dopamine Synthesis Pathway]] ...mine and phenethylamine family synthesized in plants and most animals. The synthesis of dopamine is accomplished by removing the carboxyl group from its chemica3 KB (444 words) - 01:57, 27 October 2020
- ...S_SPBS--Dopamine Synthesis--Pathway.png|600px|center|thumb|Fig 1. Dopamine Synthesis Pathway]] ...mine and phenethylamine family synthesized in plants and most animals. The synthesis of dopamine is accomplished by removing the carboxyl group from its chemica3 KB (444 words) - 01:57, 27 October 2020
- ...S_SPBS--Dopamine Synthesis--Pathway.png|600px|center|thumb|Fig 1. Dopamine Synthesis Pathway]] ...mine and phenethylamine family synthesized in plants and most animals. The synthesis of dopamine is accomplished by removing the carboxyl group from its chemica3 KB (421 words) - 01:57, 27 October 2020
- ...S_SPBS--Dopamine Synthesis--Pathway.png|600px|center|thumb|Fig 1. Dopamine Synthesis Pathway]] ...phenethylamine family that is synthesized in plants and most animals. The synthesis of dopamine is accomplished by removing the carboxyl group from its chemica3 KB (462 words) - 04:43, 27 October 2020
- ==== Origin: Synthesis from a genetic company ==== ==== Origin: Synthesis from a genetic company ====12 KB (1,718 words) - 03:49, 22 October 2021
- As an oxidase, laccase has been used to catalyze dye synthesis from plant-derived pigment precursors (Jeon et al., 2010). In the study, 15 ...n in hair dyeing: Enzymatic colourations driven by homo- or hetero-polymer synthesis", Microbial Biotechnology, vol. 3, no. 3, pp. 324-335, 2010. Available: 10.4 KB (594 words) - 05:25, 27 October 2020
- ...525nm light environment, CarH tetramer photolysis which resulted in dsRNA synthesis expression.793 B (122 words) - 17:01, 25 October 2020
- ===Synthesis=== ...ng to order this insert from IDT the insert as a whole was too complex for synthesis. Given this we ran codon optimisation and we intended to order the two circ4 KB (601 words) - 03:05, 28 October 2020
- ...B binds to c-di-GMP, which afterwards aids the activation of the cellulose synthesis process. This CDS originates from a very productive cellulose synthesising ...tic activity of BcsA and is localized in the region required for cellulose synthesis within BcsB’s C-terminal, a membrane-associated domain that packs against5 KB (707 words) - 00:16, 28 October 2020
- ...ne-anchored BcsB subunit, forms a complex that is sufficient for cellulose synthesis in vitro. This CDS originates from a very productive cellulose synthesising ...directly above the active site, thereby allowing the coupling of cellulose synthesis and translocation. In addition, BcsA forms a PilZ domain within its C-termi5 KB (737 words) - 03:04, 28 October 2020
- ...regulated by p15A-MVA provides substrates for GPPS, which allows linalool synthesis to occur. We used IPTG to induce bacteria cotransformed to E. Coli DH5α wi ...are not treated with glucose. This indicates that glucose may promote the synthesis of linalool in E.coli DH5α. We do not need to knock out the gene in5 KB (724 words) - 01:49, 28 October 2020
- ...l as their length. The created nucleotide sequences were purchased as gene synthesis from IDT and EurofinsGenomics. In general, the nanobody grafting process ge ...ewer mutations occurred. This indicates that an error occurred during gene synthesis.56 KB (8,191 words) - 03:28, 28 October 2020
- ...l as their length. The created nucleotide sequences were purchased as gene synthesis from IDT and EurofinsGenomics. In general, the nanobody grafting process ge ...ewer mutations occurred. This indicates that an error occurred during gene synthesis.57 KB (8,247 words) - 03:32, 28 October 2020
- ...l as their length. The created nucleotide sequences were purchased as gene synthesis from IDT and EurofinsGenomics. In general, the nanobody grafting process ge ...ewer mutations occurred. This indicates that an error occurred during gene synthesis.57 KB (8,249 words) - 03:33, 28 October 2020
- ...ref><ref name="x">Rustad M, Eastlund A, Marshall R, Jardine P, Noireaux V. Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression Syste ...><ref name="x">Rustad M, Eastlund A, Jardine P, Noireaux V. Cell-free TXTL synthesis of infectious bacteriophage T4 in a single test tube reaction. Synth Biol (9 KB (1,297 words) - 08:10, 19 October 2021
- ...ref><ref name="x">Rustad M, Eastlund A, Marshall R, Jardine P, Noireaux V. Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression Syste ...><ref name="x">Rustad M, Eastlund A, Jardine P, Noireaux V. Cell-free TXTL synthesis of infectious bacteriophage T4 in a single test tube reaction. Synth Biol (10 KB (1,523 words) - 08:19, 19 October 2021
- ...ref><ref name="x">Rustad M, Eastlund A, Marshall R, Jardine P, Noireaux V. Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression Syste ...><ref name="x">Rustad M, Eastlund A, Jardine P, Noireaux V. Cell-free TXTL synthesis of infectious bacteriophage T4 in a single test tube reaction. Synth Biol (7 KB (990 words) - 08:20, 19 October 2021
- ...3 hours with 0.1mM IPTG, 50mg/L chloroamphenicol was added to bog down the synthesis of protein in the engineered bacteria in order to make the experimental ope The data shows that after the protein synthesis was inhibited, the change in the amount of secreted protein over time was w12 KB (1,785 words) - 01:41, 22 October 2021
- ...regulation and enhances the synthesis of L-lysine(Klompe et al., 2019) for synthesis of 5-AVA by DavB and DavA. DavB catalyzes L-lysine to 5-aminovaleramide and ...h metabolic burden on S.elongatus UTEX 2973 while still enhancing L-lysine synthesis.2 KB (322 words) - 19:14, 21 October 2021
- ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o ...precursors, only in photosynthetic organisms and some microorganisms. The synthesis of carotenoids is encoded by plasmids or chromosome genes. The genes that e10 KB (1,507 words) - 13:07, 21 October 2021
- ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two GGPP molecu ...lants, is the protection from photooxidation. In the pathway of carotenoid synthesis, only crtI can convert octahydrolycopene to lycopene, and catalyze the desa10 KB (1,535 words) - 13:03, 21 October 2021
- ...used this part in the aim for detecting progesterone in cell-free protein synthesis (CFPS) system in <i>E.coli</i>. We also performed cell-free protein synthesis reaction with the extracts, using <partinfo>BBa_K4158010</partinfo> as the7 KB (1,131 words) - 14:19, 11 October 2022
- ...ed and translated into phytoene synthase,which is the key enzyme for the synthesis of curcumin. It participates in the transformation from two GGPP molecules ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o3 KB (493 words) - 12:55, 21 October 2021
- ...and translated into phytoene desaturase,which is the key enzyme for the synthesis of curcumin. It participates in the transformation from all-trans plant alk ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two GGPP molecu4 KB (533 words) - 12:55, 21 October 2021
- ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu2 KB (272 words) - 09:39, 21 October 2021
- ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu4 KB (636 words) - 10:29, 21 October 2021
- ...hesis pathway of heme precursor ALA (upstream), and the other part was the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</6 KB (933 words) - 05:40, 12 October 2023
- ====Origin: Saccharomyces cerevisiae, E. coli, synthesis==== ====Origin: Saccharomyces cerevisiae, synthesis====5 KB (690 words) - 02:12, 20 October 2021
- === Origin: Saccharomyces cerevisiae, synthesis === ====Origin: synthesis====6 KB (803 words) - 07:31, 21 October 2021
- ...cid synthesis. The BBa_K3909024 is belong to part two -- γ-linolenic acid synthesis. ...hosphate decarboxylase, which can catalyze one of the key reactions in the synthesis of yeast RNA pyrimidine nucleotides, it can be used as a selection marker.7 KB (1,004 words) - 11:34, 16 October 2021
- ...ed ssDNA molecules as templates both for the second strand DNA and the RNA synthesis. ...hat the forthcoming transcription step cannot start until the previous DNA synthesis has not finished.4 KB (621 words) - 22:51, 21 October 2021
- ==== Origin: Synthesis from a genetic company ==== ==== Origin: Synthesis from a genetic company ====9 KB (1,279 words) - 03:48, 22 October 2021
- ...uptake of L-alanine from an alanine-doped LB growth medium, to facilitate synthesis of alanine-rich proteins such as MaSps (Major Ampullate Silk proteins). ...resources (ATP, transcriptional and translational machinery etc) away from synthesis of other porins responsible for alanine uptake. Moreover, CycA translation7 KB (1,048 words) - 08:31, 12 October 2022
- ...CysE* ([[Part:BBa_K4171004 |BBa_K4171004]]) are engaged in cysteine (Cys) synthesis pathway in <i>E. coli</i>. CysE* catalyzes serine (Ser) into O-acetyl-serin ...h selenium and producing selenocysteine (Sec) by mimicking the natural Cys synthesis pathway. Therefore, P<sub>lacI</sub>-cysK-cysE* (<b>BBa_K4171012</b>) is co3 KB (420 words) - 12:29, 12 October 2022
- ...se is able to work properly on the template when doing <i>in vitro</i> RNA synthesis. <p style="text-align:center;">Fig. 1. <i>In vitro</i> Sec synthesis pathway</p>2 KB (298 words) - 13:26, 12 October 2022
- ...e is able to work properly on the template when doing <i>in vitro</i> RNA synthesis. <p style="text-align:center;">Fig. 1. <i>In vitro</i> Sec synthesis pathway</p>2 KB (287 words) - 13:39, 12 October 2022
- ...e is able to work properly on the template when doing <i>in vitro</i> RNA synthesis. <p style="text-align:center;">Fig. 1. <i>In vitro</i> Sec synthesis pathway</p>2 KB (288 words) - 12:23, 12 October 2022
- UDP-N-acetylglucosamine synthesis cluster ...isms [2, 3]. Despite the enzymes existing in most bacteria, taking part in synthesis of peptidoglycan, the expression is significantly lower than in yeasts, whi7 KB (1,031 words) - 17:44, 30 September 2022
- ...The 3WJ-Bro can be used to ligate fluorescent aptamers to examine the RNA synthesis of target genes at transcriptional level in Escherichia coli cells, obviati ...According to the results, the 3WJ-Bro can be used to examine the relE RNA synthesis at transcriptional level.2 KB (333 words) - 11:48, 11 October 2022
- <p> This year our project is focused on the synthesis of anthocyanin, which has a lot of research and reporting on this canonical [[File:SHSBNU-1.jpg|600px|thumb|left|Figure 1. anthocyanin synthesis pathway]]5 KB (867 words) - 04:16, 11 October 2022
- ...dard component assembly. We synthesized a copper-sensitive promoter by DNA synthesis and named it pcutR. We synthesized ribB gene by DNA synthesis. The recombinant plasmid pLZ01-pcutR-ribB was transferred to Escherichia co6 KB (872 words) - 09:13, 12 October 2022
- ...cellulose-chitosan copolymer</b>. The composite consists of an operon for synthesis and incorporation of N-acetylglucosamine, producing a bacterial cellulose-c ...a_K4719014</a> as a plasmid backbone containing bacterial cellulose-chitin synthesis operon where signal peptide sequence and deacetylase AnCDA (<a href="https:7 KB (1,080 words) - 14:41, 12 October 2023
- ...is strain A-5. pgaBCAE protein coding region.This part is useful for y-PGA synthesis.(The part included in the ellipse is the Polyglutamate synthetase catalytic ...B. subtilis pgsBCA and the required factor (pgsE) were essential for y-PGA synthesis , which functioned as a synthase complex. The transmembrane and subcellular4 KB (613 words) - 16:59, 11 October 2023
- ...strain by CRISPR/Cas9. The results strain has a greater flux of polyamine synthesis, especially putrescine. We investigate whether this part can confer thermo- ...ursor spermidine's production. To enhance the metabolic flux of spermidine synthesis in our strain, we initiated the knockout experiment of the endogenous OAZ14 KB (603 words) - 11:53, 3 October 2023
- ...mall amounts. With the overexpression of a naturally occurring gene of the synthesis pathway of <i>sinorhizobium meliloti 2011</i>, called <i>bluB</i> (<a href= .../a>). Thereby we have both proven the expression of BluB as well as AdoCbl synthesis.</html>5 KB (722 words) - 05:56, 12 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (550 words) - 06:11, 12 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</4 KB (660 words) - 17:14, 11 October 2023
- ..., we overexpress hemA and hemL genes. The downstream pathway, that is, the synthesis pathway of heme, involves 7 genes, of which 4 genes (hemB, hemD, hemC, hemH2 KB (378 words) - 07:48, 10 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</4 KB (550 words) - 17:17, 11 October 2023
- ..., we overexpress hemA and hemL genes. The downstream pathway, that is, the synthesis pathway of heme, involves 7 genes, of which 4 genes (hemB, hemD, hemC, hemH2 KB (378 words) - 07:52, 10 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (506 words) - 17:18, 11 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (487 words) - 17:20, 11 October 2023
- ..., we overexpress hemA and hemL genes. The downstream pathway, that is, the synthesis pathway of heme, involves 7 genes, of which 4 genes (hemB, hemD, hemC, hemH2 KB (378 words) - 08:20, 10 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (541 words) - 06:14, 12 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (568 words) - 16:58, 11 October 2023
- We divide the synthesis pathway of heme into two parts, one is the synthesis pathway of heme premise ALA, and the other part is the synthesis pathway of ALA to heme, one upstream and one downstream.2 KB (364 words) - 16:52, 7 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (480 words) - 17:21, 11 October 2023
- We divide the synthesis pathway of heme into two parts, one is the synthesis pathway of heme premise ALA, and the other part is the synthesis pathway of ALA to heme, one upstream and one downstream.2 KB (364 words) - 16:56, 7 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (581 words) - 16:59, 11 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (483 words) - 17:31, 11 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (523 words) - 17:32, 11 October 2023
- ...ynthesis pathway of heme premise ALA (upstream), and the other part is the synthesis pathway of ALA to heme (downstream). The downstream pathway, that was, the synthesis pathway of heme, involved 7 genes, of which 4 genes (<i>hemB</i>, <i>hemD</3 KB (504 words) - 17:26, 11 October 2023
- ...s a reliable reporter for the TME and could be used as a condition for the synthesis of anti-tumor drugs. ...e species strains or the strains of the same genus <sup>[6]</sup>. Colicin synthesis is based on the presence of Col-like plasmids located in the cytoplasm of t17 KB (2,651 words) - 15:51, 12 October 2023
- terminator Tpsbc, which is responsible for the high expression of Gsh synthesis and thus synthesis pathway to resist radiation hazards such as oxde-induced protein denaturati5 KB (712 words) - 13:31, 12 October 2023
- asdA is a relevant gene that regulates the synthesis of diaminopimelic acid (DAP), which is an essential component of bacterial ...bacterial growth can be achieved when Arabidose is added, allowing for the synthesis of cell wall acid. However, as Arabidose is depleted, the murA gene control2 KB (299 words) - 11:48, 12 October 2023
- <th class="model-th">Lsr-synthesis rate</th> <th class="model-th">LsrR synthesis rate</th>9 KB (1,360 words) - 00:48, 22 October 2021
- *steady state must be valid, so (dF/dt)/ABS (proportional to the GFP synthesis rate per cell) must be constant. * steady state must be valid, so (dF/dt)/ASB (proportional to the GFP synthesis rate per cell) must be constant.49 KB (7,616 words) - 14:47, 26 October 2020
- ...in such a way, that chimeric enzymes (fused with zinc finger domains) for synthesis of violacein bind to the sequence in the order required to produce the fina ...and [[Part:BBa_K323132]] to the program sequence and have shown increased synthesis of violacein, in addition to a decrease in formation of side products, name1 KB (181 words) - 14:42, 27 October 2010
- ...ee MazF in the cells, which then cleaves cellular mRNAs to inhibit protein synthesis, leading to growth arrest. The protein-protein interaction interface betwee ...ain amino acid levels in the brain and interferes with neural cell protein synthesis which reduced social interactions and other changes. Improving the SLC7A5 l21 KB (3,117 words) - 18:26, 13 October 2022
- ...ecular beacons, a list of synthesis companies as well as protocols for the synthesis and characterization of molecular beacons can be found [http://www.molecula ...a KS, Pinko C (2004) Structural Rearrangement Accompanying NAD<sup>+</sup> Synthesis within a Bacterial DNA Ligase Crystal, [http://www.cell.com/structure/abstr37 KB (5,540 words) - 02:26, 26 August 2020
- ===Producing BBa_k638402 from primer synthesis===6 KB (874 words) - 00:51, 22 September 2011
- ...ACP synthase III (KAS III). In general terms, the first step of Fatty acid synthesis involves KAS III acting as a condensation enzyme by “forming a carbon-car ...foreign PUFA synthase did not have to compete with the natural fatty acid synthesis pathway because FabH was disbaled . Additionally, the FabH mutant also has12 KB (1,816 words) - 22:06, 18 December 2020
- ...uding but not limited to sulfur insertion, radical formation, organic ring synthesis, and anaerobic oxidation. ...e CTD of HydG resulted in an inactive hydrogenase, which indicates that CO synthesis is metal-based and occurs in the CTD and probably uses the [4Fe–4S] clust2 KB (353 words) - 22:03, 25 September 2011
- ...n, produced mainly by monocytes. It is responsible for down-regulating the synthesis of pro-inflammatory cytokines like IFN-γ, IL-2, IL-3, TNFα (Th1 cytokines ...sruption caused by inflammation. It is responsible for down-regulating the synthesis of pro-inflammatory cytokines like IFN-γ, IL-2, IL-3, TNFα (Th1 cytokines10 KB (1,419 words) - 17:38, 23 October 2020
- ...grown to log phase (OD600=0.5) at which time IPTG was added to induce the synthesis of CDS7. In the first experiment CdCl2 was added (either 1mM or 10mM)at the ...xperiments even after the iGEM has ended. We will optimize the quantum dot synthesis protocol and determine conclusively whether or not we are making quality qu4 KB (683 words) - 00:31, 10 October 2011
- ...with two GMP moieties that are fused by a 5’-3’ macrocyclic ring. The synthesis of c-di-GMP is catalyzed by diguanylate cyclases (DGCs) through the coopera <h3>The synthesis of c-di-GMP</h3>9 KB (1,461 words) - 06:28, 1 October 2022
- ...ter with GFP (BBa_E0240), the promoter activity was represented by the GFP synthesis rate which can be easily measured. ''E. coli'' carrying the right construct 3. GFP synthesis rate was then obtained by calculating the slope of the above mentioned curv7 KB (1,139 words) - 03:06, 26 August 2020
- ...de: human Ig kappa chain V-I region taken from UniProt P01601[1-22], gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus)<br> Nanobody: anti-GFP nanobody taken from Protein Data Bank(PDB: 3OGO), gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus)<br>885 B (119 words) - 11:22, 24 September 2012
- This BioBrick is the final "caffeine synthesis device". It contains all three necessary enzymes: CaXMT1, CaMXMT1 and CaDX ...On the Specificity of Caffeine Effects, MGG, 1972), but previous caffeine synthesis experiments (see below) have only led to a concentration of about 5 µg/g (9 KB (1,299 words) - 19:49, 26 October 2012
- ...For creating an expression cassette with all three enzymes of the caffeine synthesis pathway [https://parts.igem.org/Part:BBa_K801077 BBa_K801077] based on the ...On the Specificity of Caffeine Effects, MGG, 1972), but previous caffeine synthesis experiments (see below) have only led to a concentration of about 5 µg/g (7 KB (1,096 words) - 10:10, 24 October 2012
- ...ytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase on squalene synthesis in Saccharomyces cerevisiae ''. Appl. Environ. Microbiol. 1997, 63(9):3341. This result to be due to the fact that as a result of massive synthesis of mevalonate, β-carotene was produced in large amount.7 KB (1,039 words) - 02:40, 10 October 2023
- ...of the specific production rate of GFP it can be demonstrated that the GFP synthesis rates differ between the cultivation on glucose and glycerol. The specific Only at the end, the GFP synthesis of the uninduced cultivations seems to be lower. This might be caused by th16 KB (2,344 words) - 13:44, 29 October 2013
- ...3’ untranslated regions (UTRs) found within the HCV genome to direct RNA synthesis. The UTRs form ordered RNA structures and are evolutionary conserved. </p>2 KB (344 words) - 23:22, 15 October 2014
- ...triction sites were removed. The gene was obtained by <i>in-vitro</i> gene synthesis. The complementary C-intein was generated by solid-phase peptide synthesis. The functional part of the C-intein was extended c-terminaly by a linker c1 KB (197 words) - 21:52, 14 October 2014
- ...evel is increased thereby up-regulating genes whose products catalyze NADH synthesis. Therefore the augmented pool size of NAD<sup>+</sup>(H) result in promotio <strong><h5>Fig.1 De novo synthesis and salvage pathway of NAD biosynthesis.</h5></strong>13 KB (1,602 words) - 10:50, 20 October 2021
- ...3’ untranslated regions (UTRs) found within the HCV genome to direct RNA synthesis. The UTRs form ordered RNA structures and are evolutionary conserved. </p>5 KB (804 words) - 14:46, 21 October 2019
- ...ansferase operon genes rhl are essential for the regulation of rhamnolipid synthesis which is originally found in Pseudomonas aeruginosa, a kind of bacterium ge ...ription. RhlI encodes acyl-homoserine-lactone synthase, which catalize the synthesis of C4-HSL. C4-HSL is a autoinducer molecule of rhlR and is essential for t4 KB (661 words) - 15:22, 17 October 2014
- ===Cellulose Synthesis===6 KB (936 words) - 19:15, 11 January 2016
- ...xpression of tryptophan hydroxylase, the rate-limiting enzyme in serotonin synthesis, in enterochromaffin cells and decreased level of serotonin in the colon an ...h higher than that of 5-HTP. We speculate that this may be due to the long synthesis pathway of 5-HTP or the fact that the culture environment provided was not4 KB (609 words) - 15:15, 9 October 2022
- ...s the membrane that can subsequently power cellular processes, such as ATP synthesis. ...rd proton flux that can subsequently power cellular processes, such as ATP synthesis, chemiosmotic reactions and rotary flagellar motor.<html><a href="#fn:1" id11 KB (1,697 words) - 09:21, 20 September 2015
- Triclosan inhibits type 2 fatty acid synthesis (FASII), an essential pathway in the Bacterial and Eukaryotic domains by in ...Laura M., Margret Oethinger, and Stuart B. Levy. "Triclosan Targets Lipid Synthesis." Nature 394 (1998): 531-32. Web.6 KB (869 words) - 22:57, 18 September 2015
- Triclosan inhibits type 2 fatty acid synthesis (FASII), an essential pathway in the Bacterial and Eukaryotic domains by in ...Laura M., Margret Oethinger, and Stuart B. Levy. "Triclosan Targets Lipid Synthesis." Nature 394 (1998): 531-32. Web.6 KB (869 words) - 23:04, 18 September 2015
- Triclosan inhibits type 2 fatty acid synthesis (FASII), an essential pathway in the Bacterial and Eukaryotic domains by in ...Laura M., Margret Oethinger, and Stuart B. Levy. "Triclosan Targets Lipid Synthesis." Nature 394 (1998): 531-32. Web.6 KB (869 words) - 23:05, 18 September 2015
- Triclosan inhibits type 2 fatty acid synthesis (FASII), an essential pathway in the Bacterial and Eukaryotic domains by in ...Laura M., Margret Oethinger, and Stuart B. Levy. "Triclosan Targets Lipid Synthesis." Nature 394 (1998): 531-32. Web.6 KB (869 words) - 23:06, 18 September 2015
- ...yme ALDH1. This device is an element of TCD iGEM 2015 set of parts for the synthesis of the anti-malarial drug precursor artemisinic acid in E. coli. The ALDH1 ...velopment of semi-synthetic artemisinin. Genes from the plant encoding one synthesis pathway were introduced into E. coli cells however, an alternative pathway7 KB (1,025 words) - 22:05, 18 September 2015
- ...id backbone. This part is an element of TCD iGEM 2015 set of parts for the synthesis of the anti-malarial drug precursor dihydroartemisinic acid in E. coli. The ...velopment of semi-synthetic artemisinin. Genes from the plant encoding one synthesis pathway were introduced into E. coli cells however, an alternative pathway6 KB (963 words) - 22:05, 18 September 2015
- ...ctivity. Airen showed that if RraA-protein is added to a cell free protein synthesis reaction, the productivity raises about 30% (Airen, 2011). He postulated th <p> Airen showed that if RraA-protein is added to a cell-free protein synthesis reaction, the productivity raises about 30% in his cell-free system (<a hre7 KB (1,153 words) - 05:28, 19 September 2015
- <p>This operon is a composite of the three enzymes involved in styrene synthesis in the following order: [https://parts.igem.org/Part:BBa_K1692002 FDC (BBa_ ...Screen Shot 2015-09-13 at 7.57.36 PM.png|thumbnail|center|700px|<b>Styrene Synthesis Operon</b>]]<br><br>5 KB (731 words) - 19:38, 26 September 2015
- ...of the RNA synthesis using a Malachite Green Aptamer.(A)''' To analyze RNA synthesis in real time we applied a DNA template encoding for the RNA of interest (RO ...ng|800 px|thumb|center|'''Fig.2. Monitoring of the ATP consumption and RNA synthesis of difficult transcription templates. (A)''' Using our fluorescent tool box5 KB (792 words) - 14:25, 21 September 2015
- ...e flhCD operon is a positive regulator of HNS which is responsible for the synthesis of many proteins that composes the structure of the bacterial flagella. Stu7 KB (962 words) - 09:00, 21 September 2015
- ...his cleavage<sup>7</sup>. The SD-aSD interaction is necessary for protein synthesis initiation. ...Y. et al. MazF Cleaves Cellular mRNAs Specifically at ACA to Block Protein Synthesis in Escherichia coli. <i>Molecular Cell</i> <b>12</b>, 913–923 (2003).4 KB (655 words) - 10:28, 27 October 2020
- ===Synthesis Report===1 KB (192 words) - 15:27, 18 October 2016
- ==synthesis report==1 KB (202 words) - 15:28, 18 October 2016
- ...ve the implementation of a system that allows us to control externally the synthesis and turn-down of c-diGMP, we had cloned both genes pleD* and yhjH separatel ...of PleD* increases the intracellular concentration of c-diGMP, whereas the synthesis of YhjH decreases the intracellular concentration of this second messenger.6 KB (949 words) - 22:53, 19 October 2016
- ...ve the implementation of a system that allows us to control externally the synthesis and turn-down of c-diGMP, we had cloned both genes pleD* and yhjH separatel ...of PleD* increases the intracellular concentration of c-diGMP, whereas the synthesis of YhjH decreases the intracellular concentration of this second messenger.6 KB (926 words) - 22:49, 19 October 2016
- ...lture to initialize gene expression, and subsequently cis 1,4 polyisoprene synthesis. In short, the purpose of this construct is to enable isopentenyl pyrophos4 KB (615 words) - 03:14, 26 October 2016
- ...h <i>Hevea</i> latex. Because either HRT1 or HRT2 could be used for rubber synthesis, we incorporated both genes into a plasmid construct under a IPTG inducible6 KB (886 words) - 03:32, 26 October 2016
- <p>PPK1 favors polyphosphate synthesis, using ATP as the preferred phosphate donor [1][2] </p> <p>PPK2’s affinity for hydrolysis or synthesis varies by species, and PPK2 tends to use either ATP or GTP as the phosphate10 KB (1,492 words) - 00:14, 15 October 2016
- ...ed to get a new synthetase binding other amino acids to the tRNA. The gene synthesis we ordered had 30 base pairs overlap to a linearized vector of the ONBY-par1 KB (179 words) - 14:34, 1 November 2017
- ...URA3 gene coding for OMP decarboxylase, an essential protein in the uracil synthesis pathway in S. cerevisiae budding yeast. It is widely used as a nutrition ta ...phosphate decarboxylase</i>—an enzyme that catalyzes one reaction in the synthesis of <i>pyrimidine ribonucleotides</i>. We obtained the <b><i>URA3</i></b> ge7 KB (1,110 words) - 16:03, 27 October 2017
- ...ted the uptake of exogenous phosphorus. That is to say intracellular polyP synthesis can make bacteria be on the "phosphorus starvation" state. Phosphite dehydr4 KB (577 words) - 13:37, 11 October 2022
- For our test protein, we decided to order a gene synthesis of the NM-region of sup35. The NM region is 250 amino acids long and respon ...no cysteines are still able to form prions. So, we decided to order a gene synthesis of sup35 containing no cysteines. <br>9 KB (1,369 words) - 11:33, 30 October 2017
- For our test protein, we decided to order a gene synthesis of the NM-region of sup35. The NM region is 250 amino acids long and respon ...no cysteines are still able to form prions. So, we decided to order a gene synthesis of sup35 containing no cysteines. <br>9 KB (1,360 words) - 11:24, 30 October 2017
- For our test protein, we decided to order a gene synthesis of the NM-region of sup35. The NM region is 250 amino acids long and respon ...no cysteines are still able to form prions. So, we decided to order a gene synthesis of sup35 containing no cysteines. <br>8 KB (1,357 words) - 11:43, 30 October 2017
- For our test protein, we decided to order a gene synthesis of the NM-region of sup35. The NM region is 250 amino acids long and respon ...no cysteines are still able to form prions. So, we decided to order a gene synthesis of sup35 containing no cysteines. <br>8 KB (1,361 words) - 11:34, 30 October 2017
- For our test protein, we decided to order a gene synthesis of the NM-region of sup35. The NM region is 250 amino acids long and respon ...no cysteines are still able to form prions. So, we decided to order a gene synthesis of sup35 containing no cysteines. <br>9 KB (1,365 words) - 11:40, 30 October 2017
- ...king tryptophan. The strains used carried biobricks involved in tryptophan synthesis and/or export under control of an IPTG-inducible T7 promoter. 1.0 mM IPTG w ..._K2455000|AroG]]: Gene involved in Tryptophan, Tyrosine, and Phenylalanine synthesis.1 KB (209 words) - 19:55, 28 October 2017
- ...vert phytoene into lycopene through two steps. It is the key factor in the synthesis of carotene from X. dendrorhous. ...1: From Rabeharindranto et al. 2019. Presumed biosynthetic pathway for the synthesis of β-carotene in X. dendrorhous (Verdoes et al., 1999). The bifunctional l5 KB (777 words) - 16:02, 13 October 2020
- ...oene and lycopene to β-carotene respectively. It is the key factor in the synthesis of carotene, from X. dendrorhous. ...1: From Rabeharindranto et al. 2019. Presumed biosynthetic pathway for the synthesis of β-carotene in X. dendrorhous (Verdoes et al., 1999). The bifunctional l5 KB (780 words) - 19:14, 8 October 2020
- ...β-lactamase. In our project we were using BLS for activating our chemical synthesis by formation of a β-lactam ring in vitro. In order to simplify purificatio <tr> <td>Source</td> <td>IDT (DNA synthesis) </td></tr>2 KB (315 words) - 20:23, 1 November 2017
- ...xidation. Cells treated with YncM Winsulin showed higher rates of glycogen synthesis than those at basal levels, and a slight increase in glucose oxidation was5 KB (766 words) - 01:58, 1 November 2017
- ...irus (HCV). It is a RNA-dependent RNA polymerase and initiates de novo RNA synthesis with the help of its specific RNA promoters. If you need to generate double ...ar the 3’ terminus that could act as a potential initiation site for RNA synthesis. A ladder of polymerized products is expected because along with many well-3 KB (422 words) - 03:31, 23 August 2018
- ...ed SLD3, was found by Kao et al. to be capable of supporting efficient RNA synthesis by NS5B. In our case SLD3 is just after the inhibitory strand, so that reco3 KB (467 words) - 17:24, 26 August 2018
- ...acids on the outside and inside of the protein shell, causing nanoparticle synthesis at both surfaces. An optimization of the wildtype human ferritin towards a ...tin Heavy Chain (HUHF) as gBlock from IDT. Due to the complications of the synthesis of HUHF l, we had to split the protein into three parts with 50 basepairs o18 KB (2,515 words) - 15:52, 30 November 2018
- ...smid vectors cloned in E. coli carry this gene. Penicillin can inhibit the synthesis of cell wall peptidoglycans, bind to related enzymes, inhibit their activit ...PBPs (penicillin binding proteins), which they inhibit thus preventing the synthesis of PG and promoting the release of an autolysin that will digest the PG. Th7 KB (1,055 words) - 18:36, 21 October 2021
- ...umor related genes though interacting with several RNA-splicing or protein synthesis associated proteins.4 KB (540 words) - 12:33, 11 October 2018
- ...ne that codes a glycerol-3-phosphate dehydrogenase which controls glycerol synthesis in Zygosaccharomyces rouxii. It increases glycerol synthesis which work as compatible solute. So, it may raise osmotolerance in yeast.3 KB (388 words) - 22:29, 17 October 2018
- ...phyll synthetase. As the name implies, it is the final step in chlorophyll synthesis, which is achieved after chlorophyll synthetase catalyses the esterificatio [6] Walker, C. J., et al. (1991). "Synthesis of divinyl protochlorophyllide. Enzymological properties of the Mg-protopor16 KB (1,904 words) - 01:56, 18 October 2018
- ...B-lactam antibiotics interact with the PBP 1b by inhibiting the cell wall synthesis. This composite part contains GS linker which allows the conjugation with d Penicillin Binding Protein 1b is major enzyme for peptidoglycan synthesis. Escherichia coli PBP1b is a bifunctional transglycosylase, also known as p1 KB (149 words) - 21:07, 17 October 2018
- ...cols/2015/11/24/sgrna-synthesis-using-the-hiscribe-quick-t7-high-yield-rna-synthesis-kit-neb-e2050</ref> and ordered as gBlock from IDT . Fw primer gaattcgcggcc gBlocks. Template design was based on HiScribe™ Quick T7 High Yield RNA Synthesis Kit <ref name="biolabs" />.3 KB (482 words) - 01:53, 11 October 2018
- ...complementing protein which is a critical part of the Bacterial Cellulose synthesis terminal complex. ...els of BcsB and BcsC which are proteins members of the bacterial cellulose synthesis complex indicating CcpAx also plays a regulatory role in BC biosynthesis.1 KB (152 words) - 16:00, 12 October 2018
- ...part was used as a <b>positive control</b> for our <i>in vitro</i> protein synthesis experiments. ...ations of the trigger and reducing the time of the <i>in vitro</i> protein synthesis reaction.3 KB (415 words) - 12:28, 21 October 2019
- ...ulate the transition between motile and sessile biofilm forming behaviour. Synthesis of cyclic-di-GMP itself is regulated by the stationary-phase sigma factor R ...ation of cyclic-di-GMP, however the yhjH phosphodiesterase is incapable of synthesis. Combined with the Lac promoter and double terminator, this Biopart allows6 KB (904 words) - 03:07, 22 October 2019
- In our study, we aim to achieve squalene synthesis in E.coli, so at the beginning, We cloned YSS, NSS, KSS and thSQS. ...the highest absorbance, so we decided to use YSS to construct the squalene synthesis pathway E. coli.8 KB (1,224 words) - 02:42, 22 October 2019
- ...we present the cloning of thioesterase I (TesA), an enzyme involved in the synthesis of free fatty acids in <i> E. coli</i>.<Br> ...produced to create a composite part with other gene involved in 2-nonanone synthesis. The promoter will therefore be associated with the design of the last gene12 KB (1,850 words) - 23:09, 21 October 2019
- ...entrations of trigger and reducing the time of the <i>in vitro</i> protein synthesis reaction. ...slation reactions were done using the PURExpress® <i>In Vitro</i> Protein Synthesis kit. A reaction without a trigger sequence was included, as a negative cont5 KB (668 words) - 15:04, 21 October 2019
- ...e must be preceded and flanked by terminal adapters; our team had multiple synthesis failures without these adapters. The 5' end adapter is 5'CTCACTTGTAGAACGGTG2 KB (335 words) - 03:33, 20 October 2019
- ...verall, this enzyme is involved in the elongations steps of the fatty acid synthesis, which is used for producing membrane lipids, lipid A, etc <sup>6</sup>. ...p>. This system is induced by anhydrotetracycline (aTc) that activates the synthesis of the dCas9, which then binds to the sgRNA. The formed complex is able to8 KB (1,290 words) - 17:23, 21 October 2019
- ...ranyl diphosphate into 15-cis-phytoene. It is a crucial enzyme in lycopene synthesis pathway and always works together with geranylgeranyl diphosphate synthase ...hen there is no inducer. This suggested that the switch that controled the synthesis of lycopene may not completely shut down the expression of all the three ge5 KB (750 words) - 09:04, 21 October 2019
- ...hich transforms phytoene into lycopene. It is a crucial enzyme in lycopene synthesis pathway and always works together with geranylgeranyl diphosphate synthase ...hen there is no inducer. This suggested that the switch that controled the synthesis of lycopene may not completely shut down the expression of all the three ge5 KB (746 words) - 09:05, 21 October 2019
- ...ptional regulator Fnr (EtrA) and the key gene responsible for rhamnolipids synthesis (rhlA). Team Nanjing_NFLS 2020 use this part to increase the rhamnose synthesis and upregulate PYO level in Pseudomonas aeruginosa, which contributes to im6 KB (879 words) - 15:25, 21 October 2021
- ...om the part BBa_K2155003, containing mutation F178Y. It catalyzes xylulose synthesis from glycolaldehyde and dihydroxyacetone (DHA). Along with the BFD-M7, TalB Figure 1. The synthesis of Xylulose from Glycolaldehyde and Dihydroxyacetone(DHA), catalyzed by Tal2 KB (275 words) - 00:27, 21 October 2019
- Fig.1. The mechanism of A/U-rich 5'-UTR to promote protein synthesis.<BR> ...to the RBS, promoting the translation process and accelerating the protein synthesis.<BR>4 KB (671 words) - 23:56, 21 October 2019
- <center> Fig.1 Synthesis of our RNAi molecules </center></html></center> ...to the first place, so as to improve the expression of RebB, and make the synthesis and assembly of R-body in E. coli more efficient.13 KB (2,016 words) - 14:46, 11 October 2022
- they are the essential genetic elements for the PURExpress protein synthesis kit. ...of tests. The plasmid would be transcribed and translated with the protein synthesis kit at 37℃ for 2 hours. We would then add 5μl of 0.5M sucrose and measur4 KB (672 words) - 15:44, 26 October 2020
- ...ements for the in vitro gene expression with PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs). ...ids were transcribed and translated with the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs) at 37℃ for 2 hours. We would then add 5μl of 06 KB (893 words) - 01:33, 28 October 2020
- ...31721), they are the essential genetic elements for the PURExpress protein synthesis kit. ...of tests. The plasmid would be transcribed and translated with the protein synthesis kit at 37℃ for 2 hours. We would then add 5μl of 0.5M sucrose and measur5 KB (815 words) - 06:32, 27 October 2020
- ===Synthesis===2 KB (341 words) - 03:06, 28 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (838 words) - 15:54, 27 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (843 words) - 15:34, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (842 words) - 15:36, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n6 KB (860 words) - 15:39, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (843 words) - 15:44, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (840 words) - 15:47, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (839 words) - 15:49, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (843 words) - 15:50, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (842 words) - 15:57, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (843 words) - 15:59, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n6 KB (859 words) - 16:00, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (843 words) - 16:01, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n5 KB (843 words) - 16:02, 26 October 2020
- Pacardo, et al. “Biomimetic Synthesis of Pd Nanocatalysts for the Stille Coupling Reaction.” ACS Nano, U.S. Nat Chiu, et al. Size-Controlled Synthesis of Pd Nanocrystals Using a Specific Multifunctional Peptide. 2010, pubmed.n6 KB (878 words) - 16:04, 26 October 2020
- Continuous expression of butyrate synthesis pathway enzymes through a constitutive promoter, so the strain can degrade BBa_K3585003 is a composite part consisting of butyrate synthesis pathway enzymes under constitutive promoter (basic parts BBa_J23100). The b2 KB (335 words) - 13:58, 27 October 2020
- In E. coli, the presence of glucose inhibits the synthesis of many catabolic enzymes, a phenomenon called "glucose effect" or "glucose ...strain contained pMTL83151-J23100-butyrate plasmids and expressed butyrate synthesis gene cluster; placY represents that the host strain contained p15A-J23200-l3 KB (464 words) - 19:19, 27 October 2020
- In E. coli, the presence of glucose inhibits the synthesis of many catabolic enzymes, a phenomenon called "glucose effect" or "glucose Continuous expression of butyrate synthesis pathway enzymes through a constitutive promoter, so the strain can degrade1 KB (155 words) - 14:03, 27 October 2020
- ...herapeutic delivery system. Since trichosanthin acts by inhibiting protein synthesis, its cytotoxic effects will be most deleterious to fast-growing cancer cell ....png|500px|center|thumb|Figure 1. Trichosanthin is an inhibitor of protein synthesis that acts on mammalian ribosomes. Upon release into the cell, it exhibits R3 KB (482 words) - 18:44, 19 March 2021
- ...herapeutic delivery system. Since trichosanthin acts by inhibiting protein synthesis, its cytotoxic effects will be most deleterious to fast-growing cancer cell ....png|500px|center|thumb|Figure 1. Trichosanthin is an inhibitor of protein synthesis that acts on mammalian ribosomes. Upon release into the cell, it exhibits R7 KB (965 words) - 20:58, 18 October 2020
- ...directly above the active site, thereby allowing the coupling of cellulose synthesis and translocation. In addition, BcsA forms a PilZ domain within its C-termi ...ive core of bacterial cellulose synthase sufficient for in vitro cellulose synthesis. Proceedings Of The National Academy Of Sciences, 110(44), 17856-17861. doi8 KB (1,146 words) - 14:26, 25 October 2020
- ...shown that a small addition of active Cmcax increases bacterial cellulose synthesis. It may also exhert regulatory functions. ...ne-associated proteins that can catalyse extracellular Bacterial Cellulose synthesis in vivo. Once the bcsABCD operon expression is triggered, BcsA and BcsB pro5 KB (704 words) - 03:07, 28 October 2020
- ...part codes for the BscC protein, a protein necessary for in vivo cellulose synthesis in Bacteria. It is codon optimised for <i>Flavobacterium johnsoniae</i> UW1 ...embrane-associated proteins can catalyse extracellular Bacterial Cellulose synthesis in vivo. Once the bcsABCD operon expression is triggered, BcsA and BcsB pro5 KB (721 words) - 03:05, 28 October 2020
- ...are not treated with glucose. This indicates that glucose may promote the synthesis of linalool in E.coli DH5α. We do not need to knock out the gene in E.coli ...at is not. Our next step may be finding the optimal condition for linalool synthesis in E.coli. However, due to the Covid-19 situation, we do not have enough ti4 KB (696 words) - 03:34, 28 October 2020
- ...are not treated with glucose. This indicates that glucose may promote the synthesis of linalool in E.coli DH5α. We do not need to knock out the gene in ...at is not. Our next step may be finding the optimal condition for linalool synthesis in E.coli. However, due to the Covid-19 situation, we do not have enough5 KB (802 words) - 03:22, 28 October 2020
- ...e at its front end, thus realizing the directional regulation of a protein synthesis sequence by miRNA. <br>2 KB (324 words) - 17:41, 21 October 2021
- ...aringenin synthesis enzymes in our probiotic strains. To mimic the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete.1 KB (185 words) - 09:22, 19 September 2021
- ...aringenin synthesis enzymes in our probiotic strains. To mimic the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete.1 KB (185 words) - 12:01, 22 September 2021
- ...aringenin synthesis enzymes in our probiotic strains. To mimic the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete.1 KB (185 words) - 12:11, 22 September 2021
- ...aringenin synthesis enzymes in our probiotic strains. To mimic the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete.1 KB (185 words) - 12:26, 22 September 2021
- ...aringenin synthesis enzymes in our probiotic strains. To mimic the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete.1 KB (185 words) - 12:31, 22 September 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (617 words) - 20:27, 21 October 2021
- ...chemoselective, the enantioselective and the regioselective hydrolysis and synthesis of a broad range of non-natural esters, and are widely used in industry.2 KB (231 words) - 13:00, 25 September 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven4 KB (584 words) - 20:24, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (652 words) - 21:24, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 21:23, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (620 words) - 21:21, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (620 words) - 21:18, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 21:17, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 21:15, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 21:13, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 21:11, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 21:00, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 20:57, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 20:54, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 20:52, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 20:40, 21 October 2021
- ...s in our probiotic strains. To reach the maximum efficiency of the natural synthesis pathway, we decided to manipulate the expression rates of these proteins by ...required expression rates were selected for the construction of naringenin synthesis cassete. The same evaluation strategy was applied to measure the effectiven5 KB (621 words) - 20:34, 21 October 2021
- ...hich is not well understood. H77 and C84 are essential amino acids for the synthesis of active AIP. It has been suggested that AgrB is a cysteine protease invol ...portant role in the synthesis of AIPs. AgrB plays an important role in the synthesis of AIPs. At least four types of self-inducible peptides have been identifie2 KB (349 words) - 02:13, 22 October 2021
- ...cene synthase is a key enzyme in the rate limiting reaction of naringenone synthesis, we expect that increased expression of valencene synthase will more likely ...ene in the early stage. PALD4 is strictly limited in controlling valencene synthesis and is not expressed during glucose utilization by cells and is only effect6 KB (853 words) - 20:21, 21 October 2021
- ...cene synthase is a key enzyme in the rate limiting reaction of naringenone synthesis, we expect that increased expression of valencene synthase will more likely ...ene in the early stage. PALD4 is strictly limited in controlling valencene synthesis and is not expressed during glucose utilization by cells and is only effect6 KB (915 words) - 22:03, 21 October 2021
- ...cene synthase is a key enzyme in the rate limiting reaction of naringenone synthesis, we expect that increased expression of valencene synthase will more likely ...ene in the early stage. PALD4 is strictly limited in controlling valencene synthesis and is not expressed during glucose utilization by cells and is only effect6 KB (920 words) - 20:42, 21 October 2021
- ...cene synthase is a key enzyme in the rate limiting reaction of naringenone synthesis, we expect that increased expression of valencene synthase will more likely ...ene in the early stage. PALD4 is strictly limited in controlling valencene synthesis and is not expressed during glucose utilization by cells and is only effect6 KB (853 words) - 20:45, 21 October 2021
- ...es the regulation of lysine biosynthesis by AK, therefore enhancing lysine synthesis yields.(Korosh et al., 2017)2 KB (270 words) - 15:20, 16 October 2021
- ...s of the early genes of bacteriophage T7 in shutoff of host macromolecular synthesis. McAllister WT, Barrett CL. J Virol, 1977 Sep;23(3):543-53. PMID:330878< ====Gp5.7 coding sequence synthesis====10 KB (1,587 words) - 03:27, 22 October 2021
- ...ut, V.; Gottesman, S., RcsB and RcsC: a two-component regulator of capsule synthesis in Escherichia coli. J Bacteriol 1990, 172 (2), 659-69. ...el of the RcsC --> YojN --> RcsB signalling pathway implicated in capsular synthesis and swarming behaviour. Mol Microbiol 2001, 40 (2), 440-50.1 KB (159 words) - 03:03, 21 October 2021
- ...(<a href="https://parts.igem.org/Part:BBa_K3776002"> BBa_K3776002</a>) for synthesis of 5AVA, has been cloned as the donor DNA in the INTEGRATE system.2 KB (290 words) - 12:47, 18 October 2021
- ...to construct a fusion gene, in order to detect the amount of relE protein synthesis. We removed the terminator of relE and fused it to the mScarlet-I gene. ...the mScarlet-I correctly displayed the increasing tendency of relE protein synthesis under the effect of Amp30E Amplification Device.2 KB (253 words) - 08:35, 26 September 2022
- ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o ...precursors, only in photosynthetic organisms and some microorganisms. The synthesis of carotenoids is encoded by plasmids or chromosome genes. The genes that e2 KB (302 words) - 09:42, 21 October 2021
- ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two GGPP molecu ...lants, is the protection from photooxidation. In the pathway of carotenoid synthesis, only crtI can convert octahydrolycopene to lycopene, and catalyze the desa2 KB (342 words) - 09:43, 21 October 2021
- ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o ...precursors, only in photosynthetic organisms and some microorganisms. The synthesis of carotenoids is encoded by plasmids or chromosome genes. The genes that e5 KB (666 words) - 10:30, 21 October 2021
- ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two GGPP molecu ...lants, is the protection from photooxidation. In the pathway of carotenoid synthesis, only crtI can convert octahydrolycopene to lycopene, and catalyze the desa5 KB (712 words) - 10:32, 21 October 2021
- ...(such as in Parkinson's disease), and the rate-limiting step of serotonin synthesis in people treated with 5-HTP (such as in mild depression or dysthymia). AAD6 KB (727 words) - 10:52, 21 October 2021
- ...(such as in Parkinson's disease), and the rate-limiting step of serotonin synthesis in people treated with 5-HTP (such as in mild depression or dysthymia). AAD9 KB (1,193 words) - 10:45, 21 October 2021
- ==== Origin: Saccharomycopsis fibuligera, synthesis ====14 KB (2,041 words) - 10:41, 9 October 2023
- ==== Origin: Synthesis from a genetic company ====4 KB (624 words) - 10:54, 20 October 2021
- ==== Origin: Synthesis from a genetic company ====9 KB (1,233 words) - 06:47, 19 October 2021
- === Origin: Saccharomyces cerevisiae, synthesis === ====Origin: synthesis====15 KB (2,294 words) - 10:27, 13 October 2022
- ==== Origin: Ideonella sakaiensis 201-F6, synthesis ====4 KB (533 words) - 13:47, 20 October 2021
- ==== Origin: Ideonella sakaiensis 201-F6, synthesis ====6 KB (818 words) - 13:49, 20 October 2021
- ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...lved in various botanic metabolism pathways, such as synthesis of lignans, synthesis and degradation of pigments and elongation of roots.8 KB (1,203 words) - 12:25, 21 October 2021
- ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...lved in various botanic metabolism pathways, such as synthesis of lignans, synthesis and degradation of pigments and elongation of roots.7 KB (1,201 words) - 12:24, 21 October 2021
- ...s of the early genes of bacteriophage T7 in shutoff of host macromolecular synthesis. McAllister WT, Barrett CL. J Virol, 1977 Sep;23(3):543-53. PMID:330878< ====Gp5.7 coding sequence synthesis====11 KB (1,734 words) - 03:53, 22 October 2021
- ==== Origin: Synthesis from a genetic company ====9 KB (1,271 words) - 13:26, 20 October 2021
- ...onent regulatory system by stimulating capsule synthesis from colanic acid synthesis cps genes (36). The environmental signals which activate RcsC have yet to b1 KB (166 words) - 15:44, 21 October 2021
- ...onent regulatory system by stimulating capsule synthesis from colanic acid synthesis cps genes (36). The environmental signals which activate RcsC have yet to b1 KB (166 words) - 15:47, 21 October 2021
- ...tase (SerRS) to acylate tRNA<sup>Sec</sup> with serine (Ser) in native Sec synthesis pathway. Then, L-seryl-tRNA<sup>Sec</sup> selenium transferase (SelA) will <p style="text-align:center;">Fig. 1. <i>In vitro</i> Sec synthesis pathway</p>3 KB (450 words) - 13:11, 12 October 2022
- '''Summary''': Charactering the effect of the SNF1 gene for lipid synthesis and growth in Y.lipolytica. ...order to characterize the effect of the IDH2 (BBa_K4297072) gene in lipid synthesis and growth, we constructed a knockout strain po1f ΔylSNF1 using homologous3 KB (522 words) - 01:39, 14 October 2022
- ...us, we block the synthesis of RNApol III though this shRNA, disrupting the synthesis of important functional non-coding RNAs of Rhizoctonia solani, etc., and da9 KB (1,429 words) - 15:24, 11 October 2022
- ...hy object of study. We believe that its feedback inhibition may affect the synthesis of 2-phenylethyl alcohol. We use this Mutant Feedback-Resistant Version of Our team successfully constructed a pathway for the synthesis of 2-phenylethanol in Escherichia coli. When cultured for 60 hours, the max2 KB (325 words) - 15:31, 11 October 2022
- [[File:SYNTHESIS.jpeg|400px|thumb|left|alt text]] From this caffeine synthesis pathway, it’s clear that the gene of TcAncCS1 is derived from Cocobroma.4 KB (542 words) - 04:17, 12 October 2022
- ...nstrated that this part could detect progesterone in the cell-free protein synthesis system in <i>E.coli</i>. We performed <b>cell-free protein synthesis reaction</b> using the extracts and <b>this reporter plasmid</b>.3 KB (491 words) - 15:53, 12 October 2022
- Tyrosinase(TYR) is a key enzyme in melanin synthesis that catalyzes the rate-limiting step of the reaction. By activating tyrosi ...iménez, 1987). The formation of DQ is a rate-limiting step in the melanin synthesis because remainder of the reaction sequence can proceed spontaneously at a p3 KB (454 words) - 03:49, 14 October 2022