Promoters/Catalog/Ecoli/Positive
All the promoters on this page are E. coli promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.
Contents
Positively regulated E. coli σ70 promoters
This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I0500 | Inducible pBad/araC promoter | . . . gtttctccatacccgtttttttgggctagc | 1210 | 48514 | In stock | ||
| BBa_I1051 | Lux cassette right promoter | . . . tgttatagtcgaatacctctggcggtgata | 68 | 1735 | In stock | ||
| BBa_I12006 | Modified lamdba Prm promoter (repressed by 434 cI) | . . . attacaaactttcttgtatagatttaacgt | 82 | 5124 | In stock | ||
| BBa_I12007 | Modified lambda Prm promoter (OR-3 obliterated) | . . . atttataaatagtggtgatagatttaacgt | 82 | 2240 | In stock | ||
| BBa_I12036 | Modified lamdba Prm promoter (cooperative repression by 434 cI) | . . . tttcttgtatagatttacaatgtatcttgt | 91 | 2153 | In stock | ||
| BBa_I12040 | Modified lambda P(RM) promoter: -10 region from P(L) and cooperatively repressed by 434 cI | . . . tttcttgtagatacttacaatgtatcttgt | 91 | 2572 | In stock | ||
| BBa_I12210 | plac Or2-62 (positive) | . . . ctttatgcttccggctcgtatgttgtgtgg | 70 | 5361 | In stock | ||
| BBa_I13406 | Pbad/AraC with extra REN sites | . . . ttttttgggctagcaagctttaccatggat | 1226 | 1484 | Not in stock | ||
| BBa_I13453 | Pbad promoter | . . . tgtttctccataccgtttttttgggctagc | 130 | 10492 | In stock | ||
| BBa_I14015 | P(Las) TetO | . . . ttttggtacactccctatcagtgatagaga | 170 | 1524 | In stock | ||
| BBa_I14016 | P(Las) CIO | . . . ctttttggtacactacctctggcggtgata | 168 | 1523 | In stock | ||
| BBa_I14017 | P(Rhl) | . . . tacgcaagaaaatggtttgttatagtcgaa | 51 | 13707 | In stock | ||
| BBa_I721001 | Lead Promoter | . . . gaaaaccttgtcaatgaagagcgatctatg | 94 | 4214 | It's complicated | ||
| BBa_I723020 | Pu | . . . ctcaaagcgggccagccgtagccgttacgc | 320 | 2771 | It's complicated | ||
| BBa_I731004 | FecA promoter | . . . ttctcgttcgactcatagctgaacacaaca | 90 | 814 | Not in stock | ||
| BBa_I739104 | Double Promoter (LuxR/HSL, positive / P22 cII, negative) | . . . gttctttaattatttaagtgttctttaatt | 101 | 3261 | Not in stock | ||
| BBa_I739105 | Double Promoter (LuxR/HSL, positive / cI, negative) | . . . cgtgcgtgttgataacaccgtgcgtgttga | 99 | 3259 | Not in stock | ||
| BBa_I741018 | Right facing promoter (for xylF) controlled by xylR and CRP-cAMP | . . . gttacgtttatcgcggtgattgttacttat | 221 | 3814 | In stock | ||
| BBa_I741019 | Right facing promoter (for xylA) controlled by xylR and CRP-cAMP | . . . gcaaaataaaatggaatgatgaaactgggt | 131 | 1268 | Not in stock | ||
| BBa_I741020 | promoter to xylF without CRP and several binding sites for xylR | . . . gttacgtttatcgcggtgattgttacttat | 191 | 1227 | Not in stock | ||
| BBa_I741021 | promoter to xylA without CRP and several binding sites for xylR | . . . atttcacactgctattgagataattcacaa | 87 | 1248 | Not in stock | ||
| BBa_I746104 | P2 promoter in agr operon from S. aureus | . . . agattgtactaaatcgtataatgacagtga | 96 | 1753 | In stock | ||
| BBa_I746360 | PF promoter from P2 phage | . . . gacatctccggcgcaactgaaaataccact | 91 | 1290 | In stock | ||
| BBa_I746361 | PO promoter from P2 phage | . . . gaggatgcgcatcgtcgggaaactgatgcc | 92 | 1522 | In stock | ||
| BBa_I746362 | PP promoter from P2 phage | . . . catccgggactgatggcggaggatgcgcat | 92 | 1491 | It's complicated | ||
| BBa_I746363 | PV promoter from P2 phage | . . . aacttttatatattgtgcaatctcacatgc | 91 | 1490 | Not in stock | ||
| BBa_I746364 | Psid promoter from P4 phage | . . . tgttgtccggtgtacgtcacaattttctta | 93 | 1495 | In stock | ||
| BBa_I746365 | PLL promoter from P4 phage | . . . gtctgctgaaaatattcacaaaataaagcg | 92 | 1606 | In stock | ||
| BBa_I751501 | plux-cI hybrid promoter | . . . gtgttgatgcttttatcaccgccagtggta | 66 | 1222 | Not in stock | ||
| BBa_I751502 | plux-lac hybrid promoter | . . . agtgtgtggaattgtgagcggataacaatt | 74 | 4200 | Not in stock | ||
| BBa_I760005 | Cu-sensitive promoter | atgacaaaattgtcat | 16 | 12396 | Not in stock | ||
| BBa_I761011 | CinR, CinL and glucose controlled promotor | . . . acatcttaaaagttttagtatcatattcgt | 295 | 2080 | It's complicated | ||
| BBa_I765001 | UV promoter | . . . ctgaaagcgcataccgctatggagggggtt | 76 | 1381 | In stock | ||
| BBa_I765007 | Fe and UV promoters | . . . ctgaaagcgcataccgctatggagggggtt | 1128 | 1238 | It's complicated | ||
| BBa_J01005 | pspoIIE promoter (spo0A J01004, positive) | . . . aacgaatataacaggtgggagatgagagga | 206 | 1794 | Not in stock | ||
| BBa_J03007 | Maltose specific promotor | . . . aatatttcctcattttccacagtgaagtga | 206 | 1442 | Not in stock | ||
| BBa_J06403 | RhIR promoter repressible by CI | . . . tacgcaagaaaatggtttgttatagtcgaa | 51 | 1464 | In stock | ||
| BBa_J07007 | ctx promoter | . . . atttaattgttttgatcaattatttttctg | 145 | 2141 | Not in stock | ||
| BBa_J102001 | Reverse Lux Promoter | . . . tcttgcgtaaacctgtacgatcctacaggt | 55 | 1785 | It's complicated | ||
| BBa_J13210 | pOmpR dependent POPS producer | . . . attattctgcatttttggggagaatggact | 245 | 1424 | In stock | ||
| BBa_J15502 | copA promoter | . . . ccttgctggaaggtttaacctttatcacag | 287 | 1367 | Not in stock | ||
| BBa_J16101 | BanAp - Banana-induced Promoter | atgatgtgtccatggatta | 19 | 1545 | Not in stock | ||
| BBa_J16105 | HelPp - "Help" Dependant promoter | atgatagacgatgtgcggacaacgtg | 26 | 1316 | Not in stock | ||
| BBa_J45503 | hybB Cold Shock Promoter | . . . cattagccgccaccatggggttaagtagca | 393 | 8199 | Not in stock | ||
| BBa_J58100 | AND-type promoter synergistically activated by cI and CRP | . . . atttataaatagtggtgatagatttaacgt | 106 | 3577 | It's complicated | ||
| BBa_J61051 | [Psal1] | . . . ataaagccatcacgagtaccatagaggatc | 1268 | 32679 | In stock | ||
| BBa_J61054 | [HIP-1] Promoter | . . . tttgtcttttcttgcttaataatgttgtca | 53 | 1160 | Not in stock | ||
| BBa_J61055 | [HIP-1fnr] Promoter | . . . tttgtcttttcttgcttaataatgttgtca | 53 | 840 | Not in stock | ||
| BBa_J64000 | rhlI promoter | . . . atcctcctttagtcttccccctcatgtgtg | 72 | 1470 | Not in stock | ||
| BBa_J64010 | lasI promoter | . . . taaaattatgaaatttgcataaattcttca | 53 | 3970 | Not in stock | ||
| BBa_J64712 | LasR/LasI Inducible & RHLR/RHLI repressible Promoter | . . . gaaatctggcagtttttggtacacgaaagc | 157 | 1866 | Not in stock | ||
| BBa_J64800 | RHLR/RHLI Inducible & LasR/LasI repressible Promoter | . . . tgccagttctggcaggtctaaaaagtgttc | 53 | 1631 | Not in stock | ||
| BBa_J64804 | The promoter region (inclusive of regulator binding sites) of the B. subtilis RocDEF operon | . . . cacagaacttgcatttatataaagggaaag | 135 | 2065 | Not in stock | ||
| BBa_K091107 | pLux/cI Hybrid Promoter | . . . acaccgtgcgtgttgatatagtcgaataaa | 57 | 4524 | It's complicated | ||
| BBa_K091117 | pLas promoter | . . . aaaattatgaaatttgtataaattcttcag | 126 | 3108 | It's complicated | ||
| BBa_K091143 | pLas/cI Hybrid Promoter | . . . ggttctttttggtacctctggcggtgataa | 164 | 1530 | It's complicated | ||
| BBa_K091146 | pLas/Lux Hybrid Promoter | . . . tgtaggatcgtacaggtataaattcttcag | 126 | 4661 | In stock | ||
| BBa_K091156 | pLux | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 1608 | Not in stock | ||
| BBa_K091157 | pLux/Las Hybrid Promoter | . . . ctatctcatttgctagtatagtcgaataaa | 55 | 2254 | Not in stock | ||
| BBa_K100000 | Natural Xylose Regulated Bi-Directional Operator | . . . gttacgtttatcgcggtgattgttacttat | 303 | 1977 | It's complicated | ||
| BBa_K100001 | Edited Xylose Regulated Bi-Directional Operator 1 | . . . gttacgtttatcgcggtgattgttacttat | 303 | 2220 | It's complicated | ||
| BBa_K100002 | Edited Xylose Regulated Bi-Directional Operator 2 | . . . gttacgtttatcgcggtgattgttacttat | 303 | 2062 | It's complicated | ||
| BBa_K112118 | rrnB P1 promoter | . . . ataaatgcttgactctgtagcgggaaggcg | 503 | 2103 | In stock | ||
| BBa_K112320 | {< ftsAZ promoter >} in BBb format | . . . aaaactggtagtaggactggagattggtac | 773 | 1938 | It's complicated | ||
| BBa_K112322 | {Pdps} in BBb format | . . . gggacacaaacatcaagaggatatgagatt | 348 | 1848 | It's complicated | ||
| BBa_K112402 | promoter for FabA gene - Membrane Damage and Ultrasound Senstitive | . . . gtcaaaatgaccgaaacgggtggtaacttc | 256 | 4451 | It's complicated | ||
| BBa_K112405 | Promoter for CadA and CadB genes | . . . agtaatcttatcgccagtttggtctggtca | 370 | 4281 | It's complicated | ||
| BBa_K112406 | cadC promoter | . . . agtaatcttatcgccagtttggtctggtca | 2347 | 1785 | It's complicated | ||
| BBa_K112701 | hns promoter | . . . aattctgaacaacatccgtactcttcgtgc | 669 | 2559 | Not in stock | ||
| BBa_K112900 | Pbad | . . . tcgataagattaccgatcttacctgaagct | 1225 | 1439 | Not in stock | ||
| BBa_K116001 | nhaA promoter, that can be regulated by pH and nhaR protein. | . . . cgatctattcacctgaaagagaaataaaaa | 274 | 5780 | It's complicated | ||
| BBa_K116401 | external phosphate sensing promoter | . . . attaatgatcgcaacctatttattacaaca | 492 | 1367 | In stock | ||
| BBa_K116500 | OmpF promoter that is activated or repressesed by OmpR according to osmolarity. | . . . aaacgttagtttgaatggaaagatgcctgc | 126 | 1250 | It's complicated | ||
| BBa_K116603 | pRE promoter from λ phage | . . . tttgcacgaaccatatgtaagtatttcctt | 48 | 1264 | It's complicated | ||
| BBa_K117002 | LsrA promoter (indirectly activated by AI-2) | . . . taacacttatttaattaaaaagaggagaaa | 102 | 7117 | In stock | ||
| BBa_K118011 | PcstA (glucose-repressible promoter) | . . . tagaaacaaaatgtaacatctctatggaca | 131 | 12306 | In stock | ||
| BBa_K121011 | promoter (lacI regulated) | . . . acaggaaacagctatgaccatgattacgcc | 232 | 1333 | Not in stock | ||
| BBa_K135000 | pCpxR (CpxR responsive promoter) | . . . agcgacgtctgatgacgtaatttctgcctc | 55 | 14852 | It's complicated | ||
| BBa_K136010 | fliA promoter | . . . gttcactctataccgctgaaggtgtaatgg | 345 | 2453 | It's complicated | ||
| BBa_K145150 | Hybrid promoter: HSL-LuxR activated, P22 C2 repressed | . . . tagtttataatttaagtgttctttaatttc | 66 | 2130 | It's complicated | ||
| BBa_K1520010 | Prlux-rbs-rfp-Ter | . . . caccttcgggtgggcctttctgcgtttata | 932 | 1622 | It's complicated | ||
| BBa_K1520515 | MC7-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter. | . . . caccttcgggtgggcctttctgcgtttata | 3611 | 1361 | Not in stock | ||
| BBa_K1520516 | MC31-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter | . . . caccttcgggtgggcctttctgcgtttata | 3610 | 1362 | Not in stock | ||
| BBa_K1660005 | RFP controlled by the PompR promoter | . . . caccttcgggtgggcctttctgcgtttata | 978 | 10915 | In stock | ||
| BBa_K180000 | Hybrid promoter (trp & lac regulated -- tac pR) | . . . cgagcacttcaccaacaaggaccatagcat | 1447 | 2657 | In stock | ||
| BBa_K180002 | tac pR testing plasmid (GFP) | . . . caccttcgggtgggcctttctgcgtttata | 2330 | 1691 | Not in stock | ||
| BBa_K180003 | PTAC testing plasmid (GFP) - basic | . . . catggcatggatgaactatacaaataataa | 2173 | 1658 | Not in stock | ||
| BBa_K180004 | Game of Life - Primary plasmid | . . . caccttcgggtgggcctttctgcgtttata | 3138 | 2156 | Not in stock | ||
| BBa_K180005 | GoL - Primary plasmid (part 1)/RPS - Paper primary plasmid (part 1) [LuxR generator] | . . . caccttcgggtgggcctttctgcgtttata | 979 | 1517 | It's complicated | ||
| BBa_K180006 | Game of Life - Primary plasmid (part 2) [lux pR, GFP and LacI generator] | . . . caccttcgggtgggcctttctgcgtttata | 2151 | 1500 | Not in stock | ||
| BBa_K180007 | Game of Life - Secondary plasmid [tac pR, LuxI generator] | . . . caccttcgggtgggcctttctgcgtttata | 2195 | 1479 | Not in stock | ||
| BBa_K180010 | Rock-paper-scissors - Rock primary plasmid | . . . caccttcgggtgggcctttctgcgtttata | 3888 | 2311 | Not in stock | ||
| BBa_K180011 | Rock - Primary plasmid (part 1) [RhlR generator] | . . . caccttcgggtgggcctttctgcgtttata | 927 | 1448 | Not in stock | ||
| BBa_K180012 | Rock - Primary plasmid (part 2) [tac pR, mCherry and LasI generator] | . . . caccttcgggtgggcctttctgcgtttata | 2953 | 1498 | Not in stock | ||
| BBa_K180013 | Rock-paper-scissors - Rock secondary plasmid [rhl pR, LacI generator] | . . . caccttcgggtgggcctttctgcgtttata | 1369 | 1469 | Not in stock | ||
| BBa_K180014 | Rock-paper-scissors - Paper primary plasmid | . . . caccttcgggtgggcctttctgcgtttata | 3952 | 2303 | Not in stock | ||
| BBa_K180015 | Paper - Primary plasmid (part 2) [tac pR, GFP and RhlI generator] | . . . caccttcgggtgggcctttctgcgtttata | 2965 | 1488 | Not in stock | ||
| BBa_K180016 | Rock-paper-scissors - Paper secondary plasmid [lux pR, LacI generator] | . . . caccttcgggtgggcctttctgcgtttata | 1371 | 1393 | Not in stock | ||
| BBa_K180017 | Rock-paper-scissors - Scissors primary plasmid | . . . caccttcgggtgggcctttctgcgtttata | 3858 | 2321 | Not in stock | ||
| BBa_K180018 | Scissors - Primary plasmid (part 1) [LasR generator] | . . . caccttcgggtgggcctttctgcgtttata | 921 | 1452 | Not in stock | ||
| BBa_K180019 | Scissors - Primary plasmid (part 2) [tac pR, mBanana and LuxI generator] | . . . caccttcgggtgggcctttctgcgtttata | 2929 | 1503 | Not in stock | ||
| BBa_K180020 | Rock-paper-scissors - Scissors secondary plasmid [las pR, LacI generator] | . . . caccttcgggtgggcctttctgcgtttata | 1473 | 1397 | Not in stock | ||
| BBa_K206000 | pBAD strong | . . . tgtttctccataccgtttttttgggctagc | 130 | 13743 | In stock | ||
| BBa_K206001 | pBAD weak | . . . tgtttctccataccgtttttttgggctagc | 130 | 6382 | In stock | ||
| BBa_K2558001 | lux pR-HS | . . . caagaaaatggtttgttactttcgaataaa | 55 | 15965 | It's complicated | ||
| BBa_K259005 | AraC Rheostat Promoter | . . . ttttatcgcaactctctactgtttctccat | 340 | 1934 | It's complicated | ||
| BBa_K259007 | AraC Promoter fused with RBS | . . . gtttctccattactagagaaagaggggaca | 360 | 6988 | It's complicated | ||
| BBa_K266000 | PAI+LasR -> LuxI (AI) | . . . caccttcgggtgggcctttctgcgtttata | 963 | 2325 | It's complicated | ||
| BBa_K266005 | PAI+LasR -> LasI & AI+LuxR --| LasI | . . . aataactctgatagtgctagtgtagatctc | 819 | 1498 | It's complicated | ||
| BBa_K266006 | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | . . . caccttcgggtgggcctttctgcgtttata | 1705 | 1471 | It's complicated | ||
| BBa_K266007 | Complex QS -> LuxI & LasI circuit | . . . caccttcgggtgggcctttctgcgtttata | 2676 | 1513 | It's complicated | ||
| BBa_K3205003 | luxPR_3A | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11136 | Not in stock | ||
| BBa_K3205004 | luxPR_3G | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11193 | Not in stock | ||
| BBa_K3205005 | luxPR_4G12T | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11309 | Not in stock | ||
| BBa_K3254014 | Optimized Ptac promoter | . . . taatgtgtggaattgtgagcgctcacaatt | 56 | 5498 | Not in stock | ||
| BBa_K3254015 | Mutant Ptac promoter No.1 | . . . tactgtgtggaattgtgagcgctcacaatt | 56 | 4887 | Not in stock | ||
| BBa_K3254016 | Mutant Ptac promoter No.2 | . . . taatgtgtggaattgtgagcgctcacaatt | 56 | 5435 | Not in stock | ||
| BBa_K3254017 | Mutant Ptac promoter No.3 | . . . tactgtgtggaattgtgagcgctcacaatt | 56 | 4894 | Not in stock | ||
| BBa_K338029 | +OmpR, +(CinR-HSL) Double Promoter | . . . tgctttccacgaacttgaaaacgctggagg | 347 | 1440 | It's complicated | ||
| BBa_K427003 | Pm promoter of Mu bacteriophage | . . . tcctcaatatcctgtgatgaataaccgtac | BBa_K427002 | 71 | 2213 | It's complicated | |
| BBa_K427004 | Pmom promoter of Mu bacteriophage | . . . tttttaagatagtggcgaattgatgcaaag | BBa_K427001 | 79 | 2244 | It's complicated | |
| BBa_K658006 | position 3 mutated promoter lux pR-3 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3218 | Not in stock | ||
| BBa_K658007 | position 5 mutated promoter lux pR-5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3170 | Not in stock | ||
| BBa_K658008 | position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3301 | Not in stock | ||
| BBa_K731201 | Arabinose inducible araC-pBAD promoter | . . . ctctactgtttctccatacccgtttttttg | 1203 | 7138 | In stock | ||
| BBa_K808000 | araC-Pbad - Arabinose inducible regulatory promoter/repressor unit | . . . tgtttctccatacccgttttttgggctaac | 1209 | 1033281 | In stock | ||
| BBa_K864400 | Ptac, trp & lac regulated promoter | . . . aatgtgtggaattgtgagcggataacaatt | 61 | 22250 | In stock | ||
| BBa_R0062 | Promoter (luxR & HSL regulated -- lux pR) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 77850 | In stock | ||
| BBa_R0065 | Promoter (lambda cI and luxR regulated -- hybrid) | . . . gtgttgactattttacctctggcggtgata | 97 | 3065 | In stock | ||
| BBa_R0071 | Promoter (RhlR & C4-HSL regulated) | . . . gttagctttcgaattggctaaaaagtgttc | 53 | 9591 | In stock | ||
| BBa_R0078 | Promoter (cinR and HSL regulated) | . . . ccattctgctttccacgaacttgaaaacgc | 225 | 2460 | In stock | ||
| BBa_R0079 | Promoter (LasR & PAI regulated) | . . . ggccgcgggttctttttggtacacgaaagc | 157 | 18233 | In stock | ||
| BBa_R0080 | Promoter (AraC regulated) | . . . ttttatcgcaactctctactgtttctccat | 149 | 3598 | In stock | ||
| BBa_R0082 | Promoter (OmpR, positive) | . . . attattctgcatttttggggagaatggact | 108 | 30961 | In stock | ||
| BBa_R0083 | Promoter (OmpR, positive) | . . . attattctgcatttttggggagaatggact | 78 | 3262 | In stock | ||
| BBa_R0084 | Promoter (OmpR, positive) | . . . aacgttagtttgaatggaaagatgcctgca | 108 | 2818 | In stock | ||
| BBa_R1062 | Promoter, Standard (luxR and HSL regulated -- lux pR) | . . . aagaaaatggtttgttgatactcgaataaa | 56 | 2617 | In stock |
Positively regulated E. coli σS promoters
This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K112322 | {Pdps} in BBb format | . . . gggacacaaacatcaagaggatatgagatt | 348 | 1848 | It's complicated |
Positively regulated E. coli σ32 promoters
This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K112400 | Promoter for grpE gene - Heat Shock and Ultrasound Sensitive | . . . ataataagcgaagttagcgagatgaatgcg | 98 | 4659 | It's complicated | ||
| BBa_K338001 | Heat Shock Promoter (HSP) | . . . ataataagcgaagttagcgagatgaatgcg | 98 | 4627 | It's complicated | ||
| BBa_K338002 | K338001+R0011: Heat Shock Promoter + LacI Regulated Promoter | . . . actgagcacatactagagaaagaggagaaa | 181 | 3187 | It's complicated | ||
| BBa_K338042 | GFP Reporter Device, Heat-Shock Induced | . . . caccttcgggtgggcctttctgcgtttata | 981 | 1584 | It's complicated | ||
| BBa_K338062 | GFP Reporter Device, Heat-Shock or IPTG Induced | . . . caccttcgggtgggcctttctgcgtttata | 1064 | 1354 | It's complicated | ||
| BBa_K338081 | Heat-Shock Activated Generator | . . . gatgaatgcgtactagagaaagaggagaaa | 118 | 1492 | It's complicated |
Positively regulated E. coli σ54 promoters
This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_J64979 | glnAp2 | . . . agttggcacagatttcgctttatctttttt | 151 | 1249 | Not in stock |