DNA/Assembly
Contents
BioBrick cloning sites
 |
To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site. The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site. |
 |
Note that in most BioBrick plasmid backbones, the BioBrick prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information. |
There are no parts for this table
Other cloning sites
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G00000 | BioBrick cloning site prefix | gaattcgcggccgcttctagag | 22 |
| BBa_G00001 | BioBrick cloning site suffix | tactagtagcggccgctgcag | 21 |
| BBa_I13450 | Removes BioBrick End | . . . agagtaataaactgtgataatcaatgcatg | 74 |
| BBa_I13452 | Adds another BioBrick site | . . . agattagtcacacgcgatccattgcagtgg | 52 |
| BBa_I13455 | Insertion site plus RNAse E cut site | . . . taggtcttcgaatccgatccattgcagtgg | 78 |
| BBa_I13456 | Insertion site plus RNAse E | . . . taggtcttcgaatccgatccattgcagtgg | 55 |
| BBa_I13457 | Improved insertion site with two RNAse E cut sites | . . . tctctcgagagattagtacctttggagatc | 111 |
| BBa_I732007 | BglII + BamHI | gaagatcttccggatccgg | 19 |
| BBa_J56011 | MCSII | ttaattaaggaaggaaactagt | 22 |
BioBrick restriction enzyme sites
There are no parts for this table
Other restriction enzyme sites
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0045 | NheI restriction enzyme site (XbaI, SpeI compatible overhang) | gctagc | 6 |
| BBa_B0046 | NsiI restriction enzyme site (PstI compatible overhang) | atgcat | 6 |
| BBa_B0047 | MfeI restriction enzyme site (EcoRI compatible overhang) | caattg | 6 |
| BBa_B0048 | AvrII restriction enzyme site (XbaI, SpeI compatible overhang) | cctagg | 6 |
| BBa_B0102 | SapI restriction enzyme site (offset cutter) | gctcttct | 8 |
| BBa_B0103 | SapI restriction enzyme site, reversed (offset cutter) | atgtgaagagctg | 13 |
| BBa_I11071 | KpnI restriction enzyme site with extra flanking nucleotides | atcggtaccgca | 12 |
| BBa_I11072 | AclI restriction enzyme site with extra nucleotides | gcaaacgttcga | 12 |
| BBa_I11073 | PvuI restriction enzyme site with extra flanking nucleotides | acacgatcggta | 12 |
| BBa_I11074 | XmaI restriction enzyme site with extra flanking nucleotides | attcccgggtca | 12 |
| BBa_I11075 | BmtI restriction enzyme site with extra flanking nucleotides | cttgctagc | 9 |
| BBa_I11076 | HindIII restriction enzyme site with extra flanking nucleotides | tacaagcttct | 11 |
| BBa_I11077 | SalI restriction enzyme site with extra flanking nucleotides | atcgtcgacgca | 12 |
| BBa_I11078 | SacII restriction enzyme site with extra flanking nucleotides | gcaccgcggcga | 12 |
| BBa_I11079 | MluI restriction enzyme site with flanking nucleotides | acaacgcgtgta | 12 |
| BBa_I11080 | ApaI restriction site with extra flanking nucleotides | cgtgggccctca | 12 |
| BBa_I11081 | BamHI restriction site with extra flanking nucleotides | caaggatcc | 9 |
| BBa_I11082 | XbaI restriction site with extra flanking nucleotides | ggatctagacc | 11 |
| BBa_K150008 | BamHI restriction enzyme site | ggatcc | 6 |
| BBa_K175002 | I-PpoI homing endonuclease site | ctctcttaaggtagc | 15 |
| BBa_K175027 | I-SceI restriction site | agttacgctagggataacagggtaatatag | 30 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K4816001 | napA primer forward | cagtcacatatgatgaccatctcgcggc | 28 |
| BBa_K792013 | BamHI restriction site (standalone) | ggatcc | 6 |
| BBa_M31950 | HpaI restriction enzyme site | gtt | 3 |
| BBa_M31952 | AatII restriction enzyme site | gacgtc | 6 |
| BBa_M31953 | Acc65I restriction enzyme site | ggtacc | 6 |
| BBa_M31955 | ApaI restriction enzyme site | gggccc | 6 |
| BBa_M31956 | AfeI restriction enzyme site | agcgct | 6 |
| BBa_M31958 | AseI restriction enzyme site | attaat | 6 |
| BBa_M31961 | BbvCI restriction enzyme site | cctcagc | 7 |
| BBa_M31962 | BccI restriction enzyme site | ccatc | 5 |
| BBa_M31964 | BciVI restriction enzyme site | gtatcc | 6 |
| BBa_M31965 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31967 | BfaI restriction enzyme site | ctag | 4 |
| BBa_M31968 | BfuAI restriction enzyme site | acctgc | 6 |
| BBa_M31982 | NotI restriction enzyme site | gcggccgc | 8 |
| BBa_M31983 | EcoRI restriction enzyme site | gaattc | 6 |
| BBa_M31984 | PspOMI restriction enzyme site | gggccc | 6 |
| BBa_M31985 | BglII restriction enzyme site | agatct | 6 |
| BBa_M31986 | EagI restriction enzyme site | cggccg | 6 |
| BBa_M31987 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31988 | MluI restriction enzyme site | acgcgt | 6 |
| BBa_M31989 | BssHII restriction enzyme site | gcgcgc | 6 |
| BBa_M31990 | AscI restriction enzyme site | ggcgcgcc | 8 |
| BBa_M31991 | XbaI restriction enzyme site | tctaga | 6 |
| BBa_M31992 | SpeI restriction enzyme site | actagt | 6 |
| BBa_M31995 | BsrGI restriction enzyme site | tgtaca | 6 |
| BBa_M31996 | BsiWI restriction enzyme site | cgtacg | 6 |
| BBa_M31997 | Acc65I restriction enzyme site | ggtacc | 6 |
BioBrick scars
There are no parts for this table
Other scars
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0104 | AvrII/XbaI mixed site | cctaga | 6 |
| BBa_B0105 | RFC 25 Scar Sequence | accggc | 6 |
| BBa_G0000 | SpeI/XbaI scar for RBS-CDS junctions | tactag | 6 |
| BBa_G0001 | XbaI/SpeI mixed site, reverse | ctctagta | 8 |
| BBa_G0002 | SpeI/XbaI mixed site | tactagag | 8 |
| BBa_G0003 | NheI/XbaI mixed site | gctagag | 7 |
| BBa_G0004 | SpeI/NheI mixed site | tactagc | 7 |
| BBa_G0005 | NheI/SpeI mixed site | gctagta | 7 |
| BBa_G0006 | XbaI/NheI mixed site | ctctagc | 7 |
| BBa_K106015 | AarI "A" site scar sequence | atgctcgagggagct | 15 |
| BBa_K106016 | AarI "B" site scar sequence | ggtagttcccta | 12 |
| BBa_K106017 | AarI "D" site scar sequence | tgcgggatcctgagtaaataagcggccgc | 29 |
| BBa_K112999 | BBb1 scar sequence | ggatct | 6 |
| BBa_K1319106 | RFC 25 Translation Start Scar Sequence | tactagatggccggc | 15 |
| BBa_K1319107 | RFC 25 Translation Stop Scar Sequence | accggttaatactagag | 17 |
| BBa_K245009 | RFC 37 Scar Sequence | tccggc | 6 |
Primer binding sites
 |
Primer binding sites are DNA sequences specifically designed for oligo annealing. For example, most BioBrick plasmid backbones include binding sites for the VF2 and VR primers. |
 |
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G00000 | BioBrick cloning site prefix | gaattcgcggccgcttctagag | 22 |
| BBa_G00001 | BioBrick cloning site suffix | tactagtagcggccgctgcag | 21 |
| BBa_G00100 | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa | 20 |
| BBa_G00102 | Reverse BioBrick primer annealing site (VR binding site) | gctcactcaaaggcggtaat | 20 |
| BBa_K3464000 | Forward Primer for the detection of ancestral allele of the rs4149056 | tctgggtcatacatgtggatatatgt | 26 |
| BBa_K3464001 | Forward Primer for the detection of alternative allele of the rs4149056 | tctgggtcatacatgtggatatatgc | 26 |
| BBa_K3464002 | Reverse Primer for the detection of the rs4149056 | agcaaaggactattgaaagagtgaat | 26 |
| BBa_K4816001 | napA primer forward | cagtcacatatgatgaccatctcgcggc | 28 |
Spacer
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0040 | Spacer.1 (generic) | . . . cttacctcttaagaggtcactgacctaaca | 70 |
| BBa_K2483005 | sgRNA target site couples facing each other with 6 bp spacer | . . . cgtctgtaatcgccctttgtacgtgaacgg | 850 |
| BBa_K2483006 | sgRNA target site couples facing each other with 18 bp spacer | . . . ttgaccgcggtcttcctccacattcctgtc | 955 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K3831010 | Spacer_0 | . . . cttactctgttgaaaacgaatagataggtt | 40 |
| BBa_K3831011 | Spacer_1 | tgctcgtagtttacc | 15 |
| BBa_K3831012 | Spacer_5 | . . . agaatagtcaatcttcggaaatcccaggtg | 40 |
| BBa_K3831015 | Spacer_7 | taataaaaggtcccg | 15 |
| BBa_K3831023 | Spacer 03 | aaggaacggttattt | 15 |
| BBa_K3831026 | Spacer 02 | agattactactgata | 15 |
| BBa_K3831027 | Spacer 06 | ccgattctgagacgg | 15 |
| BBa_K3831028 | Spacer 04 | . . . aatacaggacccgaatcgtttcagttgcct | 40 |
| BBa_K3831038 | Spacer_SP1 | . . . ttaccacggatacagacagtgataatctta | 40 |
Single nucleotides
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G0009 | The nucleotide A | a | 1 |
| BBa_G0010 | The nucleotide C | c | 1 |
| BBa_G0011 | The nucleotide G | g | 1 |
| BBa_G0012 | The nucleotide T | t | 1 |
| BBa_K1402010 | Lac Promoter | . . . ccactagaaataattttgtttaactttaag | 79 |
| BBa_K361001 | Message gene template | . . . caagatagactaatagtcggatccctcgag | 438 |
| BBa_K4105001 | DNAzyme | . . . ttaggcccagtcctggcgccctctgtttga | 100 |
| BBa_K4105002 | a region of mif23 gene | . . . aatccgggtcaggaccgcgggagacaaact | 88 |
| BBa_K649204 | lox2272 | . . . cttcgtataggatactttatacgaagttat | 34 |
| BBa_M34014 | Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana | . . . ttttctttttgtttttaaataaatatttag | 2646 |
DNA origami parts
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_J35000 | Rothemund DNA origami part | tcctcttttgaggaacaagttttcttgt | 28 |
| BBa_J35001 | fork hairpin | . . . ccgcagttttctgcctcgttttcgaggggc | 32 |
| BBa_J35002 | dumbbell hairpin | gcctcttttgaggcgcaagttttcttgc | 28 |
| BBa_J35003 | 3-fingers arm | . . . gcctcgttttcgagggagttttctccgggc | 44 |
| BBa_J35004 | 4-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 63 |
| BBa_J35005 | 5-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 76 |
| BBa_J35006 | 6-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 89 |
| BBa_J35007 | 7-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 102 |
| BBa_J35120 | B-Z DNA switcher | tggacactaagctattcatc | 20 |
| BBa_K1479005 | -- No description -- | aattccggaattccgg | 16 |
DNA aptamer parts
| Name | Description | SS or DS | Target | Affinity | Sequence | Length |
|---|---|---|---|---|---|---|
| BBa_J36853 | T50 linkaptamer | . . . gcaatgataggcatatttatacggctcgga | 65 | |||
| BBa_J36854 | T35 linkaptamer | . . . gtatggaaaggattagcaatgataggcata | 50 | |||
| BBa_J36855 | T20 linkaptamer | . . . gtgtggttggaagtagtatggaaaggatta | 35 | |||
| BBa_J36856 | S50 linkaptamer | . . . tatgcctatcattgctaatcctttccatac | 90 | |||
| BBa_J36857 | S35 linkaptamer | . . . tatgcctatcattgctaatcctttccatac | 75 | |||
| BBa_J36858 | S20 linkaptamer | . . . tgtctcacagtttgctaatcctttccatac | 60 | |||
| BBa_J36859 | A15 adaptamer | . . . gtgtggttggaagtaatgtagaatggaaag | 98 | |||
| BBa_K1330000 | Spinach2.1 flanked by tRNALys3 | . . . tccagggttcaagtccctgttcgggcgcca | 168 | |||
| BBa_K1614009 | software generated kanamycin aptamer (candidate 1) | ttctctc | 7 | |||
| BBa_K1614013 | software generated kanamycin aptamer (candidate 2) | cggggat | 7 | |||
| BBa_K1636000 | Lead-II-ions-specific aptamer | gggtgggtgggtgggt | 16 | |||
| BBa_K2027049 | PQQ Aptamer #1 (15ADa9) | . . . ctaccctgatttgtaggatcgaggtaatcc | 100 | |||
| BBa_K2027050 | PQQ Aptamer #2 (15ADb11) | . . . tagggcacgctgtgtggatcgaggtaatcc | 100 | |||
| BBa_K3593000 | ssDNA, aptamer for α-amanitin(Best 1) | . . . ttttggtattgaggaacatgcgtcgcaaac | 80 | |||
| BBa_K3593007 | ssDNA, aptamer for β-amanitin | . . . gccccactgagaggaacatgcgtcgcaaac | 80 | |||
| BBa_K3724001 | IL-6 aptamer | . . . gcagatatgggccagcacagaatgaggccc | 57 | |||
| BBa_K3724005 | Lactoferrin Aptamer | . . . tatcgtaccctttatgctagattgtcctgc | 59 | |||
| BBa_K4213000 | Plant Thiamine Pyrophosphate Riboswitch | . . . tacagccataaaagaagtctttaactcgct | 675 | |||
| BBa_K4391000 | E. coli ATCC 25922 Aptamer | . . . ggggggtcatcgggatacctggtaaggata | 78 | |||
| BBa_K4391001 | Penicillin G Aptamer | . . . gtttttacgcctcagaagacacgcccgaca | 98 | |||
| BBa_K4391002 | Salmonella typhimurium Aptamer | . . . aaagatatgtgcgtctacctcttgactaat | 87 | |||
| BBa_K4391003 | ToxR Aptamer | . . . ctcatgttattttatgttttttgagaagat | 70 | |||
| BBa_K4983000 | selective aptamer sequence for deltamethrin identification and binding | . . . aggacagcgcgggaggttagcacgcggaat | 53 | |||
| BBa_K5334000 | A14#1 aptamer for Bevacizumab | gcggttggtggtagttacgttcgc | 24 | |||
| BBa_K5334001 | CU2#1 aptamer for Bevacizumab | gcgtttggtggtagttacgttcgc | 24 | |||
| BBa_K5334002 | CU2#2 aptamer for Bevacizumab | gcgcttggtggtagttacgttcgc | 24 | |||
| BBa_K5334003 | CU2#3 aptamer for Bevacizumab | gcgattggtggtagttacgttcgc | 24 | |||
| BBa_K5334004 | CU2#4 aptamer for Bevacizumab | gcgggtggtggtagttacgttcgc | 24 | |||
| BBa_K5334005 | CU2#5 aptamer for Bevacizumab | gcggctggtggtagttacgttcgc | 24 | |||
| BBa_K5334006 | CU2#6 aptamer for Bevacizumab | gcggatggtggtagttacgttcgc | 24 | |||
| BBa_K5334007 | CU2#7 aptamer for Bevacizumab | gcggtgggtggtagttacgttcgc | 24 | |||
| BBa_K5334008 | CU2#8 aptamer for Bevacizumab | gcggtcggtggtagttacgttcgc | 24 | |||
| BBa_K5334009 | CU2#9 aptamer for Bevacizumab | gcggtaggtggtagttacgttcgc | 24 | |||
| BBa_K5334010 | CU2#10 aptamer for Bevacizumab | gcggttggtgggagttacgttcgc | 24 | |||
| BBa_K5334011 | CU2#11 aptamer for Bevacizumab | gcggttggtggcagttacgttcgc | 24 | |||
| BBa_K5334012 | CU2#12 aptamer for Bevacizumab | gcggttggtggaagttacgttcgc | 24 | |||
| BBa_K5334013 | CU2#13 aptamer for Bevacizumab | gcggttggtggtagttaggttcgc | 24 | |||
| BBa_K5334014 | CU2#14 aptamer for Bevacizumab | gcggttggtggtagttatgttcgc | 24 | |||
| BBa_K5334015 | CU2#15 aptamer for Bevacizumab | gcggttggtggtagttaagttcgc | 24 | |||
| BBa_K5334016 | CU2#16 aptamer for Bevacizumab | gcggttggtggtagttaccttcgc | 24 | |||
| BBa_K5334017 | CU2#17 aptamer for Bevacizumab | gcggttggtggtagttactttcgc | 24 | |||
| BBa_K5334018 | CU2#18 aptamer for Bevacizumab | gcggttggtggtagttacattcgc | 24 | |||
| BBa_K5334019 | CU2#19 aptamer for Bevacizumab | gcggttggtggtagttacggtcgc | 24 | |||
| BBa_K5334020 | CU2#20 aptamer for Bevacizumab | gcggttggtggtagttacgctcgc | 24 | |||
| BBa_K5334021 | CU2#21 aptamer for Bevacizumab | gcggttggtggtagttacgatcgc | 24 | |||
| BBa_K5334022 | CU2#22 aptamer for Bevacizumab | gcggttggtggtagttacgtgcgc | 24 | |||
| BBa_K5334023 | CU2#23 aptamer for Bevacizumab | gcggttggtggtagttacgtccgc | 24 | |||
| BBa_K5334024 | CU2#24 aptamer for Bevacizumab | gcggttggtggtagttacgtacgc | 24 |