Part:BBa_K2924007

guideRNA from enoyl-[acyl-carrier-protein] reductase

fabI guide RNA of Synechocystis sp.

Usage and Biology

This part contains the enoyl-[acyl-carrier-protein] reductase guide RNA of Synechocystis sp. PCC 6803. It was used for an induced knock-down of fabI with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)¹. The Enoyl-[acyl-carrier-protein] reductase can be found under the UniProt ID: FABI_SYNY3², and is involved in fatty acid biosynthesis and metabolism³. The gene is positioned in the genome at 503883- 504719 (837 bp) bases³. The guide RNA was obtained by using the CRISPR guide from benchling⁴. The sgRNA in the gene is located at 55-74 bp in the + strand (Fig. 1). The sequence of the sgRNA is aattctatgttagatctcag , has anOn-Target Score of 73.1 and an Off-Target Score of 49.9.

Fig. 1: Position of sgRNA (orange) in the Enoyl-[acyl-carrier-protein] reductase gene.

Fig. 2: Reaction scheme of the formation of acyl-[acyl-carrier-protein] by reductase

Enoyl-[acyl-carrier-protein] reductase is a key enzyme of the fatty acid synthesis system. It catalyzes the NAD-dependent reduction of a carbon-carbon double bond in trans-2,3-dehydroacyl-[acyl-carrier-protein] to acyl-[acyl-carrier-protein] ^{5, 6}(Fig. 2). In overall, this enzyme is involved in the elongations steps of the fatty acid synthesis, which is used for producing membrane lipids, lipid A, etc ⁶.

The short guide RNA (sgRNA) has been cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That is a homologous sequence of its genome to ensure a knock-in into the genome (Fig. 3)¹.

Due to the created knock-in containing a resistance for antibiotic in close proximity to the sgRNA, the target enzyme can down-regulated with a CRISPRi/dCas9 - system ¹. This system is induced by anhydrotetracycline (aTc) that activates the synthesis of the dCas9, which then binds to the sgRNA. The formed complex is able to bind complementary to the targeted gene and stops the transcription of it (Fig. 4).

Fig. 3: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 4: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BglII site found at 12
  
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Characterization

Fig. 5: Fluorescence measurement of the mVenus knock-down (KD) strain in the plate reader 24 h after induction with 500 nM aTc (red) or 100% EtOH (negative control, blue). 2 biological and 3 technical replicates were cultured in 6-well plates

For testing the created system the cultures were induced with aTc and the growth rates were documented for few days. To check the transcriptional activity on the targeted gene, a qPCR was performed from pelletized cultures. Finally, the varying percentage yields of fatty acids were measured via gas chromatography-mass spectrometry.

Proof of concept

This concept has been tested with the fluorescent protein mVenus. The sgRNA was designed using the “CRISPR Guides” tool on benchling⁴ by choosing suitable candidate sgRNAs, which binds at the start of mVenus and cloned it via homologous recombination into the genome of Synechocystis sp. PCC 6803. Furthermore, this Synechocystis sp. PCC 6803 was transformed with a plasmid containing the P_cpc560 BBa_K2924000 and the mVenus CDS BBa_K2924035.

Synechocystis sp. WT and Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_P_cpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO₂ conditions using 6 well plates. After 2 days of incubation, some cultures were induced with 500 nM aTc or with 100% EtOH as a control with the same amounts added. After 24 hours, the fluorescences were measured using a plate reader. Each sample was measured in biological duplicates, which are then tested in technically triplicates (Fig. 5).

As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely.

Reductase knock-down experiments

Fig. 6: Growth curve of Synechocystis sp. PCC 6803 transformants after induction with 0.1 µg/ml aTc

After inoculation and incubation of Synechocystis sp. PCC 6803 with sgRNA_reductase in BG11, they were diluted to an OD₇₅₀ = 0.2, a few days later induced with an appropriate amount of 0.1 µg/ml aTc and added an appropriate amount of 20 µg/ml spectinomycin and 25 µg/ml kanamycin. The cultures were incubated at 30 °C and shaken with specific light and CO₂.

The growth rate of Synechocystis sp. PCC 6803 transformants was not affected by the knockdown of enoyl-[acyl-carrier-protein] reductase (Fig. 6).

Fig. 7: The relative expression of different clones containing the same sgRNA for enoyl-[acyl-carrier-protein] reductase. The control resembles a strain expressing the enoyl-[acyl-carrier-protein] reductase without induction of the sgRNA. The clones resemble strains expressing the lenoyl-[acyl-carrier-protein] reductase with induction of the sgRNA targeting the gene.

The transcription of genes can be detected by a qPCR. Therefore, it can be used to validate the level of the transcription of a gene of interest due to specific primer. In this case, the knockdown target enoyl-[acyl-carrier-protein] reductase and the housekeeping gene for technical faults (rnpB) were analysed. The cultures were induced with aTc [500nM] and after 24 h 1.5 ml of the cultures were pelletized to perform a qPCR (Fig. 7).

It seems, that the expression levels did not change compared to the control (Fig.7). Therefore, further experiments, like Gas chromatography mass-spectrometry (GC-MS), with this strain and this type of sgRNA is not necessary.

References

[1]: Yao, L., Cengic, I., Anfelt, J., & Hudson, E. P. (2015). Multiple gene repression in cyanobacteria using CRISPRi. ACS synthetic biology, 5(3), 207-212.

[2]: https://www.uniprot.org/uniprot/P73016

[3]: https://www.genome.jp/dbget-bin/www_bget?syn:slr1051

[4]: Benchling [Biology Software]. (2019). Retrieved from https://benchling.com.

[5]: LIU, Xinyao; SHENG, Jie; CURTISS III, Roy. Fatty acid production in genetically modified cyanobacteria. Proceedings of the National Academy of Sciences, 2011, 108. Jg., Nr. 17, S. 6899-6904.

[6]: Bergler, H., Fuchsbichler, S., Högenauer, G., & Turnowsky, F. (1996). The enoyl‐[acyl‐carrier‐protein] reductase (FabI) of Escherichia coli, which catalyzes a key regulatory step in fatty acid biosynthesis, accepts NADH and NADPH as cofactors and is inhibited by palmitoyl‐CoA. European Journal of Biochemistry, 242(3), 689-694.