Collections/Cellulose

This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.

Bacterial cellulose has proven to be a useful and flexible biomaterial for a variety of applications. Several iGEM teams have worked with cellulose as a biomaterial, both in production and degradation.


Previous iGEM Team Projects

The following table contains iGEM teams that have worked with cellulose to some degree, along with links to their project wiki and Registry parts. This is not an exhaustive list.

Team Year Parts Project Title
Aalto-Helsinki 2015 Parts Fuel for the Future: E. coli producing renewable propane from cellulose
Berlin 2015 Parts Enzymatic Flagellulose
HAFS-Korea 2015 Parts Engineering an E.coli that transforms cellulose to alcohol by using gene from trichoderma reesei
UCSC 2015 Parts Engineering the Future of Biofuel
Imperial 2014 Parts Manufacture of Bacterial Cellulose Biomaterials: Towards Tailor-Made Biofilters
Hannover 2014 Parts Plant against – Removing heavy metals from nature
StanfordBrownSpelman 2014 Parts Towards a Biosynthetic Unmanned Aerial Vehicle
Biwako Nagahama 2013 Parts AgRePaper&E.coli-ink
Penn State 2013 Parts Plants as Plants: Natural Factories Producing Fuel, Plastic, Flavoring, and More
WHU-China 2012 Parts E. coslim: Synthetic Probiotics Help Defy Obesity
HUST-China 2012 Parts Synthetic Biofactory: Lignocellulose Decomposer and Microbial Fuel Cell
Missouri_Miners 2012 Parts Adjustable Multi-Enzyme to Cell Surface Anchoring Protein
Bielefeld-Germany 2012 Parts TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE
Tec-Monterrey 2011 Parts E. Coli's Sweet Deal
Tokyo_Metropolitan 2010 Parts Life Design: Fine Clothing, Color Housing and Delicious Food by using E. coli


Highlighted Projects

2014 Imperial Team

The [http://2014.igem.org/Team:Imperial iGEM 2014 Imperial Team] created a bacterial cellulose filter for their Aqualose project.

"The porosity of bacterial cellulose and our synthetic attachment of contaminant-specific binding and catabolic proteins make for a flexible, modular water filter. Our manufactured biomaterial would augment water recycling and reclamation on local and industrial scales, helping to alleviate water stress." - [http://2014.igem.org/Team:Imperial iGEM 2014 Imperial Team]

Through their project, they created a set of well-documented cellulose binding domains, paired with reporter genes (GFP) and metal binding domains.


2014 StanfordBrownSpelman Team

The [http://2014.igem.org/Team:StanfordBrownSpelman iGEM 2014 StanfordBrownSpelman Team] used cellulose as a biomaterial in their UAV.


Cellulose Synthesis


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K861100BcsA,cellulose synthetase, catalytic subunitCodingXian Xia26191 . . . ccatcggatcaggctttggctcaacaatga
BBa_K861110BcsB,regulator of cellulose synthetaseCodingXian Xia23401 . . . cgtcgtcgtcttaacccggataacgagtaa
BBa_K336020bacterial cellulose synthase BCodingNaoto Shimada 2415  . . . cagttgcaggaagaaaggcagaaatcgtga
BBa_K336021bacterial cellulose synthase DCodingNaoto Shimada 471  . . . tacatgcgtacccgcagcaacagcaactga
BBa_K861120BcsZ, endo-1,4-D-glucanaseCodingXian Xia11071 . . . tggggccaggaatgcgcaaattcacactaa
BBa_K1043005Cellulose Synthase OtherCasey Hall3078  . . . gacacttccaagtgtggcatcaactgctga
BBa_K1043006Cellulose Synthase 8OtherCasey Hall2955  . . . ctttctctgaactgtcttttgatcgattgc
BBa_K336051bacterial cellulose synthase ACodingNaoto Shimada 2238  . . . gaaggaaagatcagtcgtgcggcctcgtga
BBa_K336052bacterial cellulose synthase CCodingNaoto Shimada 3978  . . . tccgtacactatcttattatggaccagtaa
BBa_K861130BcsC,cellulose synthetase subunitCodingXian Xia34741 . . . cagccgctgataccttacgccgactggtaa
BBa_K1044003Cellulose synthase gene CelA from Agrobacterium tumefaciens C58.CodingKoki Tsutsumi2190  . . . agcgccaagcctgtcggagccgtgaaatga
BBa_K1044004CelB protein gene CelB from Agrobacterium tumefaciens C58.CodingKoki Tsutsumi2484  . . . atgctgcgcatgatggggcggcatcgatga
BBa_K1044005Cellulose synthased operon (CelA,B,C) from Agrobacterium tumefaciens C58.CompositeKoki Tsutsumi,Eshin Mitsui5722  . . . ctggcaaggaataacggggaatgccgatga


Cellulose Binding


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K863101Cellulose binding Domain of Cellulomonas Fimi Exoglucanse (Freiburg-Standard)Protein_DomainMoritz Müller345  . . . ccctgcacggtcggcggcagcaccggttaa
BBa_K863111Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard)Protein_DomainMoritz Müller318  . . . gaatttggatttgcaggcagcaccggttaa
BBa_K1478001Cellulose binding domainProtein_DomainFabian Frömling3093 . . . tacgttgaatttggatttgcgtcaggccgt
BBa_K1321090Phytochelatin (PC) EC20 + Linker-dCBDCodingXenia Spencer-Milnes495  . . . gtcctgaacccgtactactcccagtgtctt
BBa_K1321092Phytochelatin (PC) EC20 fused to CBDcexCodingXenia Spencer-Milnes456  . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321094CBDclos fused to Phytochelatin (PC) EC20CodingXenia Spencer-Milnes429  . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1321339CBDcenA+Linker, RFC 25 standardCodingChris N Micklem40813 . . . accccaacgcctactccgacggtcaccccc
BBa_K1321340Double CBD (dCBD) with N-terminal linkerCodingChris N Micklem36628 . . . gtcctgaacccgtactactcccagtgtctt
BBa_K1321341sfGFP fused to CBDclos in RFC 25CodingChris N Micklem10172 . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321342sfGFP fused to CBDcex in RFC 25CodingChris N Micklem10443 . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321343NiBP fused to CBDclos in RFC 25CodingChris N Micklem4821 . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321344NiBP fused to CBDcex in RFC 25CodingChris N Micklem5091 . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321345NiBP fused to dCBD with linker in RFC 25CodingChris N Micklem5481 . . . gtcctgaacccgtactactcccagtgtctt
BBa_K1321346CBDclos fused to sfGFP in RFC 25CodingChris N Micklem10171 . . . atcacgcatggtatggatgaactgtacaaa
BBa_K1321348sfGFP fused to dCBD with linker in RFC 25CodingChris N Micklem10833 . . . gtcctgaacccgtactactcccagtgtctt
BBa_K1321349CBDcex fused to sfGFP in RFC 25CodingChris N Micklem10441 . . . atcacgcatggtatggatgaactgtacaaa
BBa_K1321351CBDcenA with linker fused to NiBP in Freiburg format (RFC 25)CodingChris N Micklem5901 . . . gaagaaggttgctgccacgggcatcacgag
BBa_K1321352NiBP fused to CBDcex driven by T7CodingChris N Micklem567  . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321353NiBP fused to CBDclos driven by T7CodingChris N Micklem540  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321356sfGFP fused to CBDclos driven by LacICompositeChris N Micklem12521 . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321357sfGFP fused to CBDcex driven by LacICompositeChris N Micklem12791 . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1499004Cellulose binding domains with streptavidin domain generatorGeneratorRaman Nelakanti1052  . . . ccataaccaccgccacaaacatgtttaaac
BBa_K1321100Phytochelatin (PC) EC20 fused to linker-dCBD with T7 promoterCodingXenia Spencer-Milnes553  . . . gtcctgaacccgtactactcccagtgtctt
BBa_K1321101Phytochelatin (PC) EC20 fused to CBDclos with T7 promoterCodingXenia Spencer-Milnes487  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321104CBDclos fused to Phytochelatin (PC) EC20 with T7 promoterCodingXenia Spencer-Milnes487  . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1321105CBDcex fused to Phytochelatin (PC) EC20 with T7 promoterCodingXenia Spencer-Milnes514  . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1321110Phytochelatin (PC) EC20 fused to linker-dCBD with LacI CodingXenia Spencer-Milnes730  . . . gtcctgaacccgtactactcccagtgtctt
BBa_K1321111Phytochelatin (PC) EC20 fused with CBDclos with LacI promoterCodingXenia Spencer-Milnes664  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321112Phytochelatin (PC) EC20 fused to CBDcex with LacI promoterCodingXenia Spencer-Milnes691  . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321114CBDclos fused to phytochelatin (PC) EC20 with LacI promoterCodingXenia Spencer-Milnes664  . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1321115CBDcex fused to phytochelatin (PC) EC20 with LacI promoterCodingXenia Spencer-Milnes691  . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1321120SmtA metallothionein fused to linker-dCBDCodingGabriella Santosa537  . . . gtcctgaacccgtactactcccagtgtctt
BBa_K1321366CBDcex fused to sfGFP with T7 promoterCompositeGabriella Santosa1102  . . . atcacgcatggtatggatgaactgtacaaa
BBa_K1321121Smt metallothionein fused to CBDclosGeneratorGabriella Santosa471  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321122Smt fused to CBDcexCodingGabriella Santosa498  . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321151metallothionein Fmt fused to CBDclosCodingGabriella Santosa504  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321152metallothionein Fmt fused to CBDcexCodingGabriella Santosa531  . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321154CBDclos fused to metallothionein FmtCodingGabriella Santosa504  . . . gttaaagatgattgttgtggttgtggcaaa
BBa_K1321091Phytochelatin (PC) EC20 fused to CBDclosCodingXenia Spencer-Milnes447  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321095CBDcex fused to Phytochelatin (PC) EC20CodingXenia Spencer-Milnes472  . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1321097CBDcenA-linker fused to Phytochelatin (PC) EC20CodingXenia Spencer-Milnes511  . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1933103constitutive expression of CBDclos fused to BclA with 6xHis tagCompositeTomoki Uchino 444  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1933102constitutive expression of CBDcex fused to BclA with 6xHis tagCompositeTomoki Uchino 471  . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1933101constitutive expression of CBDclos fused to INPNC with 6xHis tagCompositeTomoki Uchino 1335  . . . acatatgttgaatttggatttgcaggcagc
BBa_K1933100constitutive expression of CBDcex fused to INPNC with 6xHis tagCompositeTomoki Uchino 1362  . . . aacggcacgccctgcacggtcggcggcagc
BBa_K2825000PETase-Linker-CBDcipA-Linker-HlyA tagDeviceJohn Starkel, Jacob Premo, Daniel Zheng6943  . . . caccttcgggtgggcctttctgcgtttata
BBa_K3819004CBM/CBDCodingAllysonC477-1 . . . ggggttttagtttggggtaaggaacccgga
BBa_K3765004dCBD (Double Cellulose Binding Domain)CodingDipayan Akhuli366-1 . . . gtgttaaatccctactactctcagtgtctg
BBa_K3765012PelB_Signal+10xHis+SpyCatcher002+dCBDCompositeDipayan Akhuli861-1 . . . ttaaatccctactactctcagtgtctgtaa
BBa_K3765016T7 RBS + SpyCatcher002+dCBDTranslational_UnitDipayan Akhuli894-1 . . . ttaaatccctactactctcagtgtctgtaa
BBa_K3765020SpyCatcher002+dCBD under T7 promoterGeneratorDipayan Akhuli1110-1 . . . gcctctaaacgggtcttgaggggttttttg
BBa_K4380000Cellulose Binding domain (CBD)CodingBrigita Duchovska492-1 . . . ggcgttctggtttggggtaaggagccgggt
BBa_K4795007transcribe endoglucanase, extranect glucanase, β-glucosidaseCompositeZilu Liu3006-1 . . . agcaattggtccgcccaacaaaacaactag
BBa_K863102Cellulose binding Domain of C. Fimi Exoglucanase with T7, RBS, GS-Linker (Freiburg-Standard)CompositeMoritz Müller373  . . . ccctgcacggtcggcggcagcaccggttaa
BBa_K863103Cellulose binding Domain from Cellulomonas Fimi with Reporter GFPReporterMoritz Müller1111  . . . aaacatcaccatcaccatcacaccggttaa
BBa_K863110Cellulose binding Domain from Clostridium cellulovorans cellulose binding proteinProtein_DomainMoritz Müller312  . . . tatgttgaatttggatttgcaaccggttaa
BBa_K863112Cellulose binding domain of C. cellulovorans with T7, RBS, GS-Linker (Freiburg-Standard)CompositeMoritz Müller337  . . . gaatttggatttgcaggcagcaccggttaa
BBa_K863113Cellulose binding Domain of C. cellulovorans cellulose binding protein with Reporter GFPReporterMoritz Müller1075  . . . aaacatcaccatcaccatcacaccggttaa
BBa_K863104Cellulose binding Domain from C. Fimi with const. Promotor and GFPReporterMoritz Müller1144  . . . aaacatcaccatcaccatcacaccggttaa
BBa_K863114CBD of C. cellulovorans cellulose binding protein gene with const. Promoter (J23100+J61101) and GFPReporterMoritz Müller1117  . . . aaacatcaccatcaccatcacaccggttaa
BBa_K1321093Phytochelatin (PC) EC20 + Linker-CBDcipA-LinkerCodingGabriella Santosa8402 . . . gctaccacgattcctccatcagacgatccg
BBa_K1321003Re-entry of BBa_K863101, Cellulose Binding Domain CBDcex in rfc25CodingXenia Spencer-Milnes32725 . . . aacggcacgccctgcacggtcggcggcagc
BBa_K1321002Re-entry of BBa_K863111, Cellulose Binding Domain CBDclos in rfc25CodingXenia Spencer-Milnes30027 . . . acatatgttgaatttggatttgcaggcagc
BBa_K1321014CBDCipA with N and C-terminal linkerCodingXenia Spencer-Milnes7117 . . . gctaccacgattcctccatcagacgatccg
BBa_K1321096Linker-CBDcipA-Linker + Phytochelatin (PC) EC20CodingXenia Spencer-Milnes8402 . . . tgcgagtgcgaatgcgaatgcgagtgcggc
BBa_K1979001CBD (cbh2)CodingMA Xinyi1475 . . . ccgggtgctgcttcttcttcttctggttct


Other Resources