Collections/Plants

• Catalog
• Collections

This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.

iGEM Teams and Labs are using plant chassis in their synthetic biology projects. They have experimentally validated their parts, documented them on the Registry, and submitted samples to the Registry's repository.

The Registry does not currently have a preferred chassis, standard, or protocol(s), for plant synthetic biology. However, this collection aims to highlight parts meant to be used in the most common plant chassis by previous teams.

Previous iGEM Plant Projects

The following table contains iGEM teams that have worked in plant chassis, along with links to their project wiki and Registry parts. This is not an exhaustive list.

Team	Year	Parts	Chassis	Project Title
Valencia UPV	2016	Parts	Nicotiana benthamiana	HYPE-IT: Hack Your Plants Editing with Innovative Technologies
AHUT_China	2015	Parts	Rehmannia glutinosa	Nutrition Commander:A bio-device can control the APeGs of the plant metabolism
Cambridge-JIC	2015	Parts	Marchantia polymorpha	OpenScope - Open-source, 3D printable fluorescence microscope
CAU_China	2015	Parts	Arabidopsis thaliana	Herbicide vs Herbicide Resistant Gene
Georgia_State	2015	Parts	Nicotiana tabacum	Protein Products from Plants and Pichia: Novel Manufacturing of Analgesics and Cannabinoids
NRP-UEA-Norwich	2015	Parts	Nicotiana benthamiana	Engineering nutrition to increase colonic butryrate
NYMU-Taipei	2015	Parts	Nicotiana tabacum	Fight the Blight
UNIK_Copenhagen	2015	Parts	Physcomitrella patens	SpaceMoss: Using synthetic biology for space exploration
Valencia UPV	2015	Parts	Nicotiana benthamiana	AladDNA
Waterloo	2015	Parts	Arabidopsis thaliana	CRISPieR: re-engineering CRISPR-Cas9 with functional applications in eukaryotic systems
Cambridge-JIC	2014	Parts	Marchantia polymorpha	mösbi - the plant biosensor for everyone
Hannover	2014	Parts	Arabidopsis thaliana, Nicotiana tabacum	Plant against – Removing heavy metals from nature
NRP-UEA-Norwich	2014	Parts	Nicotiana benthamiana	Green Canary: Induction of chromoproteins to signal plant-pathogen interactions
Valencia UPV	2014	Parts	Nicotiana benthamiana	The Sexy Plant
TU-Munich	2013	Parts	Physcomitrella patens	PhyscoFilter – Clean different
Kyoto	2012	Parts	-	Flower Fairy E.coli
UEA-JIC_Norwich	2011	Parts	Physcomitrella patens	The evolution of synthetic biology; The introduction of new photosynthetic eukaryotes as model organisms.
Harvard	2010	Parts	Arabidopsis thaliana	iGarden: an Open Source Toolkit for Plant Engineering
Nevada	2010	Parts	Nicotiana tabacum	Development of Plant Biosensors for Environmental Monitoring Using Nicotiana tabacum Protoplasts as Transgenic Plant Models

Chassis

Nicotiana benthamiana

"N. benthamiana is a widely used experimental plant from the solanaceous group of flowering plants that includes tomatoes, potatoes and capsicums. It is widely used in plant pathology due to the large number of plant pathogens (viruses, bacteria, fungi, oomycetes etc) that can successfully infect it. Of importance to synthetic biologists, N. benthamiana, is easily genetically transformed, regenerated and amenable to facile methods for virus-induced gene silencing and transient protein expression..." - [http://2014.igem.org/Team:NRP-UEA-Norwich/Project_System NRP-UEA-Norwich 2014]

More...

Name	Description	Type	Created by	length	uses	seq
BBa_K1467101	GoldenGate compatible 35s Promoter	Regulatory	Cara Deal	1432	10	. . . acaattacatttacaattatcgatacaatg
BBa_K1467102	GoldenGate compatible BS3 promoter + 5	Regulatory	Cara Deal	1032		. . . agtagtcctagttgcacatatatttcaatg
BBa_K1467103	GoldenGate compatible PDF1.2 promotor	Regulatory	Cara Deal	1050		. . . ttgaaaacaaaatagtaataatcatcaatg
BBa_K1467104	GoldenGate compatible MAS promoter	Regulatory	Cara Deal	391		. . . ataaccaatctcgatacaccaaatcgaatg
BBa_K1467204	GoldenGate compatible Green Flourescent Protein (GFP)	Reporter	Cara Deal	730	6	. . . atggacgagctgtacaagtaagcttaataa
BBa_K1554000	TA29 promoter	Regulatory	Valencia_UPV team members	859		. . . gtttttacttaaagaaattagctaaaaatg
BBa_K1554002	HarFAR	Coding	Valencia_UPV team members	1365		. . . aggcacttcttggaaaagaaatatcggtga
BBa_K1554001	AtrΔ11	Coding	Valencia_UPV team members	981		. . . ggtactgatatgtggggtaggaaacgttga
BBa_K1742002	Dronpa 145N	Coding	Iv�n Casas Rodrigo	693	3	. . . caggctaaacctaaaaagaagagaaaagtt
BBa_K1742006	BxBI Reporter (attB:T35S:attP:OmegaUTR)	Reporter	Iv�n Casas Rodrigo	397		. . . aacaacaaacaaaatacaaacaacaacaac
BBa_K1742008	PhiC31 Reporter attP:T35S:attB:omegaUTR	Reporter	Ruben Escriba Piera	412		. . . aacaacaaacaaaatacaaacaacaacaac
BBa_K1618028	Chloroplast Transit Peptide	Coding	Leda Coelewij	177	8	. . . attgctagtaacggaggaagagttcgagca
BBa_K1618037	35s Terminator	Terminator	Leda Coelewij	212	8	. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1467203	GoldenGate compatible Bax - cell death inducer	Reporter	Cara Deal	589		. . . atctggaagaagatgggttaggcttaataa
BBa_K1467205	AvrBS3 TAL Effector - Induces BS3	Coding	Cara Deal	3505		. . . atggaacttctgcctcagtaggcttaataa
BBa_K1554003	EaDAcT	Coding	Valencia_UPV team members	1092		. . . ttgggtacaagattcgtgtgcggcaattga
BBa_K1554004	Yellow biosafety module for plants	Device	Valencia_UPV team members	3394		. . . attcctaaaaccaaaatccagtgacctcgc
BBa_K1554005	Blue biosafety module for plants	Device	Valencia_UPV team members	3364		. . . attcctaaaaccaaaatccagtgacctcgc
BBa_K1742000	Avena sativa LOV2 domain	Coding	Ruben Escriba Piera	456		. . . attgataaggcagtcgatacttgggtctga
BBa_K1742001	Entertoxin LTB	Coding	Ruben Escriba Piera	414		. . . gatgagctacatcatcatcatcatcattga
BBa_K1742003	Dronpa 145K	Coding	Iv�n Casas Rodrigo	741	3	. . . gctaagcccaagaagaagaggaaggtgtga
BBa_K1742004	PhiC31 Plant codon optimized	Coding	Iv�n Casas Rodrigo	1836		. . . gtggcagcaccaaaaaaaaagaggaaggtg
BBa_K1742005	BxBI integrase	Coding	Iv�n Casas Rodrigo	1693		. . . gttgagcgattgcacacgggtatgtcttga
BBa_K1742009	35S:BxbI:T35S - 35S:ReporterBxBI::GFP:T35S	Device	Pilar Baldominos	2964		. . . acacgggggactaaaaaaatggcttcctcc
BBa_K1742011	35S:LacIBDBD-DronpaK:T35S - 35S:DronpaN-VP16:T35S	Device	M�nica Victoria Guti�rrez Salazar	2592		. . . gatgcccttggaattgacgagtacggtggg
BBa_K1742010	35S:LexABD-DronpaK:T35S - 35S:DronpaN-VP16:T35S	Device	Pilar Baldominos	3176		. . . caggctaaacctaaaaagaagagaaaagtt
BBa_K1742012	35S:Gal4BD-DronpaK:T35S - 35S:DronpaN-VP16:T35S	Device	M�nica Victoria Guti�rrez Salazar	3610		. . . gatgcccttggaattgacgagtacggtggg
BBa_K1618029	Acyltransferase Candidate 1 -Fused to GFP -Expression Construct	Composite	Leda Coelewij	3134		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618030	Acyltransferase Candidate 2 -Fused to GFP -Expression Construct	Composite	Leda Coelewij	3407		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618031	Acyltransferase Candidate 3 -Fused to GFP -Expression Construct	Composite	Leda Coelewij	3485		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618032	Acyltransferase Candidate 4 -Fused to GFP -Expression Construct	Composite	Leda Coelewij	3659		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618033	Acyltransferase Candidate 1 Expression Construct	Composite	Leda Coelewij	2396		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618034	Acyltransferase Candidate 2 Expression Construct	Composite	Leda Coelewij	2669		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618035	Acyltransferase Candidate 3 Expression Construct	Composite	Leda Coelewij	2747		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618036	Acyltransferase Candidate 4 Expression Construct	Composite	Leda Coelewij	2921		. . . ccaaaatccagtactaaaatccagatcgct
BBa_K1742013	35S:PhiC31:T35S - 35S:ReporterPhiC31::GFP:T35S	Device	Ruben Escriba Piera	5508		. . . ttcctaaaaccaaaatccagtgacctcgct
BBa_K2017000	C-split Cas9 + DnaE C-intein	Protein_Domain	Monica Victoria Gutierrez Salazar	2358		. . . aaggtgcccaagaagaagaggaaggtgtga
BBa_K2017001	N-split Cas9 + DnaE N-intein	Protein_Domain	Monica Victoria Gutierrez Salazar	2241		. . . gatttgatgagggtggacaacctccctaac
BBa_K2017007	35s:5'+ Ga20ox consense + SAGTI-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	3057		. . . gttactagatcggcaattccgctagagacc
BBa_K2017008	35s + Ga20ox consense + RSIAT-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2836		. . . gttactagatcggcaattccgctagagacc
BBa_K2017009	35s + Ga20ox consense + AEK-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2872		. . . gttactagatcggcaattccgctagagacc
BBa_K2017011	35s:5' + TFL consense + SAGTI-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	3057		. . . gttactagatcggcaattccgctagagacc
BBa_K2017010	35s + Ga20ox consense + RSIAT-TEV-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2869		. . . gttactagatcggcaattccgctagagacc
BBa_K2017012	35s + TFL consense + RSIAT-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2836		. . . gttactagatcggcaattccgctagagacc
BBa_K2017013	35s + TFL consense + AEK-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2872		. . . gttactagatcggcaattccgctagagacc
BBa_K2017014	35s + TFL consense + RSIAT-TEV-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2869		. . . gttactagatcggcaattccgctagagacc
BBa_K2269009	35s: PhyB: VP16:NLS: Tnos	Composite	Jos� �lvaro Ballesteros Gonz�lez	3970		. . . gataaatgcttcaataatgggaccgactcg
BBa_K4799990	pAtMRP3	Regulatory	Youran Yao, Wanjun Chen	1651	-1	. . . tattctcctcctccaaaactcgcctccata
BBa_K5223000	GjUGT94E13_opt (UDP-glucosyltransferase)	Coding	Chong Yao	1341	-1	. . . ctttgtcggaagaacaatggtggttgttga
BBa_K5223003	GjCCD4a_opt (Carotenoid cleavage dioxygenase)	Coding	Chong Yao	1995	-1	. . . gtgagagagtcagaactgaacaagttgtga
BBa_K5223002	GjUGT74F8_opt (UDP-glucosyltransferase)	Coding	Chong Yao	1374	-1	. . . gagcttgctggacagaaggcacagaactga
BBa_K5223004	GjALDH2C3_opt (aldehyde dehydrogenase)	Coding	Chong Yao	1512	-1	. . . acaccaatttacaattctccgtggttgtga
BBa_K5223006	HCT-M (Hydroxycinnamoyl transferase)	Coding	Chong Yao	1383	-1	. . . gaagatatccaccatcaccaccatcattga
BBa_K5223007	HQT2+4-sgRNA	RNA	Chong Yao	547	-1	. . . gtagtgattgcaacatgtaactttgtcaat
BBa_K5223008	HQT2-sgRNA	RNA	Chong Yao	547	-1	. . . gtagtgattgactaccctcgtgctcggact
BBa_K5223009	HQT3-sgRNA	RNA	Chong Yao	547	-1	. . . gtagtgattgacatggtcagaagttgcccg
BBa_K5223010	HQT4-sgRNA	RNA	Chong Yao	547	-1	. . . gtagtgattgacatggtcagaagttgcccg
BBa_K5223011	minimal 35S promoter	DNA	Chong Yao	46	-1	. . . atataaggaagttcatttcatttggagagg
BBa_K5223012	Phaselic Acid Synthesis System in Nicotiana benthamiana	Composite	Chong Yao	1728	-1	. . . atctatgttactagatcgacgctcgagacc
BBa_K5223013	YlARO3 (ARO3 gene derived from Yarrowia lipolytica)	Coding	Chong Yao	1107	-1	. . . cgtagaggacatcaccatcatcatcattag
BBa_K5223014	VvSTS (Vitis vinifera stilbene synthase)	Coding	Chong Yao	1197	-1	. . . gttaccaatcatcaccatcaccaccactga
BBa_K5223005	Crocin Synthesis System in Nicotiana benthamiana	Composite	Chong Yao	7626	-1	. . . atctatgttactagatcgacgctcgagacc
BBa_K5223015	Resveratrol Synthesis System in Nicotiana benthamiana	Composite	Chong Yao	3002	-1	. . . atctatgttactagatcgacgctcgagacc
BBa_K4213000	Plant Thiamine Pyrophosphate Riboswitch	Regulatory	Ioannis Retalis	675	-1	. . . tacagccataaaagaagtctttaactcgct
BBa_K5223001	High-intensity 35S promoter	Regulatory	Junxian Li	394	-1	. . . gacccttcctctatataaggaagttcattt

• The parts above have been tested or are intended to be used in Nicotiana benthamiana.
• To add to this list, please use the category //chassis/eukaryote/nbenthamiana

iGEM Teams that have worked with Nicotiana benthamiana

• [http://2015.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2015 Wiki] | Parts
• [http://2015.igem.org/Team:Valencia_UPV Valencia UPV 2015 Wiki] | Parts
• [http://2014.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2014 Wiki] | Parts
• [http://2014.igem.org/Team:Valencia_UPV Valencia UPV 2014 Wiki] | Parts

---

Marchantia polymorpha

"Marchantia polymorpha is [a] novel, eukaryotic multicellular chassis. Being a liverwort, it is one of the most primitive land plants around. Its small size and relative genetic simplicity make it easy to work with and an exciting new model organism in synthetic biology. Content to grow on agar plates, marchantia can be bioengineered in a standard lab with minimal extra equipment." - [http://2014.igem.org/Team:Cambridge-JIC Cambridge-JIC 2014]

More...

Name	Description	Type	Created by	length	uses	seq
BBa_K1484215	nopaline synthase terminator	Terminator	Salil Bhate	293	10	. . . gttactagatcggcaattccgctagagacc
BBa_K1484000	AsPink chromoprotein in GoldenGate standard	Coding	Virginie Rutten	721		. . . gctgggtcataattaataagctttgagacc
BBa_K1484001	tsPurple chromoprotein in GoldenGate standard	Coding	Virginie Rutten	709		. . . ggaaaaagcgacgtaataagctttgagacc
BBa_K1484002	AmajLime chromoprotein in BBa and MoClo standard	Coding	Virginia Rutten	711		. . . cggtcgtgccgttctaataactttgagacc
BBa_K1484104	N7 nuclear localisation tag	Tag	Salil Bhate	262		. . . tgatcaagaagaagagtaaggtatgagacc
BBa_K1484106	LTI membrane localisation tag	Coding	Salil Bhate	238		. . . ttatatcatcaccttttgaggtatgagacc
BBa_K1484214	MpEF1a (Marchantia poylmorpha Elongation Factor 1, PlantSyntax Pro+5U)	Regulatory	Salil Bhate	1756		. . . ctgcacaaaggttgtcaccaatgtgagacc
BBa_K1484316	Mp Selection Cassette	Temporary	Salil Bhate	3559		. . . ttactagatcggcaattcgcaaaagtcttc

• The parts above have been tested or are intended to be used in Marchantia polymorpha.
• To add to this list, please use the category //chassis/eukaryote/mpolymorpha

iGEM Teams that have worked with Marchantia polymorpha

• [http://2015.igem.org/Team:Cambridge-JIC Cambridge-JIC Wiki 2015] | Parts
• [http://2014.igem.org/Team:Cambridge-JIC Cambridge-JIC Wiki 2014] | Parts

---

Arabidopsis thaliana

"Arabidopsis thaliana ... is easy to transform via R. radiobacter and has a short regeneration time." - [http://2014.igem.org/Team:Hannover Hannover 2014]

More...

Name	Description	Type	Created by	length	uses	seq
BBa_K1478000	Expa4 plant secretion signal, localizes to extracellular space	Protein_Domain	Fabian Fr�mling	60		. . . acatttgttctttttagcctcgccgacgct
BBa_K1478001	Cellulose binding domain	Protein_Domain	Fabian Fr�mling	309	3	. . . tacgttgaatttggatttgcgtcaggccgt
BBa_K382000	pORE Open Series Vector with BioBrick MCS (Basta resistance)	Plasmid	Christina Agapakis	7208		. . . tagaccagttacccagatctgaggcgcgcc
BBa_K382001	pORE Open Serices Vector with BioBrick MCS (Kan resistance)	Plasmid_Backbone	Christina Agapakis	7451		. . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382003	pORE Expression Series Vector with BioBrick MCS (Kan reistance)	Plasmid	Christina Agapakis	7969		. . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382002	pORE Expression Series Vector with BioBrick MCS, Basta resistance	Plasmid	Mara C. Inniss	7786		. . . tagaccagttacccagatctgaggcgcgcc
BBa_K382004	pORE Gus Reporter Series Vector with BiOBrick MCS (Kan resistance)	Plasmid_Backbone	Christina Agapakis	9295		. . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382005	pORE GFP Reporter Series Vector with BioBrick MCS (Kan resistance)	Plasmid_Backbone	Christina Agapakis	8203		. . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382010	amiRNA Construct for lycopene epsilon cyclase (LUT2)	RNA	Patrick Boyle	413		. . . tttatctttatttaaggcatcgccatgggg
BBa_K382012	amiRNA Construct for lycopene beta cyclase (LYC)	RNA	Christina Agapakis	413		. . . tttatctttatttaaggcatcgccatgggg
BBa_K382011	amiRNA Construct for carotene beta-ring hydroxylase (BETA-OHASE 1)	RNA	Mara C. Inniss	413		. . . tttatctttatttaaggcatcgccatgggg
BBa_K382014	ihpRNA construct against Arabidopsis Bet v 1 allergen	RNA	Christina Agapakis	1288		. . . gacgtctacctcaatctcctcttctatcat
BBa_K382020	Arabidopsis optimized Brazzein	Coding	Patrick Boyle	165		. . . ctccagtgtatctgtgattattgtgagtat
BBa_K382021	Arabidopsis optimized Miraculin	Coding	Patrick Boyle	660		. . . gctttcgagttcaacaaaaccgtttatttc
BBa_K382015	ihpRNA construct against Arabidopsis LTP Allergen	RNA	Christina Agapakis	1372		. . . caagcatgccaacttcatcactccagccat
BBa_K382022	pENTCUP2 plant specific promoter	Regulatory	Patrick Boyle	503		. . . ctcatcatcctcacctcaaaacccaccgga
BBa_K382017	ihpRNA construct against Arabidopsis LTP Allergen	RNA	Christina Agapakis	424		. . . tttatctttatttaaggcatcgccatgggg
BBa_K382018	PDK intron	Intermediate	Christina Agapakis	793		. . . attgattacagttgggaaattgggttcgaa
BBa_K382019	ihpRNA construct against Arabidopsis Ger3 allergen	RNA	Christina Agapakis	1429		. . . atcatcttcatactagtagcggccgctgca
BBa_K382034	Act2pLacO (Actin promoter + 2x LacO)	Regulatory	Mara C. Inniss	1241		. . . ctctttttgtgtgtttgcagctcataaaaa
BBa_K382025	Arabidopsis optimized Miraculin with StrepII N-terminus tag	Coding	Patrick Boyle	696		. . . gctttcgagttcaacaaaaccgtttatttc
BBa_K382026	Arabidopsis optimized Brazzein with StrepII N-terminus	Coding	Patrick Boyle	201		. . . ctccagtgtatctgtgattattgtgagtat
BBa_K382040	Arabidopsis optimized Miraculin+2xYFP	Coding	Mara C. Inniss	2160		. . . gatgaactatacaaaggttctggtaccgca
BBa_K382041	Arabidopsis optimized Brazzein+2xYFP	Coding	Mara C. Inniss	1665		. . . gatgaactatacaaaggttctggtaccgca
BBa_K382027	Arabidopsis optimized Miraculin with StrepII C-terminus tag	Coding	Patrick Boyle	696		. . . agtgcttggtctcacccacaattcgaaaag
BBa_K382028	Arabidopsis optimized Brazzein with StrepII C-terminus	Coding	Patrick Boyle	201		. . . agtgcttggtctcacccacaattcgaaaag
BBa_K1478002	Top metal binding protein. Binds zinc, arsenic, copper and cadmium.	Coding	Fabian Fr�mling	909		. . . tgcggatcatcttgcagctgtaagtaataa
BBa_K1982002	Prokaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor)	Coding	Zexu Li	1854		. . . actacaagtttgggaaaaaatggttgcaaa
BBa_K1982003	CIBN(the N-terminal fragment of CIB1)	Coding	Zexu Li	612		. . . ccatacgatgttccagattacgcttaataa
BBa_K1982010	CRY2-VP64(Eukaryotic LACE system)	Coding	Zexu Li	2100		. . . gactacaaggacgacgacgacaaataataa
BBa_K1982009	Eukaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor)	Coding	Zexu Li	1848		. . . actacaagtttgggaaaaaatggttgcaaa
BBa_K4213000	Plant Thiamine Pyrophosphate Riboswitch	Regulatory	Ioannis Retalis	675	-1	. . . tacagccataaaagaagtctttaactcgct

• The parts above have been tested or are intended to be used in Arabidopsis thaliana.
• To add to this list, please use the category //chassis/eukaryote/athaliana

iGEM Teams that have worked with Arabidopsis thaliana

• [http://2015.igem.org/Team:CAU_China CAU_China 2015] | Parts
• [http://2015.igem.org/Team:Waterloo Waterloo 2015] | Parts
• [http://2014.igem.org/Team:Hannover Hannover 2014] | Parts
• [http://2010.igem.org/Team:Harvard Harvard 2010] | Parts

---

Physcomitrella patens

"The moss Physcomitrella patens belongs to the land plant division Bryophyta, which are one of the earliest representatives of the land plants (Embryophyta) having evolved from green algae about 470 million years ago during the early Paleozoic...The general organization of plant tissue into roots, stem and leaves is found in a much more basic version in mosses. They show a differentiated stem with simple leaves, usually only a single layer of cells thick and lacking veins, that are used to absorb water and nutrients. Instead of roots they have similar threadlike rhizoids. These have a primary function as mechanical attachment rather than extraction of soil nutrients.

However different mosses and vascular plants are because of the early diverge of the evolutionary lineages, they share fundamental genetic and physiological processes. Here researchers chose Physcomitrella patens as a model organism with a genome size of about 450 Mb along 27 chromosomes that is highly similar to other land plants in both exon-intron-structure and codon usage." - [http://2013.igem.org/Team:TU-Munich TU-Munich 2013]

More...

Name	Description	Type	Created by	length	uses	seq
BBa_K1159000	Erythromycin Esterase Type II (EreB) in RFC[25]	Coding	Louise FUNKE	1254	2	. . . aagtcatctgtatctgaggtcgtttatgaa
BBa_K1159001	NanoLuc Luciferase in RFC[25]	Coding	TU Munich 2013	510	4	. . . ggttggagactttgcgagagaatccttgct
BBa_K1159003	Engineered Fluorescein-Binding Anticalin FluA (triple mutant variant) in RFC[25]	Coding	TU Munich 2013	522	1	. . . ttctctgaagccgcctgcaaggtcaacaat
BBa_K1159010	Secretory NanoLuc Luciferase (SERK-SigP_nLuc) in RFC[25] N-Part	Coding	TU Munich 2013	616		. . . ggttggagactttgcgagagaatccttgct
BBa_K1159303	Signal Peptide of SERK Receptor from Physcomitrella patens in RFC[25]	Protein_Domain	TU Munich 2013	100	9	. . . tctaacgctgagggtgatgctcttaacacc
BBa_K1159304	Signal Peptide of Ig Kappa chain from Mus musculus in RFC[25] N-part	Protein_Domain	TU Munich 2013	67	6	. . . ttgctttgggttccaggatctaccggcgat
BBa_K1159305	Transmembrane domain of SERK Receptor from Physcomitrella patens in RFC[25]	Protein_Domain	TU Munich 2013	186	2	. . . tggtggagaagaagaaggcctattgaggct
BBa_K1159307	35S Terminator of Cauliflower Mosaic Virus (CaMV)	Terminator	TU Munich 2013	217	9	. . . tctaattcctaaaaccaaaatccagtgacc
BBa_K1159308	Neomycin phosphotransferase II (nptII) plant expression cassette for G418 resistance	Device	Dong-Jiunn Jeffery TRUONG	1517	1	. . . tactagatcgggcctcctgtcaagcttgat
BBa_K1159006	Secretory NanoLuc Luciferase (IgKappa-SigP_nLuc) in RFC[25] N-Part	Coding	TU Munich 2013	583	3	. . . ggttggagactttgcgagagaatccttgct
BBa_K1159315	TMD of SERK Receptor from Physcomitrella patens with C-terminal GFP fusion in RFC[25]	Coding	TU Munich 2013	933	1	. . . attacacatggcatggatgagctctacaaa
BBa_K1159316	SERK-Receptor TMD with C-terminal GFP and N-terminal Strep-tag II TEV-site linker in RFC[25]	Coding	TU Munich 2013	996	8	. . . attacacatggcatggatgagctctacaaa
BBa_K1159314	TMD with N-terminal Signal Peptide of SERK Receptor from ''P. patens'' in RFC[25] N-Part	Coding	Dong-Jiunn Jeffery TRUONG	292	1	. . . tggtggagaagaagaaggcctattgaggct
BBa_K1159120	Red light triggered TEV Protease with FRET Reporter for plants translation unit (PhyB/PIF6 version)	Translational_Unit	Dong-Jiunn Jeffery TRUONG	6751		. . . attaccctgggtatggatgagctgtataaa
BBa_K1159202	Secretory SpyCatcher (IgKappa-SigP_SpyCatcher) in RFC[25] N-Part	Coding	Dong-Jiunn Jeffery TRUONG	412	1	. . . ggcaaagcaactaaaggtgacgctcatatt
BBa_K1159203	Secretory SpyTag (IgKappa-SigP_SpyTag) in RFC[25] N-Part	Coding	Dong-Jiunn Jeffery TRUONG	112	1	. . . gtcatggttgatgcttacaagccaactaag
BBa_K1159204	Secretory SpyCatcher (SERK-SigP_SpyCatcher) in RFC[25] N-Part	Coding	Dong-Jiunn Jeffery TRUONG	445	1	. . . ggcaaagcaactaaaggtgacgctcatatt
BBa_K1159205	Secretory SpyTag (SERK-SigP_SpyTag) in RFC[25] N-Part	Coding	Dong-Jiunn Jeffery TRUONG	145	1	. . . gtcatggttgatgcttacaagccaactaag
BBa_K1159206	Membrane-anchored SpyCatcher in RFC[25] N-Part	Coding	Dong-Jiunn Jeffery TRUONG	1447	2	. . . attacacatggcatggatgagctctacaaa
BBa_K1159207	Membrane-anchored SpyTag in RFC[25] N-Part	Coding	Dong-Jiunn Jeffery TRUONG	1147	2	. . . attacacatggcatggatgagctctacaaa
BBa_K1825000	UNIK antifreeze protein	Coding	Adam Petersen	324		. . . aagatctccggttgtactttcagcgctaac
BBa_K1825005	nptII	Coding	Jonathan Asmund Arnesen	795	1	. . . ttctatcgccttcttgacgagttcttctga
BBa_K1159015	Membrane-anchored NanoLuc Luciferase in RFC[25] N-Part	Coding	TU Munich 2013	1585		. . . attacacatggcatggatgagctctacaaa
BBa_K1159306	Actin5 Promoter from Physcomitrella patens	Regulatory	Ingmar Polte	1948		. . . ggtggttgttgtgcaggtccgtattaaata
BBa_K1825004	35s CaMV	Regulatory	Jonathan Asmund Arnesen	390	5	. . . atataaggaagttcatttcatttggagagg
BBa_K1825006	35s CaMV + nptII	Composite	Jonathan Asmund Arnesen	1191		. . . ttctatcgccttcttgacgagttcttctga
BBa_K1825008	Stilbene synthase	Coding	Jonathan Asmund Arnesen	1170		. . . acagttgttttacgttcaatggctatttaa

• The parts above have been tested or are intended to be used in Physcomitrella patens.
• To add to this list, please use the category //chassis/eukaryote/ppatens

iGEM Teams that have worked with Physcomitrella patens

• [http://2015.igem.org/Team:UNIK_Copenhagen UNIK_Copenhagen 2015] | Parts
• [http://2013.igem.org/Team:TU-Munich TU-Munich 2013] | Parts
• [http://2011.igem.org/Team:UEA-JIC_Norwich UEA-JIC_Norwich 2011] | Parts

---

Nicotiana tabacum

There are no parts for this table

• The parts above have been tested or are intended to be used in Nicotiana tabacum.
• To add to this list, please use the category //chassis/eukaryote/ntabacum

iGEM Teams that have worked with Nicotiana tabacum

• [http://2015.igem.org/Team:Georgia_State Georgia_State 2015] | Parts
• [http://2015.igem.org/Team:NYMU-Taipei NYMU-Taipei 2015] | Parts
• [http://2014.igem.org/Team:Hannover Hannover 2014] | Parts
• [http://2010.igem.org/Team:Nevada Nevada 2010] | Parts

---

Rhizobium radiobacter/Agrobacterium tumefaciens

Rhizobium radiobacter/Agrobacterium tumefaciens is used as a shuttle chassis to deliver constructs into different plant chassis. "[Rhizobium radiobacter] infects plants through its Ti plasmid. The Ti plasmid inserts a segment of its DNA, termed T-DNA, into the host organisms genome when the T-DNA is successfully integrated this causes the expression of the gene of interest by the plant. The T-DNA can be altered to include any gene construct that you would like, so it can be inserted into the host cells." - [http://2014.igem.org/Team:NRP-UEA-Norwich/Project_System NRP-UEA-Norwich 2014]

iGEM Teams that have worked with Rhizobium radiobacter/Agrobacterium tumefaciens

• [http://2015.igem.org/Team:AHUT_China AHUT_China 2015] | Parts
• [http://2015.igem.org/Team:CAU_China CAU_China 2015] | Parts
• [http://2015.igem.org/Team:Georgia_State Georgia_State 2015] | Parts
• [http://2015.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2015] | Parts
• [http://2015.igem.org/Team:Valencia_UPV Valencia_UPV 2015] | Parts
• [http://2015.igem.org/Team:Waterloo Waterloo 2015] | Parts
• [http://2014.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2014] | Parts
• [http://2014.igem.org/Team:Hannover Hannover 2014] | Parts
• [http://2012.igem.org/Team:Toronto Toronto 2012]
• [http://2012.igem.org/Team:Kyoto Kyoto 2012]
• [http://2010.igem.org/Team:Harvard Harvard 2010]

---

Chlamydomonas reinhardtii

iGEM Teams that have worked with Chlamydomonas reinhardtii

• [http://2011.igem.org/Team:UEA-JIC_Norwich UEA-JIC_Norwich 2011]
• [http://2016.igem.org/Team:USP_UNIFESP-Brazil USP_UNIFESP-Brazil 2016]
• [http://2016.igem.org/Team:Linkoping_Sweden Linkoping_Sweden 2016]
• [http://2016.igem.org/Team:SZU-China SZU-China 2016]
• [http://2016.igem.org/Team:FAFU-CHINA FAFU-CHINA 2016]
• [http://2016.igem.org/Team:Cambridge-JIC Cambridge-JIC 2016]

---

Other Resources

• [http://openplant.org/ OpenPlant]
• Golden Braid
• [http://synbio.tsl.ac.uk/golden-gate/ SynBio @ TSL]