Collections/Cellulose
Bacterial cellulose has proven to be a useful and flexible biomaterial for a variety of applications. Several iGEM teams have worked with cellulose as a biomaterial, both in production and degradation.
Previous iGEM Team Projects
The following table contains iGEM teams that have worked with cellulose to some degree, along with links to their project wiki and Registry parts. This is not an exhaustive list.
Team | Year | Parts | Project Title |
---|---|---|---|
Aalto-Helsinki | 2015 | Parts | Fuel for the Future: E. coli producing renewable propane from cellulose |
Berlin | 2015 | Parts | Enzymatic Flagellulose |
HAFS-Korea | 2015 | Parts | Engineering an E.coli that transforms cellulose to alcohol by using gene from trichoderma reesei |
UCSC | 2015 | Parts | Engineering the Future of Biofuel |
Imperial | 2014 | Parts | Manufacture of Bacterial Cellulose Biomaterials: Towards Tailor-Made Biofilters |
Hannover | 2014 | Parts | Plant against – Removing heavy metals from nature |
StanfordBrownSpelman | 2014 | Parts | Towards a Biosynthetic Unmanned Aerial Vehicle |
Biwako Nagahama | 2013 | Parts | AgRePaper&E.coli-ink |
Penn State | 2013 | Parts | Plants as Plants: Natural Factories Producing Fuel, Plastic, Flavoring, and More |
WHU-China | 2012 | Parts | E. coslim: Synthetic Probiotics Help Defy Obesity |
HUST-China | 2012 | Parts | Synthetic Biofactory: Lignocellulose Decomposer and Microbial Fuel Cell |
Missouri_Miners | 2012 | Parts | Adjustable Multi-Enzyme to Cell Surface Anchoring Protein |
Bielefeld-Germany | 2012 | Parts | TOXIC COMPOUNDS IN NATURAL WATER - A CASE FOR LACCASE |
Tec-Monterrey | 2011 | Parts | E. Coli's Sweet Deal |
Tokyo_Metropolitan | 2010 | Parts | Life Design: Fine Clothing, Color Housing and Delicious Food by using E. coli |
Highlighted Projects
2014 Imperial Team
The [http://2014.igem.org/Team:Imperial iGEM 2014 Imperial Team] created a bacterial cellulose filter for their Aqualose project.
"The porosity of bacterial cellulose and our synthetic attachment of contaminant-specific binding and catabolic proteins make for a flexible, modular water filter. Our manufactured biomaterial would augment water recycling and reclamation on local and industrial scales, helping to alleviate water stress." - [http://2014.igem.org/Team:Imperial iGEM 2014 Imperial Team]
Through their project, they created a set of well-documented cellulose binding domains, paired with reporter genes (GFP) and metal binding domains.
2014 StanfordBrownSpelman Team
The [http://2014.igem.org/Team:StanfordBrownSpelman iGEM 2014 StanfordBrownSpelman Team] used cellulose as a biomaterial in their UAV.
Cellulose Synthesis
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K861100 | BcsA,cellulose synthetase, catalytic subunit | Coding | Xian Xia | 2619 | 1 | . . . ccatcggatcaggctttggctcaacaatga |
BBa_K861110 | BcsB,regulator of cellulose synthetase | Coding | Xian Xia | 2340 | 1 | . . . cgtcgtcgtcttaacccggataacgagtaa |
BBa_K336020 | bacterial cellulose synthase B | Coding | Naoto Shimada | 2415 | . . . cagttgcaggaagaaaggcagaaatcgtga | |
BBa_K336021 | bacterial cellulose synthase D | Coding | Naoto Shimada | 471 | . . . tacatgcgtacccgcagcaacagcaactga | |
BBa_K861120 | BcsZ, endo-1,4-D-glucanase | Coding | Xian Xia | 1107 | 1 | . . . tggggccaggaatgcgcaaattcacactaa |
BBa_K1043005 | Cellulose Synthase | Other | Casey Hall | 3078 | . . . gacacttccaagtgtggcatcaactgctga | |
BBa_K1043006 | Cellulose Synthase 8 | Other | Casey Hall | 2955 | . . . ctttctctgaactgtcttttgatcgattgc | |
BBa_K336051 | bacterial cellulose synthase A | Coding | Naoto Shimada | 2238 | . . . gaaggaaagatcagtcgtgcggcctcgtga | |
BBa_K336052 | bacterial cellulose synthase C | Coding | Naoto Shimada | 3978 | . . . tccgtacactatcttattatggaccagtaa | |
BBa_K861130 | BcsC,cellulose synthetase subunit | Coding | Xian Xia | 3474 | 1 | . . . cagccgctgataccttacgccgactggtaa |
BBa_K1044003 | Cellulose synthase gene CelA from Agrobacterium tumefaciens C58. | Coding | Koki Tsutsumi | 2190 | . . . agcgccaagcctgtcggagccgtgaaatga | |
BBa_K1044004 | CelB protein gene CelB from Agrobacterium tumefaciens C58. | Coding | Koki Tsutsumi | 2484 | . . . atgctgcgcatgatggggcggcatcgatga | |
BBa_K1044005 | Cellulose synthased operon (CelA,B,C) from Agrobacterium tumefaciens C58. | Composite | Koki Tsutsumi,Eshin Mitsui | 5722 | . . . ctggcaaggaataacggggaatgccgatga |
Cellulose Binding
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K863101 | Cellulose binding Domain of Cellulomonas Fimi Exoglucanse (Freiburg-Standard) | Protein_Domain | Moritz Müller | 345 | . . . ccctgcacggtcggcggcagcaccggttaa | |
BBa_K863111 | Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard) | Protein_Domain | Moritz Müller | 318 | . . . gaatttggatttgcaggcagcaccggttaa | |
BBa_K1478001 | Cellulose binding domain | Protein_Domain | Fabian Frömling | 309 | 3 | . . . tacgttgaatttggatttgcgtcaggccgt |
BBa_K1321090 | Phytochelatin (PC) EC20 + Linker-dCBD | Coding | Xenia Spencer-Milnes | 495 | . . . gtcctgaacccgtactactcccagtgtctt | |
BBa_K1321092 | Phytochelatin (PC) EC20 fused to CBDcex | Coding | Xenia Spencer-Milnes | 456 | . . . aacggcacgccctgcacggtcggcggcagc | |
BBa_K1321094 | CBDclos fused to Phytochelatin (PC) EC20 | Coding | Xenia Spencer-Milnes | 429 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc | |
BBa_K1321339 | CBDcenA+Linker, RFC 25 standard | Coding | Chris N Micklem | 408 | 13 | . . . accccaacgcctactccgacggtcaccccc |
BBa_K1321340 | Double CBD (dCBD) with N-terminal linker | Coding | Chris N Micklem | 366 | 28 | . . . gtcctgaacccgtactactcccagtgtctt |
BBa_K1321341 | sfGFP fused to CBDclos in RFC 25 | Coding | Chris N Micklem | 1017 | 2 | . . . acatatgttgaatttggatttgcaggcagc |
BBa_K1321342 | sfGFP fused to CBDcex in RFC 25 | Coding | Chris N Micklem | 1044 | 3 | . . . aacggcacgccctgcacggtcggcggcagc |
BBa_K1321343 | NiBP fused to CBDclos in RFC 25 | Coding | Chris N Micklem | 482 | 1 | . . . acatatgttgaatttggatttgcaggcagc |
BBa_K1321344 | NiBP fused to CBDcex in RFC 25 | Coding | Chris N Micklem | 509 | 1 | . . . aacggcacgccctgcacggtcggcggcagc |
BBa_K1321345 | NiBP fused to dCBD with linker in RFC 25 | Coding | Chris N Micklem | 548 | 1 | . . . gtcctgaacccgtactactcccagtgtctt |
BBa_K1321346 | CBDclos fused to sfGFP in RFC 25 | Coding | Chris N Micklem | 1017 | 1 | . . . atcacgcatggtatggatgaactgtacaaa |
BBa_K1321348 | sfGFP fused to dCBD with linker in RFC 25 | Coding | Chris N Micklem | 1083 | 3 | . . . gtcctgaacccgtactactcccagtgtctt |
BBa_K1321349 | CBDcex fused to sfGFP in RFC 25 | Coding | Chris N Micklem | 1044 | 1 | . . . atcacgcatggtatggatgaactgtacaaa |
BBa_K1321351 | CBDcenA with linker fused to NiBP in Freiburg format (RFC 25) | Coding | Chris N Micklem | 590 | 1 | . . . gaagaaggttgctgccacgggcatcacgag |
BBa_K1321352 | NiBP fused to CBDcex driven by T7 | Coding | Chris N Micklem | 567 | . . . aacggcacgccctgcacggtcggcggcagc | |
BBa_K1321353 | NiBP fused to CBDclos driven by T7 | Coding | Chris N Micklem | 540 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1321356 | sfGFP fused to CBDclos driven by LacI | Composite | Chris N Micklem | 1252 | 1 | . . . acatatgttgaatttggatttgcaggcagc |
BBa_K1321357 | sfGFP fused to CBDcex driven by LacI | Composite | Chris N Micklem | 1279 | 1 | . . . aacggcacgccctgcacggtcggcggcagc |
BBa_K1499004 | Cellulose binding domains with streptavidin domain generator | Generator | Raman Nelakanti | 1052 | . . . ccataaccaccgccacaaacatgtttaaac | |
BBa_K1321100 | Phytochelatin (PC) EC20 fused to linker-dCBD with T7 promoter | Coding | Xenia Spencer-Milnes | 553 | . . . gtcctgaacccgtactactcccagtgtctt | |
BBa_K1321101 | Phytochelatin (PC) EC20 fused to CBDclos with T7 promoter | Coding | Xenia Spencer-Milnes | 487 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1321104 | CBDclos fused to Phytochelatin (PC) EC20 with T7 promoter | Coding | Xenia Spencer-Milnes | 487 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc | |
BBa_K1321105 | CBDcex fused to Phytochelatin (PC) EC20 with T7 promoter | Coding | Xenia Spencer-Milnes | 514 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc | |
BBa_K1321110 | Phytochelatin (PC) EC20 fused to linker-dCBD with LacI | Coding | Xenia Spencer-Milnes | 730 | . . . gtcctgaacccgtactactcccagtgtctt | |
BBa_K1321111 | Phytochelatin (PC) EC20 fused with CBDclos with LacI promoter | Coding | Xenia Spencer-Milnes | 664 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1321112 | Phytochelatin (PC) EC20 fused to CBDcex with LacI promoter | Coding | Xenia Spencer-Milnes | 691 | . . . aacggcacgccctgcacggtcggcggcagc | |
BBa_K1321114 | CBDclos fused to phytochelatin (PC) EC20 with LacI promoter | Coding | Xenia Spencer-Milnes | 664 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc | |
BBa_K1321115 | CBDcex fused to phytochelatin (PC) EC20 with LacI promoter | Coding | Xenia Spencer-Milnes | 691 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc | |
BBa_K1321120 | SmtA metallothionein fused to linker-dCBD | Coding | Gabriella Santosa | 537 | . . . gtcctgaacccgtactactcccagtgtctt | |
BBa_K1321366 | CBDcex fused to sfGFP with T7 promoter | Composite | Gabriella Santosa | 1102 | . . . atcacgcatggtatggatgaactgtacaaa | |
BBa_K1321121 | Smt metallothionein fused to CBDclos | Generator | Gabriella Santosa | 471 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1321122 | Smt fused to CBDcex | Coding | Gabriella Santosa | 498 | . . . aacggcacgccctgcacggtcggcggcagc | |
BBa_K1321151 | metallothionein Fmt fused to CBDclos | Coding | Gabriella Santosa | 504 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1321152 | metallothionein Fmt fused to CBDcex | Coding | Gabriella Santosa | 531 | . . . aacggcacgccctgcacggtcggcggcagc | |
BBa_K1321154 | CBDclos fused to metallothionein Fmt | Coding | Gabriella Santosa | 504 | . . . gttaaagatgattgttgtggttgtggcaaa | |
BBa_K1321091 | Phytochelatin (PC) EC20 fused to CBDclos | Coding | Xenia Spencer-Milnes | 447 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1321095 | CBDcex fused to Phytochelatin (PC) EC20 | Coding | Xenia Spencer-Milnes | 472 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc | |
BBa_K1321097 | CBDcenA-linker fused to Phytochelatin (PC) EC20 | Coding | Xenia Spencer-Milnes | 511 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc | |
BBa_K1933103 | constitutive expression of CBDclos fused to BclA with 6xHis tag | Composite | Tomoki Uchino | 444 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1933102 | constitutive expression of CBDcex fused to BclA with 6xHis tag | Composite | Tomoki Uchino | 471 | . . . aacggcacgccctgcacggtcggcggcagc | |
BBa_K1933101 | constitutive expression of CBDclos fused to INPNC with 6xHis tag | Composite | Tomoki Uchino | 1335 | . . . acatatgttgaatttggatttgcaggcagc | |
BBa_K1933100 | constitutive expression of CBDcex fused to INPNC with 6xHis tag | Composite | Tomoki Uchino | 1362 | . . . aacggcacgccctgcacggtcggcggcagc | |
BBa_K2825000 | PETase-Linker-CBDcipA-Linker-HlyA tag | Device | John Starkel, Jacob Premo, Daniel Zheng | 6943 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K3819004 | CBM/CBD | Coding | AllysonC | 477 | -1 | . . . ggggttttagtttggggtaaggaacccgga |
BBa_K3765004 | dCBD (Double Cellulose Binding Domain) | Coding | Dipayan Akhuli | 366 | -1 | . . . gtgttaaatccctactactctcagtgtctg |
BBa_K3765012 | PelB_Signal+10xHis+SpyCatcher002+dCBD | Composite | Dipayan Akhuli | 861 | -1 | . . . ttaaatccctactactctcagtgtctgtaa |
BBa_K3765016 | T7 RBS + SpyCatcher002+dCBD | Translational_Unit | Dipayan Akhuli | 894 | -1 | . . . ttaaatccctactactctcagtgtctgtaa |
BBa_K3765020 | SpyCatcher002+dCBD under T7 promoter | Generator | Dipayan Akhuli | 1110 | -1 | . . . gcctctaaacgggtcttgaggggttttttg |
BBa_K4380000 | Cellulose Binding domain (CBD) | Coding | Brigita Duchovska | 492 | -1 | . . . ggcgttctggtttggggtaaggagccgggt |
BBa_K4795007 | transcribe endoglucanase, extranect glucanase, β-glucosidase | Composite | Zilu Liu | 3006 | -1 | . . . agcaattggtccgcccaacaaaacaactag |
BBa_K863102 | Cellulose binding Domain of C. Fimi Exoglucanase with T7, RBS, GS-Linker (Freiburg-Standard) | Composite | Moritz Müller | 373 | . . . ccctgcacggtcggcggcagcaccggttaa | |
BBa_K863103 | Cellulose binding Domain from Cellulomonas Fimi with Reporter GFP | Reporter | Moritz Müller | 1111 | . . . aaacatcaccatcaccatcacaccggttaa | |
BBa_K863110 | Cellulose binding Domain from Clostridium cellulovorans cellulose binding protein | Protein_Domain | Moritz Müller | 312 | . . . tatgttgaatttggatttgcaaccggttaa | |
BBa_K863112 | Cellulose binding domain of C. cellulovorans with T7, RBS, GS-Linker (Freiburg-Standard) | Composite | Moritz Müller | 337 | . . . gaatttggatttgcaggcagcaccggttaa | |
BBa_K863113 | Cellulose binding Domain of C. cellulovorans cellulose binding protein with Reporter GFP | Reporter | Moritz Müller | 1075 | . . . aaacatcaccatcaccatcacaccggttaa | |
BBa_K863104 | Cellulose binding Domain from C. Fimi with const. Promotor and GFP | Reporter | Moritz Müller | 1144 | . . . aaacatcaccatcaccatcacaccggttaa | |
BBa_K863114 | CBD of C. cellulovorans cellulose binding protein gene with const. Promoter (J23100+J61101) and GFP | Reporter | Moritz Müller | 1117 | . . . aaacatcaccatcaccatcacaccggttaa | |
BBa_K1321093 | Phytochelatin (PC) EC20 + Linker-CBDcipA-Linker | Coding | Gabriella Santosa | 840 | 2 | . . . gctaccacgattcctccatcagacgatccg |
BBa_K1321003 | Re-entry of BBa_K863101, Cellulose Binding Domain CBDcex in rfc25 | Coding | Xenia Spencer-Milnes | 327 | 25 | . . . aacggcacgccctgcacggtcggcggcagc |
BBa_K1321002 | Re-entry of BBa_K863111, Cellulose Binding Domain CBDclos in rfc25 | Coding | Xenia Spencer-Milnes | 300 | 27 | . . . acatatgttgaatttggatttgcaggcagc |
BBa_K1321014 | CBDCipA with N and C-terminal linker | Coding | Xenia Spencer-Milnes | 711 | 7 | . . . gctaccacgattcctccatcagacgatccg |
BBa_K1321096 | Linker-CBDcipA-Linker + Phytochelatin (PC) EC20 | Coding | Xenia Spencer-Milnes | 840 | 2 | . . . tgcgagtgcgaatgcgaatgcgagtgcggc |
BBa_K1979001 | CBD (cbh2) | Coding | MA Xinyi | 147 | 5 | . . . ccgggtgctgcttcttcttcttctggttct |