Cell-cell signalling
Promoters (?) | Transcriptional regulators (?) | Enzymes (?) | Translational units (?) | Composite parts |
Promoters
These promoters are all related to cell signalling. Cell signalling is often mediated by a small molecule or peptide that diffuses between cells and can diffuse through cell membranes. The signalling molecule is recognized by a receptor protein (often located in or near the membrane of the cell) that regulates the activity of the promoters listed here directly, or via a signalling cascade.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_I1051 | Lux cassette right promoter | . . . tgttatagtcgaatacctctggcggtgata | 68 | 1735 | In stock | ||
BBa_I14015 | P(Las) TetO | . . . ttttggtacactccctatcagtgatagaga | 170 | 1524 | In stock | ||
BBa_I14016 | P(Las) CIO | . . . ctttttggtacactacctctggcggtgata | 168 | 1523 | In stock | ||
BBa_I14017 | P(Rhl) | . . . tacgcaagaaaatggtttgttatagtcgaa | 51 | 13707 | In stock | ||
BBa_I739105 | Double Promoter (LuxR/HSL, positive / cI, negative) | . . . cgtgcgtgttgataacaccgtgcgtgttga | 99 | 3259 | Not in stock | ||
BBa_I746104 | P2 promoter in agr operon from S. aureus | . . . agattgtactaaatcgtataatgacagtga | 96 | 1753 | In stock | ||
BBa_I751501 | plux-cI hybrid promoter | . . . gtgttgatgcttttatcaccgccagtggta | 66 | 1222 | Not in stock | ||
BBa_I751502 | plux-lac hybrid promoter | . . . agtgtgtggaattgtgagcggataacaatt | 74 | 4200 | Not in stock | ||
BBa_I761011 | CinR, CinL and glucose controlled promotor | . . . acatcttaaaagttttagtatcatattcgt | 295 | 2080 | It's complicated | ||
BBa_J06403 | RhIR promoter repressible by CI | . . . tacgcaagaaaatggtttgttatagtcgaa | 51 | 1464 | In stock | ||
BBa_J102001 | Reverse Lux Promoter | . . . tcttgcgtaaacctgtacgatcctacaggt | 55 | 1785 | It's complicated | ||
BBa_J64000 | rhlI promoter | . . . atcctcctttagtcttccccctcatgtgtg | 72 | 1470 | Not in stock | ||
BBa_J64010 | lasI promoter | . . . taaaattatgaaatttgcataaattcttca | 53 | 3970 | Not in stock | ||
BBa_J64067 | LuxR+3OC6HSL independent R0065 | . . . gtgttgactattttacctctggcggtgata | 98 | 1810 | Not in stock | ||
BBa_J64712 | LasR/LasI Inducible & RHLR/RHLI repressible Promoter | . . . gaaatctggcagtttttggtacacgaaagc | 157 | 1866 | Not in stock | ||
BBa_K091107 | pLux/cI Hybrid Promoter | . . . acaccgtgcgtgttgatatagtcgaataaa | 57 | 4524 | It's complicated | ||
BBa_K091117 | pLas promoter | . . . aaaattatgaaatttgtataaattcttcag | 126 | 3108 | It's complicated | ||
BBa_K091143 | pLas/cI Hybrid Promoter | . . . ggttctttttggtacctctggcggtgataa | 164 | 1530 | It's complicated | ||
BBa_K091146 | pLas/Lux Hybrid Promoter | . . . tgtaggatcgtacaggtataaattcttcag | 126 | 4661 | In stock | ||
BBa_K091156 | pLux | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 1608 | Not in stock | ||
BBa_K091157 | pLux/Las Hybrid Promoter | . . . ctatctcatttgctagtatagtcgaataaa | 55 | 2254 | Not in stock | ||
BBa_K145150 | Hybrid promoter: HSL-LuxR activated, P22 C2 repressed | . . . tagtttataatttaagtgttctttaatttc | 66 | 2130 | It's complicated | ||
BBa_K1520010 | Prlux-rbs-rfp-Ter | . . . caccttcgggtgggcctttctgcgtttata | 932 | 1622 | It's complicated | ||
BBa_K1520515 | MC7-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter. | . . . caccttcgggtgggcctttctgcgtttata | 3611 | 1361 | Not in stock | ||
BBa_K1520516 | MC31-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter | . . . caccttcgggtgggcctttctgcgtttata | 3610 | 1362 | Not in stock | ||
BBa_K2558001 | lux pR-HS | . . . caagaaaatggtttgttactttcgaataaa | 55 | 15965 | It's complicated | ||
BBa_K266000 | PAI+LasR -> LuxI (AI) | . . . caccttcgggtgggcctttctgcgtttata | 963 | 2325 | It's complicated | ||
BBa_K266005 | PAI+LasR -> LasI & AI+LuxR --| LasI | . . . aataactctgatagtgctagtgtagatctc | 819 | 1498 | It's complicated | ||
BBa_K266006 | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | . . . caccttcgggtgggcctttctgcgtttata | 1705 | 1471 | It's complicated | ||
BBa_K266007 | Complex QS -> LuxI & LasI circuit | . . . caccttcgggtgggcctttctgcgtttata | 2676 | 1513 | It's complicated | ||
BBa_K3205003 | luxPR_3A | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11136 | Not in stock | ||
BBa_K3205004 | luxPR_3G | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11193 | Not in stock | ||
BBa_K3205005 | luxPR_4G12T | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 11309 | Not in stock | ||
BBa_K658006 | position 3 mutated promoter lux pR-3 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3218 | Not in stock | ||
BBa_K658007 | position 5 mutated promoter lux pR-5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3170 | Not in stock | ||
BBa_K658008 | position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 3301 | Not in stock | ||
BBa_R0062 | Promoter (luxR & HSL regulated -- lux pR) | . . . caagaaaatggtttgttatagtcgaataaa | 55 | 77850 | In stock | ||
BBa_R0063 | Promoter (luxR & HSL regulated -- lux pL) | . . . cacgcaaaacttgcgacaaacaataggtaa | 151 | 4614 | In stock | ||
BBa_R0071 | Promoter (RhlR & C4-HSL regulated) | . . . gttagctttcgaattggctaaaaagtgttc | 53 | 9591 | In stock | ||
BBa_R0078 | Promoter (cinR and HSL regulated) | . . . ccattctgctttccacgaacttgaaaacgc | 225 | 2460 | In stock | ||
BBa_R0079 | Promoter (LasR & PAI regulated) | . . . ggccgcgggttctttttggtacacgaaagc | 157 | 18233 | In stock | ||
BBa_R1062 | Promoter, Standard (luxR and HSL regulated -- lux pR) | . . . aagaaaatggtttgttgatactcgaataaa | 56 | 2617 | In stock |
Transcriptional regulators
Transcriptional regulators either activate or repress transcription from cognate promoters.
Name | Protein | Description | Tag | Direction | Uniprot | KEGG | Operator | Ligand | Length |
---|---|---|---|---|---|---|---|---|---|
BBa_C0062 | LuxR | luxR repressor/activator, (no LVA?) | None | Forward | P12746 | 781 | |||
BBa_C0071 | rhlR-LVA | rhlR repressor/activator from P. aeruginosa PA3477 (+LVA) | LVA | Forward | P54292 | 787 | |||
BBa_C0079 | lasR-LVA | lasR activator from P. aeruginosa PAO1(+LVA) | LVA | Forward | P25084 | 781 | |||
BBa_C0077 | cinR | cinR activator from Rhizobium leguminosarum (+LVA) | LVA | Forward | ~ Q84HT2 | 787 | |||
BBa_C0171 | rhIR | rhlR repressor/activator from P. aeruginosa PA3477 (no LVA) | None | Forward | P54292 | 729 | |||
BBa_C0179 | lasR | lasR activator from P. aeruginosa PAO1(no LVA) | None | Forward | P25084 | 723 | |||
BBa_K082006 | LuxR-G2F | 753 | |||||||
BBa_S04301 | lasR-LVA | C0079:B0015 | LVA | Forward | P25084 | 918 | |||
BBa_K266002 | lasR-LVA | LasR + Term | LVA | Forward | P25084 | 918 | |||
BBa_K783054 | lasR-LVA | This is a MoClo converted version of BBa_C0079 | LVA | Forward | P25084 | 756 | |||
BBa_K131022 | LuxO D47E, Vibrio harveyi | 1362 | |||||||
BBa_K131023 | LuxO D47A, Vibrio harveyi | 1362 | |||||||
BBa_K2656016 | LuxR TF Coding Sequence | 757 |
Enzymes
< Back to Biosynthesis Protein coding sequences
N-Acyl Homoserine lactones (AHLs or N-AHLs) are a class of signaling molecules involved in bacterial quorum sensing. Quorum sensing is a method of communication between bacteria that enables the coordination of group based behavior based on population density. In synthetic biology, genetic parts derived from quorum sensing systems have been used to create patterns on a lawn of bacteria and to achieve synchronized cell behavior. AHL can diffuse across cell membranes and is stable in growth media over a range of pH values. AHL can bind to transcriptional activators such as LuxR and stimulate transcription from cognate promoters. Several similar quorum sensing systems exists across different bacterial species; thus, there are several known enzymes that synthesize or degrade different AHL molecules. Note that genetic parts derived from different quorum sensing systems may have different levels of crosstalk.
Biosynthesis
Name | Protein | Description | Direction | Uniprot | KEGG | E.C. | Substrate | Product | Length | Status |
---|---|---|---|---|---|---|---|---|---|---|
BBa_C0060 | aiiA-LVA | autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone | Forward | Q1WNZ5 | none | 3.1.1.- | 814 | In stock | ||
BBa_C0061 | luxI-LVA | autoinducer synthetase for AHL | Forward | P12747 | none | none | 643 | In stock | ||
BBa_C0070 | rhlI-LVA | autoinducer synthetase for N-butyryl-HSL (BHL) and HHL | Forward | Q02QW5 | none | none | 667 | In stock | ||
BBa_C0076 | cinI | autoinducer synthetase | Forward | Q1MDW1 | none | none | 727 | In stock | ||
BBa_C0078 | lasI | autoinducer synthetase for PAI from Pseudomonas aeruginosa | Forward | P33883 | pae:PA1432 | none | 667 | In stock | ||
BBa_C0161 | luxI | autoinducer synthetase for AHL (no LVA) | Forward | P12747 | none | none | 585 | In stock | ||
BBa_C0170 | rhII | autoinducer synthetase for N-butyryl-HSL (BHL) and HHL (no LVA) | Forward | Q02QW5 | none | none | 609 | In stock | ||
BBa_C0178 | lasI | autoinducer synthetase for PAI from Pseudomonas aeruginosa (no LVA) | Forward | P33883 | pae:PA1432 | none | 609 | In stock | ||
BBa_K091109 | LuxS | 516 | In stock | |||||||
BBa_K1060000 | AroG; DAHP synthase | 1053 | In stock | |||||||
BBa_K2656019 | LuxI Coding Sequence | 586 | It's complicated |
Degradation
Name | Protein | Description | Direction | Uniprot | KEGG | E.C. | Substrate | Product | Length | Status |
---|---|---|---|---|---|---|---|---|---|---|
BBa_C0060 | aiiA-LVA | autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone | Forward | Q1WNZ5 | none | 3.1.1.- | 814 | In stock | ||
BBa_C0160 | aiiA | autoinducer inactivation enzyme aiiA (no LVA) | Forward | Q1WNZ5 | none | 3.1.1.- | 756 | In stock |
Translational units
Translational units begin with the RBS, the site of ribosome binding and translational initiation, and end with a stop codon, the site of translational termination. Every translational unit in the Registry consists of at least three parts, a Translational start, one or more Internal Domains including Special Internal Domains, and a Tail Domain. Thus translational units can, in some sense, be thought of as a composite part made up of three or more parts. Protein coding sequences, in contrast, begin with a start codon and end with a stop codon.
For more information on protein domains, see protein domains. Unfortunately, the original BioBrick assembly standard, Assembly standard 10, does not support in-frame assembly of protein domains. (Assembly standard 10 creates an 8 bp scar between adjacent parts.) Therefore, it is recommended that you use an alternate approach to assemble protein domains together to make a translational unit. There are several possible approaches to assembling protein domains including direct synthesis (preferred because it creates no scars) as well as various assembly standards. Regardless of which standard you choose, we suggest that the resulting translational unit comply with the original BioBrick assembly standard so that your parts can be assembled with most of the parts in the Registry.
Translational units should be as follows
GAATTC GCGGCCGC T TCTAGA G [RBS] [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG
Although most RBSs are currently specified as separate parts in the Registry, we are now moving to a new design in which the RBS and Head domain are combined into a single part termed a Translational start. The new design has the advantage of encapsulating both ribosome binding and translational initiation within a single part. Our working hypothesis is that the new design will reduce the likelihood of unexpected functional composition problems between the RBS and coding sequence.
Name | Protein | Description | Tag | Direction | UniProt | KEGG | Length | Status |
---|---|---|---|---|---|---|---|---|
BBa_I9026 | rhlI translational unit | 685 | In stock | |||||
BBa_C0261 | luxI | AHL-making Enzyme, luxI (+RBS) | LVA | Forward | 661 | In stock | ||
BBa_K081008 | luxI protein generator (TERM-) | 664 | In stock | |||||
BBa_K081009 | lasI protein generator (TERM-) | 688 | In stock | |||||
BBa_K081020 | cI and lasR protein generator (TERM-) | 1606 | In stock | |||||
BBa_K082010 | B0034-C0070 | 685 | In stock | |||||
BBa_K332033 | 37℃ induced RBS + tetR + double terminator | 864 | In stock | |||||
BBa_C0260 | aiiA | autoinducer inactivation enzyme, AaiiA (+RBS) | LVA | Forward | 832 | It's complicated | ||
BBa_J37033 | RBS + LuxR | 799 | It's complicated | |||||
BBa_K091138 | RBS+lsrR | 972 | It's complicated | |||||
BBa_K091158 | RBS+lsrK | 1611 | It's complicated | |||||
BBa_K131015 | LuxPQ from Vibrio harveyi | 3825 | It's complicated | |||||
BBa_K131016 | LuxOU from Vibrio harveyi | 1945 | It's complicated | |||||
BBa_K082007 | B0030-C0070 | 688 | It's complicated | |||||
BBa_K082008 | B0032-C0070 | 686 | It's complicated | |||||
BBa_K1631003 | Tlanslational unit of Colicin Lysis Protein (for colicin-E3) | 156 | It's complicated | |||||
BBa_K772001 | EpCAM Binding Dock: C-terminus | 1159 | Not in stock | |||||
BBa_K772002 | EpCAM Binding Dock: N terminus | 1138 | Not in stock | |||||
BBa_K1520501 | LuxR | Rbs-luxR(scarless) | None | Forward | P12746 | 799 | Not in stock | |
BBa_K1520504 | luxI-LVA | Rbs-luxI(scarless) | LVA | Forward | P12747 | none | 661 | Not in stock |
BBa_K1631002 | Translational unit of Colicin-E3 | 1668 | Not in stock |
Composite parts
These are composite parts related to cell-cell signalling.
Name | Type | Description | Length | Status |
---|---|---|---|---|
BBa_F1610 | Signalling | 3OC6HSL Sender Device | 798 | In stock |
BBa_F2620 | Signalling | 3OC6HSL -> PoPS Receiver | 1061 | In stock |
BBa_F2621 | Signalling | 3OC6HSL Receiver Device | 1158 | In stock |
BBa_F2622 | Signalling | 3OC6HSL Receiver Device | 1062 | In stock |
BBa_I0424 | Signalling | I0404.I6101 | 2700 | It's complicated |
BBa_I0426 | Signalling | I0406.I6107 | 2798 | It's complicated |
BBa_I0428 | Signalling | I0408.I6106 | 2872 | It's complicated |
BBa_I0429 | Signalling | I0408.I6116 | 2858 | Not in stock |
BBa_I0460 | Generator | aiiA Device (B0034.C0060.B0015) | 969 | It's complicated |
BBa_I0462 | Generator | luxR Protein Generator | 936 | In stock |
BBa_I0464 | Signalling | LasR Protein Generator | 936 | It's complicated |
BBa_I0466 | Signalling | RhlR Protein Generator | 942 | In stock |
BBa_I0468 | Signalling | Cin R Protein Generator | 942 | Not in stock |
BBa_I13018 | Signalling | LuxR Cassette under Ptet (Other) | 998 | In stock |
BBa_I13035 | Signalling | 3OC6HSL Receiver Device with Inducible Control of LuxR and a YFP Output device | 3003 | Not in stock |
BBa_I13202 | Signalling | 3OC6HSL Sender Controlled by Lac Repressible Promoter | 803 | In stock |
BBa_I13203 | Signalling | pBad.aiiA protein generator (LVA-) | 2129 | Not in stock |
BBa_I13205 | Signalling | HSL/aiiA test construct | 4239 | Not in stock |
BBa_I13206 | Signalling | aiiA (LVA-) protein generator driven by ptet | 973 | Not in stock |
BBa_I13207 | Signalling | HSL/aiiA test construct | 4142 | In stock |
BBa_I13208 | Signalling | aiiA (LVA-) protein generator driven by plac | 974 | It's complicated |
BBa_I13210 | Signalling | Lux/Cin Relaxation Oscillator | 5724 | Not in stock |
BBa_I13211 | Signalling | Biobricked version of the natural Lux quorum sensing system | 1964 | In stock |
BBa_I13212 | Signalling | LuxR Protein Generator Controlled by the Left Lux Promoter | 1095 | It's complicated |
BBa_I13213 | Signalling | BioBricked version of the natural Lux system with order reversed | 1964 | Not in stock |
BBa_I13261 | Signalling | Lux Receiver (I13263 with reversed part order) | 2044 | In stock |
BBa_I13262 | Signalling | PoPS->PoPS Amplifier Controlled by 3OC6HSL | 999 | In stock |
BBa_I13263 | Signalling | Lux Receiver (HSL & R0063 driven) | 2044 | In stock |
BBa_I13264 | Signalling | Lux based Sender/Receiver/Reporter system | 2713 | Not in stock |
BBa_I13265 | Signalling | Lux based Sender/Receiver/Reporter system (LVA-) | 2655 | Not in stock |
BBa_I13266 | Signalling | Lux-based Sender/Receiver Device which outputs PoPS | 1827 | Not in stock |
BBa_I13272 | Signalling | YFP Producer Controlled by 3OC6HSL Receiver Device | 2083 | In stock |
BBa_I13273 | Signalling | YFP Producer Controlled by 3OC6HSL Receiver Device | 1947 | It's complicated |
BBa_I13274 | Signalling | Lux Receiver (HSL & R0011 driven) | 1948 | Not in stock |
BBa_I13277 | Signalling | PoPS->PoPS amplifier (CinR-based, HSL driven) | 1175 | Not in stock |
BBa_I1466 | Signalling | RhlR protein generator (LVA-) | 884 | In stock |
BBa_I1467 | Signalling | AI-1 protein generator (LVA-) | 878 | Not in stock |
BBa_I1468 | Generator | CinR protein generator | 884 | In stock |
BBa_I534060 | Signalling | aiiA Protein Generator (LVA+) Controlled by a tet Repressible Promoter | 2187 | Not in stock |
BBa_I722006 | Signalling | GFP Producer Controlled by 3OC6HSL (without Promoter) | 1885 | It's complicated |
BBa_I722011 | Composite | rhl producer followed by a AHL acceptor | 2702 | It's complicated |
BBa_I722012 | Composite | AHL->RoPs and mRFP producer | 2722 | In stock |
BBa_I724000 | Device | Autoinducer inactivation enzyme regulated by LuxR/HSL promoter | 895 | It's complicated |
BBa_I726031 | Device | Trc-LIC | 1552 | It's complicated |
BBa_I726041 | Device | Sen-TIC | 1551 | It's complicated |
BBa_I726061 | Device | Trc-LRY | 1748 | It's complicated |
BBa_I726071 | Device | Rec-RRY | 1748 | It's complicated |
BBa_I726081 | Device | Rec-LRY.RC | 2697 | It's complicated |
BBa_I729004 | Composite | Sensitive AHL Receiver | 1920 | It's complicated |
BBa_I729005 | Composite | AHL Reporter and Quencher | 2650 | It's complicated |
BBa_I729006 | Composite | AHL reporter and aiia device | 2985 | It's complicated |
BBa_I732923 | Device | I732907 I732922 | 5682 | It's complicated |
BBa_I751250 | Generator | pSB4 plac-luxI | 803 | In stock |
BBa_I751350 | Generator | pBR322 plac-luxI | 803 | In stock |
BBa_I761011 | Regulatory | CinR, CinL and glucose controlled promotor | 295 | It's complicated |
BBa_J06001 | Signalling | Tet repressible luxI generator ( LVA+ ) | 860 | In stock |
BBa_J06002 | Signalling | Tet repressible luxI generator ( LVA- ) | 802 | Not in stock |
BBa_J06101 | Signalling | Tet repressible lasI generator ( LVA+ ) | 884 | In stock |
BBa_J06102 | Signalling | Tet repressible lasI generator ( LVA- ) | 826 | Not in stock |
BBa_J06201 | Signalling | Tet repressible rhI generator (LVA+) | 884 | In stock |
BBa_J06400 | Signalling | 3OC12HSL Receiver | 1147 | Not in stock |
BBa_J06401 | Signalling | 30C12HSL Sender | 764 | It's complicated |
BBa_J06402 | Signalling | C4HSL Receiver | 1044 | Not in stock |
BBa_J07043 | Signalling | J07012.B0015 (scFv 4-4-20.TT) | 899 | It's complicated |
BBa_J07044 | Signalling | J07013.B0015 (scFv S101A.TT) | 899 | It's complicated |
BBa_J07045 | Signalling | J07014.B0015 (scFv 4M5.3.TT) | 899 | It's complicated |
BBa_J13040 | Signalling | pOmpR dependent 3OC6HSL sender device | 914 | In stock |
BBa_J85120 | Composite | High Population->mRFP (pLac->LuxI; pLacIQ->luxR; pLux->mRFP;) | 2653 | Not in stock |
BBa_K081011 | Generator | luxR protein generator under Plambda regulation (TERM-) | 859 | In stock |
BBa_K081015 | Generator | luxI protein generator - PoPS->luxI | 711 | In stock |
BBa_K081019 | Generator | luxR protein generator under Plambda regulation | 906 | In stock |
BBa_K082020 | Generator | LuxR generator | 998 | In stock |
BBa_K082021 | Generator | RhlI generator | 1004 | It's complicated |
BBa_K082023 | Generator | B0034-C0070-B0015 | 822 | It's complicated |
BBa_K082029 | Generator | LuxI generator | 860 | In stock |
BBa_K082030 | Generator | luxI generator on PSB3C5 | 860 | In stock |
BBa_K082031 | Composite | R0071-B0030-C0070 | 749 | It's complicated |
BBa_K082032 | Composite | R0071-B0032-C0070 | 747 | It's complicated |
BBa_K082035 | Generator | RhlI generator | 884 | In stock |
BBa_K082036 | Generator | LuxR & RhlI generator | 1890 | It's complicated |
BBa_K082037 | Generator | RhlI & GFP generator | 1633 | It's complicated |
BBa_K091134 | Device | Las Receiver with GFP reporter | 2048 | It's complicated |
BBa_K091139 | Generator | RBS+lsrR+TT | 1109 | It's complicated |
BBa_K091182 | Device | pLasR/cI-RBS-LuxI-RBS-Mnt-TT-pMnt/tetR-RBS-LuxI-RBS-cI-TT | 2988 | It's complicated |
BBa_K091190 | Device | plux/cI+RBS+lasI+RBS+Mnt+TT+pMnt/lac+RBS+lasI+RBS+cI+TT | 2802 | It's complicated |
BBa_K091203 | Device | pBAD-RBS-LuxR-RBS-LacI(I12)-TT | 2183 | It's complicated |
BBa_K094103 | Device | plux-rbs-cheZ-terminator | 878 | It's complicated |
BBa_K094106 | Device | Plux-rbs-CI-terminator-plambda P(O-R12)-rbs-cheZ | 2521 | It's complicated |
BBa_K094112 | Device | luxR-luxI-terminator | 1552 | It's complicated |
BBa_K1072002 | Generator | NADH dehydrogenase | 1525 | It's complicated |
BBa_K1072017 | Composite | pGAL1 + Flag + odr-10 + GFP + ADH1Te + pFUS1 + BFP + ADH1Te | 4169 | Not in stock |
BBa_K1072018 | Composite | pGAL1 + Flag + Brho + odr-10 + GFP + ADH1Te + pFUS1 + BFP + ADH1Te | 4235 | Not in stock |
BBa_K1157013 | Composite | pCI-mCherry-pConst-RhlR-pRhl-RhlR-CI | 3627 | It's complicated |
BBa_K116626 | Generator | BBa_B0032 + LuxR + BBa_B0015 | 937 | It's complicated |
BBa_K1520003 | Generator | Pcons2-rbs-luxR-Ter | 979 | It's complicated |
BBa_K1520009 | Composite | Plac-rbs-luxI-Ter | 1006 | It's complicated |
BBa_K1520010 | Reporter | Prlux-rbs-rfp-Ter | 932 | It's complicated |
BBa_K1520011 | Composite | Prlux-rbs-rfp-rbs-luxI-Ter | 1601 | It's complicated |
BBa_K1520012 | Composite | Prlux-rbs-rfp-rbs-luxR-Ter | 1739 | Not in stock |
BBa_K1520013 | Composite | Prlux-rbs-rfp-rbs-luxI-rbs-luxR-Ter | 2408 | It's complicated |
BBa_K1520019 | Composite | Pcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter | 2365 | It's complicated |
BBa_K1520020 | Composite | Pcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter | 3352 | Not in stock |
BBa_K1520021 | Composite | Pcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-Ter | 4292 | Not in stock |
BBa_K1520022 | Composite | Pcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-rbs-luxI-Ter | 4961 | Not in stock |
BBa_K1520023 | Composite | Pcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-rbs-luxR-Ter | 5099 | Not in stock |
BBa_K1520024 | Composite | Pcons2-rbs-lacI-Ter-Plac-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-rfp-rbs-luxI-rbs-luxR-Ter | 5768 | Not in stock |
BBa_K1520508 | Composite | PgolTS-golS-PgolB-rbs-luxI-Ter | 1559 | Not in stock |
BBa_K1520510 | Composite | PgolTS-golS-PgolB-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter | 4231 | Not in stock |
BBa_K1520511 | Composite | MC7-rbs-luxI-Ter | 939 | Not in stock |
BBa_K1520512 | Composite | MC31-rbs-luxI-Ter | 938 | Not in stock |
BBa_K1520515 | Composite | MC7-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter. | 3611 | Not in stock |
BBa_K1520516 | Composite | MC31-rbs-luxI-Ter-Pcons2-rbs-luxR-Ter-Prlux-rbs-OMPA-golB-rbs-luxI-Ter | 3610 | Not in stock |
BBa_K1631022 | Generator | Plux -rbs- Barnase -rbs- GFP -d.term | 1330 | It's complicated |
BBa_K1631024 | Device | Colicin-E3 cassette (Strong) | 2290 | It's complicated |
BBa_K1631025 | Device | Colicin-E3 cassette (Medium) | 2290 | It's complicated |
BBa_K2637034 | Composite | KaiA cassette II with PGK1 Promoter and PGK1 Terminator | 1731 | It's complicated |
BBa_K266000 | Signalling | PAI+LasR -> LuxI (AI) | 963 | It's complicated |
BBa_K266002 | Coding | LasR + Term | 918 | In stock |
BBa_K266005 | Signalling | PAI+LasR -> LasI & AI+LuxR --| LasI | 819 | It's complicated |
BBa_K266006 | Signalling | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | 1705 | It's complicated |
BBa_K266007 | Signalling | Complex QS -> LuxI & LasI circuit | 2676 | It's complicated |
BBa_K332031 | Generator | Constitutive promoter + 37℃ induced RBS + tetR + double terminator | 907 | It's complicated |
BBa_K332032 | Generator | Constitutive promoter+37℃ induced RBS+tetR+double terminator+Ptet+RBS+GFP+double terminator | 1836 | It's complicated |
BBa_K3848010 | Composite | TRAIL-Smac fusion peptide secretion cassette. | 1271 | |
BBa_K4833007 | DNA | shSTAT3/shPD-L1 transcribes shSTAT3 and shPD-L1, silencing STAT3 and PD-L1 gene expression. | 426 | |
BBa_K4833008 | Composite | shSTAT3/shPD-L1 transcribes shSTAT3 and shPD-L1, silencing STAT3 and PD-L1 gene expression. | 426 | |
BBa_K546000 | Signalling | Lux pL controlled LuxR with lux pR autoinducing LuxI(lva tag)- AHL. | 1964 | In stock |
BBa_K546001 | Composite | Lux pL controlled luxR with lux pR controlled AHL degrading enzyme AiiA(lva tag). | 2135 | In stock |
BBa_K546002 | Measurement | Lux pL controlled luxR with lux pR controlled GFP(lva tag). | 2080 | It's complicated |
BBa_K546003 | Signalling | Lux pL controlled LuxR + lux pR promoter. | 1158 | In stock |
BBa_K546005 | Composite | Lux pL controlled LuxR + lux pR autoinducing LuxI (lva tag) + lux pR controlled GFP(lva tag). | 4052 | It's complicated |
BBa_K574001 | Signalling | TetR regulated by 3OC6HSL | 1890 | It's complicated |
BBa_K574004 | Signalling | 3OC12HSL regulated by TetR | 797 | In stock |
BBa_K574005 | Signalling | 3OC12HSL and YFP regulated by pBad | 1712 | In stock |
BBa_K574006 | Device | 3OC12HSL regulated by pTet and pBad | 2517 | In stock |
BBa_K574009 | Signalling | 3OC12HSL -> PoPS Receiver | 1147 | It's complicated |
BBa_K772100 | Project | EpCAM Detection Device | 2305 | It's complicated |
BBa_K990001 | Signalling | pOmpC+EPIC Firefly Luciferase | 2742 | It's complicated |
BBa_S04301 | Coding | C0079:B0015 | 918 | In stock |
BBa_T9001 | Signalling | GFP and Producer Controlled by 3OC6HSL Receiver Device | 1946 | It's complicated |
BBa_T9002 | Signalling | GFP Producer Controlled by 3OC6HSL Receiver Device | 1945 | In stock |
![]() |
Barry Canton, as a graduate student in Drew Endy's lab, built and characterized the cell-cell signalling receiver BBa_F2620. |