DNA/Assembly
BioBrick cloning sites • Other cloning sites • BioBrick restriction enzyme sites • BioBrick scars • BioScaffold sites •
BioBrick-compatible restriction enzyme sites • BioBrick-compatible scars • Other restriction enzyme sites • Other scars • Single nucleotides
BioBrick cloning sites
 |
To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site. The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site. |
 |
In most BioBrick plasmid backbones, including those constructed from the BioBrick base vector, the BioBrick prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information. |
There are no parts for this table
Other cloning sites
Some plasmid backbones available in the Registry adhere to other standards for physical composition or simply have multiple cloning sites typical of most molecular biology vectors. Parts encoding non-BioBrick cloning sites are listed here.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G00000 | BioBrick cloning site prefix | gaattcgcggccgcttctagag | 22 |
| BBa_G00001 | BioBrick cloning site suffix | tactagtagcggccgctgcag | 21 |
| BBa_I13450 | Removes BioBrick End | . . . agagtaataaactgtgataatcaatgcatg | 74 |
| BBa_I13452 | Adds another BioBrick site | . . . agattagtcacacgcgatccattgcagtgg | 52 |
| BBa_I13455 | Insertion site plus RNAse E cut site | . . . taggtcttcgaatccgatccattgcagtgg | 78 |
| BBa_I13456 | Insertion site plus RNAse E | . . . taggtcttcgaatccgatccattgcagtgg | 55 |
| BBa_I13457 | Improved insertion site with two RNAse E cut sites | . . . tctctcgagagattagtacctttggagatc | 111 |
| BBa_I732007 | BglII + BamHI | gaagatcttccggatccgg | 19 |
| BBa_J56011 | MCSII | ttaattaaggaaggaaactagt | 22 |
BioBrick restriction enzyme sites
 |
The BioBrick standard for physical composition includes the EcoRI, NotI, XbaI, SpeI, and PstI restriction sites. Parts encoding each of the BioBrick restriction enzyme sites are listed here. |
There are no parts for this table
BioBrick scars
 |
When a BioBrick part digested with EcoRI and SpeI is assembled with a BioBrick parts digested with XbaI and PstI, the partial SpeI and XbaI sites combined to form a mixed site or scar that cannot be cut by either SpeI or XbaI. A part encoding the BioBrick scar sequence is listed here. |
There are no parts for this table
BioScaffold sites
Bioscaffold sites are BioBrick parts that contain restriction enzyme recognition sites that enable full or partial removal of the Bioscaffold site from a composite BioBrick part. Bioscaffold parts address some of the limitations of BioBrick standard assembly by enabling protein fusions, cloning of part libraries within a composite BioBrick part, and removal of BioBrick scars.
 |
Julie Norville, as a graduate student in Tom Knight and Angie Belcher's lab at MIT, developed a new set of DNA parts called Bioscaffold sites. Bioscaffold sites can be assembled as regular BioBrick parts, but enable you to remove BioBrick scars, create protein fusions, and insert part libraries within composite parts. |
To learn more about BioScaffold sites, also see Help:Assembly_standard_15.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_J70010 | A BioScaffold Part (Uses PpiI), for offset see Part Design page | . . . taattaattaaacctggtgaacgtggtctc | 53 |
| BBa_J70012 | A BioScaffold Part (Uses PsrI), Protein Head Remover see Part Design page | . . . gcgccggcgcgccagctggtgaacaccagg | 52 |
| BBa_J70030 | A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page | . . . taattaattaaaccaggtgaacgtggtctc | 48 |
| BBa_J70032 | A Composite BioScaffold Part (PpiI and PsrI) for Protein Fusions (see Design Page) | . . . gcgccggcgcgccagctggtgaacaccagg | 138 |
| BBa_J70034 | A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page) | . . . gagtcccgggagctggaactcccacctgca | 45 |
| BBa_J70036 | A BioScaffold Part (Uses AarI) for Library Insert Preparation (see Part Design page) | . . . tcccgggagctggaactcccacctgcatat | 51 |
| BBa_J70040 | A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) | . . . gggtcccgggagcaccaggtcccacctgca | 45 |
| BBa_J70050 | Left Library Insert Preparation Part (To use with J70052, and J70040) | cacctgcatat | 11 |
| BBa_J70052 | Right Library Insert Preparation Part (To use with J70050, and J70040) | atagcaggtg | 10 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K606026 | tetO Array | . . . tctatcactgatagggacccccaactctgt | 3628 |
References
- [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15 BioBricks Foundation RFC 15] by Julie Norville, Angie Belcher and Tom Knight
BioBrick-compatible restriction enzyme sites
 |
Some restriction enzymes produce DNA ends that are compatible with the DNA ends produced by the BioBrick restriction enzymes. These BioBrick compatible restriction enzyme sites are useful for certain applications, such as building BioBrick vectors. We list the parts encoding those restriction enzymes sites here. |
There are no parts for this table
BioBrick-compatible scars
 |
When a DNA fragment digested with a BioBrick enzyme is assembled with a second DNA fragment digested with a BioBrick-compatible enzyme, the ligated DNA forms a mixed site or scar. Parts encoding the possible scars from BioBrick-compatible sites are listed here. |
There are no parts for this table
Other restriction enzyme sites
Parts encoding miscellaneous restriction enzyme sites, including those used in other physical composition standards, are listed here. Rich Roberts, who won the Nobel Prize in Physiology or Medicine in 1993 for his work on restriction enzymes, maintains a restriction enzyme database at http://rebase.neb.com.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0045 | NheI restriction enzyme site (XbaI, SpeI compatible overhang) | gctagc | 6 |
| BBa_B0046 | NsiI restriction enzyme site (PstI compatible overhang) | atgcat | 6 |
| BBa_B0047 | MfeI restriction enzyme site (EcoRI compatible overhang) | caattg | 6 |
| BBa_B0048 | AvrII restriction enzyme site (XbaI, SpeI compatible overhang) | cctagg | 6 |
| BBa_B0102 | SapI restriction enzyme site (offset cutter) | gctcttct | 8 |
| BBa_B0103 | SapI restriction enzyme site, reversed (offset cutter) | atgtgaagagctg | 13 |
| BBa_I11071 | KpnI restriction enzyme site with extra flanking nucleotides | atcggtaccgca | 12 |
| BBa_I11072 | AclI restriction enzyme site with extra nucleotides | gcaaacgttcga | 12 |
| BBa_I11073 | PvuI restriction enzyme site with extra flanking nucleotides | acacgatcggta | 12 |
| BBa_I11074 | XmaI restriction enzyme site with extra flanking nucleotides | attcccgggtca | 12 |
| BBa_I11075 | BmtI restriction enzyme site with extra flanking nucleotides | cttgctagc | 9 |
| BBa_I11076 | HindIII restriction enzyme site with extra flanking nucleotides | tacaagcttct | 11 |
| BBa_I11077 | SalI restriction enzyme site with extra flanking nucleotides | atcgtcgacgca | 12 |
| BBa_I11078 | SacII restriction enzyme site with extra flanking nucleotides | gcaccgcggcga | 12 |
| BBa_I11079 | MluI restriction enzyme site with flanking nucleotides | acaacgcgtgta | 12 |
| BBa_I11080 | ApaI restriction site with extra flanking nucleotides | cgtgggccctca | 12 |
| BBa_I11081 | BamHI restriction site with extra flanking nucleotides | caaggatcc | 9 |
| BBa_I11082 | XbaI restriction site with extra flanking nucleotides | ggatctagacc | 11 |
| BBa_K150008 | BamHI restriction enzyme site | ggatcc | 6 |
| BBa_K175002 | I-PpoI homing endonuclease site | ctctcttaaggtagc | 15 |
| BBa_K175027 | I-SceI restriction site | agttacgctagggataacagggtaatatag | 30 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K4816001 | napA primer forward | cagtcacatatgatgaccatctcgcggc | 28 |
| BBa_K792013 | BamHI restriction site (standalone) | ggatcc | 6 |
| BBa_M31950 | HpaI restriction enzyme site | gtt | 3 |
| BBa_M31952 | AatII restriction enzyme site | gacgtc | 6 |
| BBa_M31953 | Acc65I restriction enzyme site | ggtacc | 6 |
| BBa_M31955 | ApaI restriction enzyme site | gggccc | 6 |
| BBa_M31956 | AfeI restriction enzyme site | agcgct | 6 |
| BBa_M31958 | AseI restriction enzyme site | attaat | 6 |
| BBa_M31961 | BbvCI restriction enzyme site | cctcagc | 7 |
| BBa_M31962 | BccI restriction enzyme site | ccatc | 5 |
| BBa_M31964 | BciVI restriction enzyme site | gtatcc | 6 |
| BBa_M31965 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31967 | BfaI restriction enzyme site | ctag | 4 |
| BBa_M31968 | BfuAI restriction enzyme site | acctgc | 6 |
| BBa_M31982 | NotI restriction enzyme site | gcggccgc | 8 |
| BBa_M31983 | EcoRI restriction enzyme site | gaattc | 6 |
| BBa_M31984 | PspOMI restriction enzyme site | gggccc | 6 |
| BBa_M31985 | BglII restriction enzyme site | agatct | 6 |
| BBa_M31986 | EagI restriction enzyme site | cggccg | 6 |
| BBa_M31987 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31988 | MluI restriction enzyme site | acgcgt | 6 |
| BBa_M31989 | BssHII restriction enzyme site | gcgcgc | 6 |
| BBa_M31990 | AscI restriction enzyme site | ggcgcgcc | 8 |
| BBa_M31991 | XbaI restriction enzyme site | tctaga | 6 |
| BBa_M31992 | SpeI restriction enzyme site | actagt | 6 |
| BBa_M31995 | BsrGI restriction enzyme site | tgtaca | 6 |
| BBa_M31996 | BsiWI restriction enzyme site | cgtacg | 6 |
| BBa_M31997 | Acc65I restriction enzyme site | ggtacc | 6 |
Other scars
Other possible mixed sites or scars are listed here.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0104 | AvrII/XbaI mixed site | cctaga | 6 |
| BBa_B0105 | RFC 25 Scar Sequence | accggc | 6 |
| BBa_G0000 | SpeI/XbaI scar for RBS-CDS junctions | tactag | 6 |
| BBa_G0001 | XbaI/SpeI mixed site, reverse | ctctagta | 8 |
| BBa_G0002 | SpeI/XbaI mixed site | tactagag | 8 |
| BBa_G0003 | NheI/XbaI mixed site | gctagag | 7 |
| BBa_G0004 | SpeI/NheI mixed site | tactagc | 7 |
| BBa_G0005 | NheI/SpeI mixed site | gctagta | 7 |
| BBa_G0006 | XbaI/NheI mixed site | ctctagc | 7 |
| BBa_K106015 | AarI "A" site scar sequence | atgctcgagggagct | 15 |
| BBa_K106016 | AarI "B" site scar sequence | ggtagttcccta | 12 |
| BBa_K106017 | AarI "D" site scar sequence | tgcgggatcctgagtaaataagcggccgc | 29 |
| BBa_K112999 | BBb1 scar sequence | ggatct | 6 |
| BBa_K1319106 | RFC 25 Translation Start Scar Sequence | tactagatggccggc | 15 |
| BBa_K1319107 | RFC 25 Translation Stop Scar Sequence | accggttaatactagag | 17 |
| BBa_K245009 | RFC 37 Scar Sequence | tccggc | 6 |
Single nucleotides
 |
When specifying composite BioBrick parts, it can be helpful to sometimes specify a single nucleotide within the composite part. Thus, parts encoding each nucleotide alone are listed for convenience. |
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G0009 | The nucleotide A | a | 1 |
| BBa_G0010 | The nucleotide C | c | 1 |
| BBa_G0011 | The nucleotide G | g | 1 |
| BBa_G0012 | The nucleotide T | t | 1 |
| BBa_K1402010 | Lac Promoter | . . . ccactagaaataattttgtttaactttaag | 79 |
| BBa_K361001 | Message gene template | . . . caagatagactaatagtcggatccctcgag | 438 |
| BBa_K4105001 | DNAzyme | . . . ttaggcccagtcctggcgccctctgtttga | 100 |
| BBa_K4105002 | a region of mif23 gene | . . . aatccgggtcaggaccgcgggagacaaact | 88 |
| BBa_K649204 | lox2272 | . . . cttcgtataggatactttatacgaagttat | 34 |
| BBa_M34014 | Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana | . . . ttttctttttgtttttaaataaatatttag | 2646 |