Help:Assembly standard 10
< Back to Assembly standard 10
A reprint of BBF RFC 10 is included here.
Draft Standard for Biobrick Biological Parts Tom Knight 3 May 2007 This standard defines the required sequence properties for a Biobrick(tm) standard biological part. It does not define any functional characteristics of the parts, nor does it motivate any aspect of these standards. All sequences defined herein are specified in the 5' to 3' direction. 0. A Biobrick compatible standard biological part consists of a DNA fragment potentially conveying informational or functional properties to a composite structure assembled from multiple parts. The current assembly process requires certain sequence properties for the part and the surrounding DNA. 1. Allowed sequences within Biobrick parts include any DNA sequence which does not contain the following subsequences: EcoRI site: GAATTC XbaI site: TCTAGA SpeI site: ACTAGT PstI site: CTGCAG NotI site: GCGGCCGC Additionally, there are a set of sites which, if convenient, should also be eliminated. Parts containing these sites qualify as fully Biobrick standard compliant, but future assumbly and advanced uses of the parts may be compromised. These include: PvuII site: CAGCTG XhoI site; CTCGAG AvrII site: CCTAGG NheI site: GCTAGC SapI site: GCTCTTC and GAAGAGC 2. Biobrick Suffix Each Biobrick part must contain precisely this sequence immediately following the 3' end of the part: T ACTAGT A GCGGCCG CTGCAG (note: if constructing a primer, this sequence must be reverse complemented.) 3. Biobrick Prefix: To allow the construction of ribosomal binding sequences 5' of coding regions, the prefix used for coding regions is distinguished from the sequence for non-coding Biobrick parts. a. For non-coding Biobrick parts (the default) the Biobrick part must contain precisely the following sequence immediately 5' of the part: GAATTC GCGGCCGC T TCTAGA G b. For Biobrick parts coding for proteins, the Biobrick part must contain precisely the following sequence immediately 5' of the ATG start of the coding region: GAATTC GCGGCCGC T TCTAG Parts containing start codons other than ATG must be modified to use ATG as the start codon. We highly recommend, but do not require, that all coding regions terminate with in-frame TAATAA stop codons, replacing other stop codons (TGA, TAG). 4. Plasmid context Biobrick parts must be supplied in plasmids compatible with registry and assembly procedures. The pSBxxxx series of plasmids comply with these requirements. Other plasmids may be compliant with the following constraints: a. Antibiotic resistance: All plasmids must carry at least one of the following antibiotic resistance markers: Ampicillin Chloramphenicol Kanamycin Tetracycline It is acceptable for a plasmid to convey both ampicillin resistance and no more than one additional antibiotic resistance markers. Note that certain strains convey resistance as well. Parts delivered to the registry must be in strains which do not convey resistance to these markers. b. Sequencing primers The registry uses the following primers in sequencing all parts. Plasmids which omit or misplace these primers cannot be sequenced: VF2: TGCCACCTGACGTCTAAGAA VR: ATTACCGCCTTTGAGTGAGC 5. Strains The registry maintains parts libraries in frozen bacterial cultures, and encourages submissions in this form. The bacterial strain must be a K-12 cloning strain (endA-). Under no circumstances will the registry accept submissions in any strain which is not BSL-1. We recommend strains such as Top10, DH10B, and DH5a. We do not recommend submissions in MC4100, BL21 and similar strains. 6. PCR contruction of Biobrick parts Biobrick parts can be constructed by PCR from naturally occurring coding regions or other long DNA sequences. The recommended primer sequences for PCR of these fragments are: Biobrick prefix: GTTTCTTC GAATTC GCGGCCGC T TCTAGA G <18-24 bp of matching primer> Coding region biobrick prefix: GTTTCTTC GAATTC GCGGCCGC T TCTAG <18-24 bp of matching primer, beginning with ATG> Biobrick suffix: GTTTCTTC CTGCAG CGGCCGC T ACTAGT A <18-24 bp of matching primer (reverse complement)> The reverse complement of this suffix sequence is: 3' T ACTAGT A GCGGCCG CTGCAG GAAGAAAC 5' ------------ Biobrick(tm) is a registered trademark of the Biobrick Foundation, Inc.