Help:Promoters/Prokaryotic RNAP

This page provides information about prokaryotic RNA polymerases (RNAP). For example, how many subunits are in a particular RNAP, how does the RNAP recognize promoters or what is the consensus promoter sequences for a particular promoter. Some RNAP are only expressed during particular stages of growth, this information is provided where known.

E. coli RNA polymerases

E. coli has only one RNA polymerase composed of 5 subunits. However, a 6th subunit is necessary the holoenzyme that can transcribe DNA. This 6th subunit is called a sigma (σ) factor and confers specificity on the holoenzyme for particular promoter sequencesGruber. In E. coli there are seven different σ factors that recognize different promoter sequences. The α subunit of the polymerase binds nonspecifically to DNA and the σ factor binds specifically to DNA sequences between -10 and -35 bases upstream of the site at which transcription begins. The conditions under which different σ factors are used and the consensus sequences for those promoters are provided below.

σ⁷⁰ holenzyme (Eσ⁷⁰)

• A.K.A σ^D
• Used during exponential growth for the transcription of most genes. σ⁷⁰ is the most common sigma factor in E. coli.
• Consensus promoter sequence: TTGACA__(17)__TATAAT

σ⁵⁴ holenzyme (Eσ⁵⁴)

• A.K.A σ^N
• This sigma factor is used to activate certain genes in response to nitrogen activation
• Consensus promoter sequence: NNNNMRNRYTGGCACGNNNNTTGCWNNWNNNNN Barrios

σ^S holenzyme (Eσ^S)

• A.K.A σ³⁸
• Used during late exponential and stationary growth phases. Is also is a major regulator of the response of E. coli to starvation.
• Consensus promoter sequence: TTGACA__(17)__TATAAT Typas

σ³² holenzyme (Eσ³²)

• A.K.A σ^H
• This sigma factor is most commonly activated following a heat, osmotic, or pH shock to coordinate the relevant stress responses of E. coli.
• Consensus promoter sequence: NTCNCCCTTGAA__(17)__ CCCCATTTA Cowing

σ²⁸ holenzyme (Eσ²⁸)

• A.K.A σ^F
• This sigma factor is regulates the transcription of genes necessary for motility of E. coli.
• Consensus promoter sequence: TAAAGWWY__(11/12)__RYCGAWRN Yu

σ²⁴ holenzyme (Eσ²⁴)

• A.K.A σ^E
• This sigma factor is used in the response to extreme heat shock and also to damage to periplasmic and membrane proteins.
• Consensus promoter sequence:
  

  Sequence logo and associated information for Eσ²⁴ promoters. Taken from doi:10.1371/journal.pbio.0040002 Rhodius

σ¹⁹ holenzyme (Eσ¹⁹)

• A.K.A σFecI
• This is a minor sigma factor that regulates the genes necessary for transport of ferric citrate.
• Consensus promoter sequence: TGGATAAACATTTCACCACTGTAAGGAAAATAATTCTTATTTCGATTGTCCTTTTTACCCT (E. coli FecA gene) Enz

References

<biblio>

1. Barrios pmid=10536136
2. Gruber pmid=14527287
3. Typas pmid=16420370
4. Cowing pmid=3887408
5. Yu pmid=16855242
6. Rhodius pmid=16336047
7. Enz pmid=12644513

</biblio>