Difference between revisions of "Collections/Plants"
m |
m |
||
Line 8: | Line 8: | ||
− | ===Previous iGEM Plant Projects=== | + | ===Previous iGEM Plant Projects<div class="click_open"><div class="click_icon">▼</div>=== |
+ | <div class="click_content"> | ||
The following table contains iGEM teams that have worked in plant chassis, along with links to their project wiki and Registry parts. This is not an exhaustive list. | The following table contains iGEM teams that have worked in plant chassis, along with links to their project wiki and Registry parts. This is not an exhaustive list. | ||
<html> | <html> | ||
Line 148: | Line 149: | ||
</table> | </table> | ||
</html> | </html> | ||
− | + | </div> | |
+ | </div> | ||
Revision as of 19:18, 5 January 2016
iGEM Teams and Labs are using plant chassis in their synthetic biology projects. They have experimentally validated their parts, documented them on the Registry, and submitted samples to the Registry's repository.
The Registry does not currently have a preferred chassis, standard, or protocol(s), for plant synthetic biology. However, this collection aims to highlight parts meant to be used in the most common plant chassis by previous teams.
Previous iGEM Plant Projects▼
The following table contains iGEM teams that have worked in plant chassis, along with links to their project wiki and Registry parts. This is not an exhaustive list.
Team
Year
Parts
Chassis
Project Title
AHUT_China
2015
Parts
Rehmannia glutinosa
Nutrition Commander:A bio-device can control the APeGs of the plant metabolism
Cambridge-JIC
2015
Parts
Marchantia polymorpha
OpenScope - Open-source, 3D printable fluorescence microscope
CAU_China
2015
Parts
Arabidopsis thaliana
Herbicide vs Herbicide Resistant Gene
Georgia_State
2015
Parts
Nicotiana tabacum
Protein Products from Plants and Pichia: Novel Manufacturing of Analgesics and Cannabinoids
NRP-UEA-Norwich
2015
Parts
Nicotiana benthamiana
Engineering nutrition to increase colonic butryrate
NYMU-Taipei
2015
Parts
Nicotiana tabacum
Fight the Blight
UNIK_Copenhagen
2015
Parts
Physcomitrella patens
SpaceMoss: Using synthetic biology for space exploration
Valencia UPV
2015
Parts
Nicotiana benthamiana
AladDNA
Waterloo
2015
Parts
Arabidopsis thaliana
CRISPieR: re-engineering CRISPR-Cas9 with functional applications in eukaryotic systems
Cambridge-JIC
2014
Parts
Marchantia polymorpha
mösbi - the plant biosensor for everyone
Hannover
2014
Parts
Arabidopsis thaliana, Nicotiana tabacum
Plant against – Removing heavy metals from nature
NRP-UEA-Norwich
2014
Parts
Nicotiana benthamiana
Green Canary: Induction of chromoproteins to signal plant-pathogen interactions
Valencia UPV
2014
Parts
Nicotiana benthamiana
The Sexy Plant
TU-Munich
2013
Parts
Physcomitrella patens
PhyscoFilter – Clean different
Kyoto
2012
Parts
-
Flower Fairy E.coli
UEA-JIC_Norwich
2011
Parts
Physcomitrella patens
The evolution of synthetic biology; The introduction of new photosynthetic eukaryotes as model organisms.
Harvard
2010
Parts
Arabidopsis thaliana
iGarden: an Open Source Toolkit for Plant Engineering
Nevada
2010
Parts
Nicotiana tabacum
Development of Plant Biosensors for Environmental Monitoring Using Nicotiana tabacum Protoplasts as Transgenic Plant Models
Chassis
Nicotiana benthamiana
"N. benthamiana is a widely used experimental plant from the solanaceous group of flowering plants that includes tomatoes, potatoes and capsicums. It is widely used in plant pathology due to the large number of plant pathogens (viruses, bacteria, fungi, oomycetes etc) that can successfully infect it. Of importance to synthetic biologists, N. benthamiana, is easily genetically transformed, regenerated and amenable to facile methods for virus-induced gene silencing and transient protein expression..." - [http://2014.igem.org/Team:NRP-UEA-Norwich/Project_System NRP-UEA-Norwich 2014]
More... Name Description Type Created by length uses seq
BBa_K1467101 GoldenGate compatible 35s Promoter Regulatory Cara Deal 1432 10 . . . acaattacatttacaattatcgatacaatg
BBa_K1467102 GoldenGate compatible BS3 promoter + 5 Regulatory Cara Deal 1032 . . . agtagtcctagttgcacatatatttcaatg
BBa_K1467103 GoldenGate compatible PDF1.2 promotor Regulatory Cara Deal 1050 . . . ttgaaaacaaaatagtaataatcatcaatg
BBa_K1467104 GoldenGate compatible MAS promoter Regulatory Cara Deal 391 . . . ataaccaatctcgatacaccaaatcgaatg
BBa_K1467204 GoldenGate compatible Green Flourescent Protein (GFP) Reporter Cara Deal 730 6 . . . atggacgagctgtacaagtaagcttaataa
BBa_K1554000 TA29 promoter Regulatory Valencia_UPV team members 859 . . . gtttttacttaaagaaattagctaaaaatg
BBa_K1554002 HarFAR Coding Valencia_UPV team members 1365 . . . aggcacttcttggaaaagaaatatcggtga
BBa_K1554001 AtrΔ11 Coding Valencia_UPV team members 981 . . . ggtactgatatgtggggtaggaaacgttga
BBa_K1742002 Dronpa 145N Coding Ivn Casas Rodrigo 693 3 . . . caggctaaacctaaaaagaagagaaaagtt
BBa_K1742006 BxBI Reporter (attB:T35S:attP:OmegaUTR) Reporter Ivn Casas Rodrigo 397 . . . aacaacaaacaaaatacaaacaacaacaac
BBa_K1742008 PhiC31 Reporter attP:T35S:attB:omegaUTR Reporter Ruben Escriba Piera 412 . . . aacaacaaacaaaatacaaacaacaacaac
BBa_K1618028 Chloroplast Transit Peptide Coding Leda Coelewij 177 8 . . . attgctagtaacggaggaagagttcgagca
BBa_K1618037 35s Terminator Terminator Leda Coelewij 212 8 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1467203 GoldenGate compatible Bax - cell death inducer Reporter Cara Deal 589 . . . atctggaagaagatgggttaggcttaataa
BBa_K1467205 AvrBS3 TAL Effector - Induces BS3 Coding Cara Deal 3505 . . . atggaacttctgcctcagtaggcttaataa
BBa_K1554003 EaDAcT Coding Valencia_UPV team members 1092 . . . ttgggtacaagattcgtgtgcggcaattga
BBa_K1554004 Yellow biosafety module for plants Device Valencia_UPV team members 3394 . . . attcctaaaaccaaaatccagtgacctcgc
BBa_K1554005 Blue biosafety module for plants Device Valencia_UPV team members 3364 . . . attcctaaaaccaaaatccagtgacctcgc
BBa_K1742000 Avena sativa LOV2 domain Coding Ruben Escriba Piera 456 . . . attgataaggcagtcgatacttgggtctga
BBa_K1742001 Entertoxin LTB Coding Ruben Escriba Piera 414 . . . gatgagctacatcatcatcatcatcattga
BBa_K1742003 Dronpa 145K Coding Ivn Casas Rodrigo 741 3 . . . gctaagcccaagaagaagaggaaggtgtga
BBa_K1742004 PhiC31 Plant codon optimized Coding Ivn Casas Rodrigo 1836 . . . gtggcagcaccaaaaaaaaagaggaaggtg
BBa_K1742005 BxBI integrase Coding Ivn Casas Rodrigo 1693 . . . gttgagcgattgcacacgggtatgtcttga
BBa_K1742009 35S:BxbI:T35S - 35S:ReporterBxBI::GFP:T35S Device Pilar Baldominos 2964 . . . acacgggggactaaaaaaatggcttcctcc
BBa_K1742011 35S:LacIBDBD-DronpaK:T35S - 35S:DronpaN-VP16:T35S Device Mnica Victoria Gutirrez Salazar 2592 . . . gatgcccttggaattgacgagtacggtggg
BBa_K1742010 35S:LexABD-DronpaK:T35S - 35S:DronpaN-VP16:T35S Device Pilar Baldominos 3176 . . . caggctaaacctaaaaagaagagaaaagtt
BBa_K1742012 35S:Gal4BD-DronpaK:T35S - 35S:DronpaN-VP16:T35S Device Mnica Victoria Gutirrez Salazar 3610 . . . gatgcccttggaattgacgagtacggtggg
BBa_K1618029 Acyltransferase Candidate 1 -Fused to GFP -Expression Construct Composite Leda Coelewij 3134 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618030 Acyltransferase Candidate 2 -Fused to GFP -Expression Construct Composite Leda Coelewij 3407 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618031 Acyltransferase Candidate 3 -Fused to GFP -Expression Construct Composite Leda Coelewij 3485 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618032 Acyltransferase Candidate 4 -Fused to GFP -Expression Construct Composite Leda Coelewij 3659 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618033 Acyltransferase Candidate 1 Expression Construct Composite Leda Coelewij 2396 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618034 Acyltransferase Candidate 2 Expression Construct Composite Leda Coelewij 2669 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618035 Acyltransferase Candidate 3 Expression Construct Composite Leda Coelewij 2747 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1618036 Acyltransferase Candidate 4 Expression Construct Composite Leda Coelewij 2921 . . . ccaaaatccagtactaaaatccagatcgct
BBa_K1742013 35S:PhiC31:T35S - 35S:ReporterPhiC31::GFP:T35S Device Ruben Escriba Piera 5508 . . . ttcctaaaaccaaaatccagtgacctcgct
BBa_K2017000 C-split Cas9 + DnaE C-intein Protein_Domain Monica Victoria Gutierrez Salazar 2358 . . . aaggtgcccaagaagaagaggaaggtgtga
BBa_K2017001 N-split Cas9 + DnaE N-intein Protein_Domain Monica Victoria Gutierrez Salazar 2241 . . . gatttgatgagggtggacaacctccctaac
BBa_K2017007 35s:5'+ Ga20ox consense + SAGTI-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 3057 . . . gttactagatcggcaattccgctagagacc
BBa_K2017008 35s + Ga20ox consense + RSIAT-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 2836 . . . gttactagatcggcaattccgctagagacc
BBa_K2017009 35s + Ga20ox consense + AEK-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 2872 . . . gttactagatcggcaattccgctagagacc
BBa_K2017011 35s:5' + TFL consense + SAGTI-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 3057 . . . gttactagatcggcaattccgctagagacc
BBa_K2017010 35s + Ga20ox consense + RSIAT-TEV-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 2869 . . . gttactagatcggcaattccgctagagacc
BBa_K2017012 35s + TFL consense + RSIAT-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 2836 . . . gttactagatcggcaattccgctagagacc
BBa_K2017013 35s + TFL consense + AEK-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 2872 . . . gttactagatcggcaattccgctagagacc
BBa_K2017014 35s + TFL consense + RSIAT-TEV-Luciferase + Tnos Device Monica Victoria Gutierrez Salazar 2869 . . . gttactagatcggcaattccgctagagacc
BBa_K2269009 35s: PhyB: VP16:NLS: Tnos Composite Jos lvaro Ballesteros Gonzlez 3970 . . . gataaatgcttcaataatgggaccgactcg
BBa_K4799990 pAtMRP3 Regulatory Youran Yao, Wanjun Chen 1651 -1 . . . tattctcctcctccaaaactcgcctccata
BBa_K4213000 Plant Thiamine Pyrophosphate Riboswitch Regulatory Ioannis Retalis 675 -1 . . . tacagccataaaagaagtctttaactcgct
- The parts above have been tested or are intended to be used in Nicotiana benthamiana.
- To add to this list, please use the category //chassis/eukaryote/nbenthamiana
iGEM Teams that have worked with Nicotiana benthamiana
- [http://2015.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2015 Wiki] | Parts
- [http://2015.igem.org/Team:Valencia_UPV Valencia UPV 2015 Wiki] | Parts
- [http://2014.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2014 Wiki] | Parts
- [http://2014.igem.org/Team:Valencia_UPV Valencia UPV 2014 Wiki] | Parts
Marchantia polymorpha
"Marchantia polymorpha is [a] novel, eukaryotic multicellular chassis. Being a liverwort, it is one of the most primitive land plants around. Its small size and relative genetic simplicity make it easy to work with and an exciting new model organism in synthetic biology. Content to grow on agar plates, marchantia can be bioengineered in a standard lab with minimal extra equipment." - [http://2014.igem.org/Team:Cambridge-JIC Cambridge-JIC 2014]
More... Name Description Type Created by length uses seq
BBa_K1484215 nopaline synthase terminator Terminator Salil Bhate 293 10 . . . gttactagatcggcaattccgctagagacc
BBa_K1484000 AsPink chromoprotein in GoldenGate standard Coding Virginie Rutten 721 . . . gctgggtcataattaataagctttgagacc
BBa_K1484001 tsPurple chromoprotein in GoldenGate standard Coding Virginie Rutten 709 . . . ggaaaaagcgacgtaataagctttgagacc
BBa_K1484002 AmajLime chromoprotein in BBa and MoClo standard Coding Virginia Rutten 711 . . . cggtcgtgccgttctaataactttgagacc
BBa_K1484104 N7 nuclear localisation tag Tag Salil Bhate 262 . . . tgatcaagaagaagagtaaggtatgagacc
BBa_K1484106 LTI membrane localisation tag Coding Salil Bhate 238 . . . ttatatcatcaccttttgaggtatgagacc
BBa_K1484214 MpEF1a (Marchantia poylmorpha Elongation Factor 1, PlantSyntax Pro+5U) Regulatory Salil Bhate 1756 . . . ctgcacaaaggttgtcaccaatgtgagacc
BBa_K1484316 Mp Selection Cassette Temporary Salil Bhate 3559 . . . ttactagatcggcaattcgcaaaagtcttc
- The parts above have been tested or are intended to be used in Marchantia polymorpha.
- To add to this list, please use the category //chassis/eukaryote/mpolymorpha
iGEM Teams that have worked with Marchantia polymorpha
- [http://2015.igem.org/Team:Cambridge-JIC Cambridge-JIC Wiki 2015] | Parts
- [http://2014.igem.org/Team:Cambridge-JIC Cambridge-JIC Wiki 2014] | Parts
Arabidopsis thaliana
"Arabidopsis thaliana ... is easy to transform via R. radiobacter and has a short regeneration time." - [http://2014.igem.org/Team:Hannover Hannover 2014]
More... Name Description Type Created by length uses seq
BBa_K1478000 Expa4 plant secretion signal, localizes to extracellular space Protein_Domain Fabian Frmling 60 . . . acatttgttctttttagcctcgccgacgct
BBa_K1478001 Cellulose binding domain Protein_Domain Fabian Frmling 309 3 . . . tacgttgaatttggatttgcgtcaggccgt
BBa_K382000 pORE Open Series Vector with BioBrick MCS (Basta resistance) Plasmid Christina Agapakis 7208 . . . tagaccagttacccagatctgaggcgcgcc
BBa_K382001 pORE Open Serices Vector with BioBrick MCS (Kan resistance) Plasmid_Backbone Christina Agapakis 7451 . . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382003 pORE Expression Series Vector with BioBrick MCS (Kan reistance) Plasmid Christina Agapakis 7969 . . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382002 pORE Expression Series Vector with BioBrick MCS, Basta resistance Plasmid Mara C. Inniss 7786 . . . tagaccagttacccagatctgaggcgcgcc
BBa_K382004 pORE Gus Reporter Series Vector with BiOBrick MCS (Kan resistance) Plasmid_Backbone Christina Agapakis 9295 . . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382005 pORE GFP Reporter Series Vector with BioBrick MCS (Kan resistance) Plasmid_Backbone Christina Agapakis 8203 . . . ccttcttgacgagttcttctgaggcgcgcc
BBa_K382010 amiRNA Construct for lycopene epsilon cyclase (LUT2) RNA Patrick Boyle 413 . . . tttatctttatttaaggcatcgccatgggg
BBa_K382012 amiRNA Construct for lycopene beta cyclase (LYC) RNA Christina Agapakis 413 . . . tttatctttatttaaggcatcgccatgggg
BBa_K382011 amiRNA Construct for carotene beta-ring hydroxylase (BETA-OHASE 1) RNA Mara C. Inniss 413 . . . tttatctttatttaaggcatcgccatgggg
BBa_K382014 ihpRNA construct against Arabidopsis Bet v 1 allergen RNA Christina Agapakis 1288 . . . gacgtctacctcaatctcctcttctatcat
BBa_K382020 Arabidopsis optimized Brazzein Coding Patrick Boyle 165 . . . ctccagtgtatctgtgattattgtgagtat
BBa_K382021 Arabidopsis optimized Miraculin Coding Patrick Boyle 660 . . . gctttcgagttcaacaaaaccgtttatttc
BBa_K382015 ihpRNA construct against Arabidopsis LTP Allergen RNA Christina Agapakis 1372 . . . caagcatgccaacttcatcactccagccat
BBa_K382022 pENTCUP2 plant specific promoter Regulatory Patrick Boyle 503 . . . ctcatcatcctcacctcaaaacccaccgga
BBa_K382017 ihpRNA construct against Arabidopsis LTP Allergen RNA Christina Agapakis 424 . . . tttatctttatttaaggcatcgccatgggg
BBa_K382018 PDK intron Intermediate Christina Agapakis 793 . . . attgattacagttgggaaattgggttcgaa
BBa_K382019 ihpRNA construct against Arabidopsis Ger3 allergen RNA Christina Agapakis 1429 . . . atcatcttcatactagtagcggccgctgca
BBa_K382034 Act2pLacO (Actin promoter + 2x LacO) Regulatory Mara C. Inniss 1241 . . . ctctttttgtgtgtttgcagctcataaaaa
BBa_K382025 Arabidopsis optimized Miraculin with StrepII N-terminus tag Coding Patrick Boyle 696 . . . gctttcgagttcaacaaaaccgtttatttc
BBa_K382026 Arabidopsis optimized Brazzein with StrepII N-terminus Coding Patrick Boyle 201 . . . ctccagtgtatctgtgattattgtgagtat
BBa_K382040 Arabidopsis optimized Miraculin+2xYFP Coding Mara C. Inniss 2160 . . . gatgaactatacaaaggttctggtaccgca
BBa_K382041 Arabidopsis optimized Brazzein+2xYFP Coding Mara C. Inniss 1665 . . . gatgaactatacaaaggttctggtaccgca
BBa_K382027 Arabidopsis optimized Miraculin with StrepII C-terminus tag Coding Patrick Boyle 696 . . . agtgcttggtctcacccacaattcgaaaag
BBa_K382028 Arabidopsis optimized Brazzein with StrepII C-terminus Coding Patrick Boyle 201 . . . agtgcttggtctcacccacaattcgaaaag
BBa_K1478002 Top metal binding protein. Binds zinc, arsenic, copper and cadmium. Coding Fabian Frmling 909 . . . tgcggatcatcttgcagctgtaagtaataa
BBa_K1982002 Prokaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor) Coding Zexu Li 1854 . . . actacaagtttgggaaaaaatggttgcaaa
BBa_K1982003 CIBN(the N-terminal fragment of CIB1) Coding Zexu Li 612 . . . ccatacgatgttccagattacgcttaataa
BBa_K1982010 CRY2-VP64(Eukaryotic LACE system) Coding Zexu Li 2100 . . . gactacaaggacgacgacgacaaataataa
BBa_K1982009 Eukaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor) Coding Zexu Li 1848 . . . actacaagtttgggaaaaaatggttgcaaa
BBa_K4213000 Plant Thiamine Pyrophosphate Riboswitch Regulatory Ioannis Retalis 675 -1 . . . tacagccataaaagaagtctttaactcgct
- The parts above have been tested or are intended to be used in Arabidopsis thaliana.
- To add to this list, please use the category //chassis/eukaryote/athaliana
iGEM Teams that have worked with Arabidopsis thaliana
- [http://2015.igem.org/Team:CAU_China CAU_China 2015] | Parts
- [http://2015.igem.org/Team:Waterloo Waterloo 2015] | Parts
- [http://2014.igem.org/Team:Hannover Hannover 2014] | Parts
- [http://2010.igem.org/Team:Harvard Harvard 2010] | Parts
Physcomitrella patens
"The moss Physcomitrella patens belongs to the land plant division Bryophyta, which are one of the earliest representatives of the land plants (Embryophyta) having evolved from green algae about 470 million years ago during the early Paleozoic...The general organization of plant tissue into roots, stem and leaves is found in a much more basic version in mosses. They show a differentiated stem with simple leaves, usually only a single layer of cells thick and lacking veins, that are used to absorb water and nutrients. Instead of roots they have similar threadlike rhizoids. These have a primary function as mechanical attachment rather than extraction of soil nutrients.
However different mosses and vascular plants are because of the early diverge of the evolutionary lineages, they share fundamental genetic and physiological processes. Here researchers chose Physcomitrella patens as a model organism with a genome size of about 450 Mb along 27 chromosomes that is highly similar to other land plants in both exon-intron-structure and codon usage." - [http://2013.igem.org/Team:TU-Munich TU-Munich 2013]
More... Name Description Type Created by length uses seq
BBa_K1159000 Erythromycin Esterase Type II (EreB) in RFC[25] Coding Louise FUNKE 1254 2 . . . aagtcatctgtatctgaggtcgtttatgaa
BBa_K1159001 NanoLuc Luciferase in RFC[25] Coding TU Munich 2013 510 4 . . . ggttggagactttgcgagagaatccttgct
BBa_K1159003 Engineered Fluorescein-Binding Anticalin FluA (triple mutant variant) in RFC[25] Coding TU Munich 2013 522 1 . . . ttctctgaagccgcctgcaaggtcaacaat
BBa_K1159010 Secretory NanoLuc Luciferase (SERK-SigP_nLuc) in RFC[25] N-Part Coding TU Munich 2013 616 . . . ggttggagactttgcgagagaatccttgct
BBa_K1159303 Signal Peptide of SERK Receptor from Physcomitrella patens in RFC[25] Protein_Domain TU Munich 2013 100 9 . . . tctaacgctgagggtgatgctcttaacacc
BBa_K1159304 Signal Peptide of Ig Kappa chain from Mus musculus in RFC[25] N-part Protein_Domain TU Munich 2013 67 6 . . . ttgctttgggttccaggatctaccggcgat
BBa_K1159305 Transmembrane domain of SERK Receptor from Physcomitrella patens in RFC[25] Protein_Domain TU Munich 2013 186 2 . . . tggtggagaagaagaaggcctattgaggct
BBa_K1159307 35S Terminator of Cauliflower Mosaic Virus (CaMV) Terminator TU Munich 2013 217 9 . . . tctaattcctaaaaccaaaatccagtgacc
BBa_K1159308 Neomycin phosphotransferase II (nptII) plant expression cassette for G418 resistance Device Dong-Jiunn Jeffery TRUONG 1517 1 . . . tactagatcgggcctcctgtcaagcttgat
BBa_K1159006 Secretory NanoLuc Luciferase (IgKappa-SigP_nLuc) in RFC[25] N-Part Coding TU Munich 2013 583 3 . . . ggttggagactttgcgagagaatccttgct
BBa_K1159315 TMD of SERK Receptor from Physcomitrella patens with C-terminal GFP fusion in RFC[25] Coding TU Munich 2013 933 1 . . . attacacatggcatggatgagctctacaaa
BBa_K1159316 SERK-Receptor TMD with C-terminal GFP and N-terminal Strep-tag II TEV-site linker in RFC[25] Coding TU Munich 2013 996 8 . . . attacacatggcatggatgagctctacaaa
BBa_K1159314 TMD with N-terminal Signal Peptide of SERK Receptor from ''P. patens'' in RFC[25] N-Part Coding Dong-Jiunn Jeffery TRUONG 292 1 . . . tggtggagaagaagaaggcctattgaggct
BBa_K1159120 Red light triggered TEV Protease with FRET Reporter for plants translation unit (PhyB/PIF6 version) Translational_Unit Dong-Jiunn Jeffery TRUONG 6751 . . . attaccctgggtatggatgagctgtataaa
BBa_K1159202 Secretory SpyCatcher (IgKappa-SigP_SpyCatcher) in RFC[25] N-Part Coding Dong-Jiunn Jeffery TRUONG 412 1 . . . ggcaaagcaactaaaggtgacgctcatatt
BBa_K1159203 Secretory SpyTag (IgKappa-SigP_SpyTag) in RFC[25] N-Part Coding Dong-Jiunn Jeffery TRUONG 112 1 . . . gtcatggttgatgcttacaagccaactaag
BBa_K1159204 Secretory SpyCatcher (SERK-SigP_SpyCatcher) in RFC[25] N-Part Coding Dong-Jiunn Jeffery TRUONG 445 1 . . . ggcaaagcaactaaaggtgacgctcatatt
BBa_K1159205 Secretory SpyTag (SERK-SigP_SpyTag) in RFC[25] N-Part Coding Dong-Jiunn Jeffery TRUONG 145 1 . . . gtcatggttgatgcttacaagccaactaag
BBa_K1159206 Membrane-anchored SpyCatcher in RFC[25] N-Part Coding Dong-Jiunn Jeffery TRUONG 1447 2 . . . attacacatggcatggatgagctctacaaa
BBa_K1159207 Membrane-anchored SpyTag in RFC[25] N-Part Coding Dong-Jiunn Jeffery TRUONG 1147 2 . . . attacacatggcatggatgagctctacaaa
BBa_K1825000 UNIK antifreeze protein Coding Adam Petersen 324 . . . aagatctccggttgtactttcagcgctaac
BBa_K1825005 nptII Coding Jonathan Asmund Arnesen 795 1 . . . ttctatcgccttcttgacgagttcttctga
BBa_K1159015 Membrane-anchored NanoLuc Luciferase in RFC[25] N-Part Coding TU Munich 2013 1585 . . . attacacatggcatggatgagctctacaaa
BBa_K1159306 Actin5 Promoter from Physcomitrella patens Regulatory Ingmar Polte 1948 . . . ggtggttgttgtgcaggtccgtattaaata
BBa_K1825004 35s CaMV Regulatory Jonathan Asmund Arnesen 390 5 . . . atataaggaagttcatttcatttggagagg
BBa_K1825006 35s CaMV + nptII Composite Jonathan Asmund Arnesen 1191 . . . ttctatcgccttcttgacgagttcttctga
BBa_K1825008 Stilbene synthase Coding Jonathan Asmund Arnesen 1170 . . . acagttgttttacgttcaatggctatttaa
- The parts above have been tested or are intended to be used in Physcomitrella patens.
- To add to this list, please use the category //chassis/eukaryote/ppatens
iGEM Teams that have worked with Physcomitrella patens
- [http://2015.igem.org/Team:UNIK_Copenhagen UNIK_Copenhagen 2015] | Parts
- [http://2013.igem.org/Team:TU-Munich TU-Munich 2013] | Parts
- [http://2011.igem.org/Team:UEA-JIC_Norwich UEA-JIC_Norwich 2011] | Parts
Nicotiana tabacum
There are no parts for this table
- The parts above have been tested or are intended to be used in Nicotiana tabacum.
- To add to this list, please use the category //chassis/eukaryote/ntabacum
iGEM Teams that have worked with Nicotiana tabacum
- [http://2015.igem.org/Team:Georgia_State Georgia_State 2015] | Parts
- [http://2015.igem.org/Team:NYMU-Taipei NYMU-Taipei 2015] | Parts
- [http://2014.igem.org/Team:Hannover Hannover 2014] | Parts
- [http://2010.igem.org/Team:Nevada Nevada 2010] | Parts
Rhizobium radiobacter/Agrobacterium tumefaciens
Rhizobium radiobacter/Agrobacterium tumefaciens is used as a shuttle chassis to deliver constructs into different plant chassis. "[Rhizobium radiobacter] infects plants through its Ti plasmid. The Ti plasmid inserts a segment of its DNA, termed T-DNA, into the host organisms genome when the T-DNA is successfully integrated this causes the expression of the gene of interest by the plant. The T-DNA can be altered to include any gene construct that you would like, so it can be inserted into the host cells." - [http://2014.igem.org/Team:NRP-UEA-Norwich/Project_System NRP-UEA-Norwich 2014]
iGEM Teams that have worked with Rhizobium radiobacter/Agrobacterium tumefaciens
- [http://2015.igem.org/Team:AHUT_China AHUT_China 2015] | Parts
- [http://2015.igem.org/Team:CAU_China CAU_China 2015] | Parts
- [http://2015.igem.org/Team:Georgia_State Georgia_State 2015] | Parts
- [http://2015.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2015] | Parts
- [http://2015.igem.org/Team:Valencia_UPV Valencia_UPV 2015] | Parts
- [http://2015.igem.org/Team:Waterloo Waterloo 2015] | Parts
- [http://2014.igem.org/Team:NRP-UEA-Norwich NRP-UEA-Norwich 2014] | Parts
- [http://2014.igem.org/Team:Hannover Hannover 2014] | Parts
- [http://2012.igem.org/Team:Toronto Toronto 2012]
- [http://2012.igem.org/Team:Kyoto Kyoto 2012]
- [http://2010.igem.org/Team:Harvard Harvard 2010]
Chlamydomonas reinhardtii
iGEM Teams that have worked with Chlamydomonas reinhardtii
- [http://2011.igem.org/Team:UEA-JIC_Norwich UEA-JIC_Norwich 2011]
Other Resources
- [http://openplant.org/ OpenPlant]
- Golden Braid
- [http://synbio.tsl.ac.uk/golden-gate/ SynBio @ TSL]
The following table contains iGEM teams that have worked in plant chassis, along with links to their project wiki and Registry parts. This is not an exhaustive list.
Team | Year | Parts | Chassis | Project Title |
---|---|---|---|---|
AHUT_China | 2015 | Parts | Rehmannia glutinosa | Nutrition Commander:A bio-device can control the APeGs of the plant metabolism |
Cambridge-JIC | 2015 | Parts | Marchantia polymorpha | OpenScope - Open-source, 3D printable fluorescence microscope |
CAU_China | 2015 | Parts | Arabidopsis thaliana | Herbicide vs Herbicide Resistant Gene |
Georgia_State | 2015 | Parts | Nicotiana tabacum | Protein Products from Plants and Pichia: Novel Manufacturing of Analgesics and Cannabinoids |
NRP-UEA-Norwich | 2015 | Parts | Nicotiana benthamiana | Engineering nutrition to increase colonic butryrate |
NYMU-Taipei | 2015 | Parts | Nicotiana tabacum | Fight the Blight |
UNIK_Copenhagen | 2015 | Parts | Physcomitrella patens | SpaceMoss: Using synthetic biology for space exploration |
Valencia UPV | 2015 | Parts | Nicotiana benthamiana | AladDNA |
Waterloo | 2015 | Parts | Arabidopsis thaliana | CRISPieR: re-engineering CRISPR-Cas9 with functional applications in eukaryotic systems |
Cambridge-JIC | 2014 | Parts | Marchantia polymorpha | mösbi - the plant biosensor for everyone |
Hannover | 2014 | Parts | Arabidopsis thaliana, Nicotiana tabacum | Plant against – Removing heavy metals from nature |
NRP-UEA-Norwich | 2014 | Parts | Nicotiana benthamiana | Green Canary: Induction of chromoproteins to signal plant-pathogen interactions |
Valencia UPV | 2014 | Parts | Nicotiana benthamiana | The Sexy Plant |
TU-Munich | 2013 | Parts | Physcomitrella patens | PhyscoFilter – Clean different |
Kyoto | 2012 | Parts | - | Flower Fairy E.coli |
UEA-JIC_Norwich | 2011 | Parts | Physcomitrella patens | The evolution of synthetic biology; The introduction of new photosynthetic eukaryotes as model organisms. |
Harvard | 2010 | Parts | Arabidopsis thaliana | iGarden: an Open Source Toolkit for Plant Engineering |
Nevada | 2010 | Parts | Nicotiana tabacum | Development of Plant Biosensors for Environmental Monitoring Using Nicotiana tabacum Protoplasts as Transgenic Plant Models |
There are no parts for this table