Collections/Best Composite Part
Contents |
A composite part is a functional unit of DNA consisting of two or more basic parts assembled together. Generally, the Best Composite Part Award is given to a "device," a composite part that can function independently, without the need for further assembly. The iGEM community can improve upon these devices, use them as part of their designs, and/or use them as a foundation for new devices.
The following collection contains parts (and teams) that won, or were nominated, for the Best Composite Part award. Generally, these parts:
- are novel and/or provide a useful function
- are highly documented and characterized, with data and visualizations that show they work as expected
- adhere to the iGEM competition's requirements and the Registry's requirements for submissions
Note: These tables do not yet contain all award and nominees. We have updated these tables with information from iGEM Judging Forms (started in 2015), and awards from years before 2015 will need to be added manually.
Winners
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1658000 | Cinnamyl alcohol dehydrogenase CAD1 | Composite | Şeniz Yüksel, Burak Kızıl | 1231 | . . . tttatctgttgtttgtcggtgaacgctctc | |
BBa_K1689010 | N-luc-dCas9 | Composite | ZHANG Yihao | 5630 | 1 | . . . ctgatgtcaagcgtgtacgaatttgataat |
BBa_K1758377 | Biosensor device for detection of GHB and GBL | Composite | Team Bielefeld-CeBiTec 2015 | 1863 | . . . aagcttgggtaccgatcgcagaaagactaa | |
BBa_K1890002 | Silicatein gene, fused to transmembrane domain of OmpA, with strong RBS | Composite | Lycka Kamoen, Maria Vazquez | 1481 | . . . gctagtgatgcctcctaccccactctctag | |
BBa_K1991009 | Pcons-RBS-LO-AOX2-His | Composite | Chen, Pei-En | 2662 | . . . aggggttttttgctgaaaggaggaactata | |
BBa_K1993009 | CXCR4-T2A-Luciferase-IRES-eGFP | Composite | Su Xiaojun | 3366 | . . . actctcggcatggacgagctgtacaagtaa | |
BBa_K2206006 | Toehold switch for hsa-miR-15b-5p with GFPmut3b and inducible promoter | Composite | Sammy Lovat | 2014 | . . . catggcatggatgaactatacaaataataa | |
BBa_K2259091 | SynORI inducible plasmid copy number device | Composite | Laurynas Karpus | 925 | . . . accgttggtagcggtggtttttttgtttgc | |
BBa_K2306008 | Secretory-abundant heat soluble protein 33020 "SAHS 33020" (T7 promoter, RBS and double terminator) | Composite | Guillermo Serena Ruiz | 736 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2753018 | TALE2 sp1 | Composite | WEI KUANGYI | 3166 | . . . tcagaccggaaagcacatccggtgacagct | |
BBa_K2770002 | ycdW generator | Generator | Luca Brenker, Peter Gockel, Maria Musillo, Elena Nickels, Jan Benedict Spannenkrebs | 1060 | . . . catcaccatcaccatcatcatcatcattaa | |
BBa_K2796028 | Exosome booster | Coding | Shuangshuang Pu | 3874 | 2 | . . . tcccccggcaatcattacataaacagataa |
BBa_K2932003 | PliaI + RBS + CA + terminator | Composite | Ping-Yi Chen | 1173 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2980009 | CIB1-GCN(4)-mEGFP-FUSLCD | Coding | Ji Gao | 1713 | . . . atcactctcggcatggacgagctgtacaag | |
BBa_K3187000 | P22 Bacteriophage Coat Protein with LPETGG Tag for Sortase-mediated Ligation | Composite | iGEM TU_Darmstadt 2019 | 1650 | . . . tccggattggcgaatgggacgcgccctgta | |
BBa_K3352006 | T7 + RBS SplintR Ligase Expressing Construct | Composite | Hannah Hsu | 1124 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3370601 | T7 promoter + LacO + RBS + Harmonized GR with linker and GFP + 6x His-tag + Terminator | Composite | CHIH-LU CHIANG | 1877 | -1 | . . . gactgtccacgacgctatacccaaaagaaa |
BBa_K3407022 | Short hairpin RNA (shRNA) potential trigger of RNAi. Transcription controlled under T7 promoter. | Composite | Javier Navarro Delgado | 87 | -1 | . . . tgtaggtggcatcgccctcgccctcgccgg |
BBa_K3512042 | Atmosphere Regulated Killswitch | Device | Gourav Saha | 958 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3758301 | T7 Universal Test Construct 7.0 | T7 | Michael Burgis | 823 | -1 | . . . cccggtaggggcccacgcttgttggagacg |
BBa_K3893030 | Population control device (QS-based lysis protein oscilator) | Composite | Stefania Soledad Montesinos Ludena | 3200 | -1 | . . . ttcgggtgggcctttctgcgtttatacgct |
BBa_K4011008 | CBM3-NT2RepCT-CBM3 | Coding | Zixiang Zhou | 1995 | -1 | . . . aatggtgttctggtttggggtaaagaaccg |
BBa_K4150006 | T7P-g10.RBS-His-Ova-T7T | Composite | WEI CHIEH CHIN | 1363 | -1 | . . . gcctctaaacgggtcttgaggggttttttg |
BBa_K4156101 | pLldR | Regulatory | Zheng Huang | 1361 | -1 | . . . gcacatccggtgacagctaaagaggagaaa |
BBa_K4239008 | fiatlux genes with their promoter to emit luminescence | Translational_Unit | Guillaume FULCONIS | 5867 | -1 | . . . ttaagcttaaccgaagcgtttgatagttga |
BBa_K4735014 | NarK promoter fused to sfGFP | Composite | Asha Keshavarz | 980 | -1 | . . . tttatctgttgtttgtcggtgaacgctctc |
BBa_K4735015 | dmsA promoter driving superfolder GFP expression | Composite | Asha Keshavarz | 979 | -1 | . . . tttatctgttgtttgtcggtgaacgctctc |
Nominees
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1583102 | pRha + CsgA + Hydroxyapatite-affinity tag | Coding | Stefan Robert Marsden, Hector Sanguesa Ferrer | 684 | 1 | . . . gtctccgcgtccgtaactactagaaggagg |
BBa_K1598008 | J23101 promoter + RBS + Human FDXR + RBS + Human FDX1 + RBS + Human CYP11A1 + rrnb double terminator | Composite | Yash Mishra | 3910 | . . . gggaccaccgcgctactgccgccaggcaaa | |
BBa_K1610105 | pTS + RBS + yebF + ACT3m + Term | Composite | Leon Yim | 2743 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K1639000 | Toehold-GFP | Composite | Mustafa Yılmaz | 987 | . . . ggggttttttgctgaaaggaggaactatat | |
BBa_K1650006 | Constitutive promoter expressing GFP and constitutive promoter expressing RFP | Composite | Anna Knoerlein | 1830 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K1692021 | PanK + hybrid promoter phaCAB | Composite | Erica Lieberman | 5176 | 1 | . . . caacggcggcctgcatatgggctgacctgc |
BBa_K1720005 | Human phosphodiesterase 5A gene silencing device NO.3 | Device | Ying Guan , Yuanbin Cui | 304 | . . . cgagtaattggcatacaaagaatgcttttt | |
BBa_K1806005 | T7+ ibPB RNA Thermometer + RFP | Composite | İBRAHİM YASİR ORHAN | 976 | . . . ggggttttttgctgaaaggaggaactatat | |
BBa_K1825006 | 35s CaMV + nptII | Composite | Jonathan Asmund Arnesen | 1191 | . . . ttctatcgccttcttgacgagttcttctga | |
BBa_K1893016 | Arabinose inducible gp2 (pBAD+gp2) | Composite | Henry Lloyd-Laney, Stefan Grossfurthner | 1568 | . . . cgtgtgcgtccttgtgtagcaccgaagtaa | |
BBa_K1921021 | PETase+linker.b+GCW51 | Composite | Zhuozhi Chen | 1404 | . . . ggtggtgttgccattgccctattgatctag | |
BBa_K1954001 | Lycopene cassette under the control of NarK, an oxidative stress inducible promoter | Composite | Abbie Rogan | 3532 | . . . ggtttgatgctggaggatctgatataataa | |
BBa_K1963008 | Device for rhamnose-dependent expression of an OsmY fusion to E. coli Hfq.. | Composite | Frank Sargent | 1060 | . . . tccgcgcaacaggacagcgaagaaaccgaa | |
BBa_K1974033 | T7 Promoter+RBS+Hv1a+GS linker+snowdrop-lectin+linker+6X His-Tag | Composite | YU-CHUN WU | 101 | . . . gaggtgcaccaccaccaccatcacgtgtaa | |
BBa_K1997011 | P+R->sHRP-N->FRB->RBS->FKBP->sHRP-C->Ter | Composite | Xinyuan Qiu | 2019 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K1998000 | Mg-Chelatase Plasmid | Device | Shauna Winchester | 10938 | . . . gacaagattgagggagtcgaataataataa | |
BBa_K2082231 | RFP under the control of an optimized lacZ promoter combined with the protein SH2:cI434 | Composite | Pascal Schmidt | 1596 | . . . ccccgcccctgacagggcggggtttttttt | |
BBa_K2170002 | Secretory eukaryotic biotin binding receptor with single chain avidin | Device | Max Mustermann | 3813 | . . . cgtgaaccactgctcccttccctgtccttt | |
BBa_K2201373 | T3 polymerase with inverted mRFP under T3 promoter control for signal enhancing | Composite | Svenja Vinke | 3411 | . . . aagccattctccctttagtgagtgttaatt | |
BBa_K2230017 | Pcar-wRBS-PhlF-T-Pr-sRBS-GFP-sRBS-lysis-sRBS-NucA/pSB1C3 | Device | Yi-Lun Huang & Pei-Hong Chen | 2222 | . . . tggagcgaagacaacgctgattcaggtcaa | |
BBa_K2282011 | AmilCP with DSbox under Upelmt/CspA promoter + 5'UTR | Composite | Eliott LAFON | 1033 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2315034 | LasR-pLas-GFP HSL inducible fluorescent actuator | Measurement | FANG LUO, FANG BA | 1953 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2323004 | Lwa Cas13a under T7 promoter with solubility tag | Composite | Aurore Dupin | 4117 | . . . ttgaggggttttttgctgaaaggaggaact | |
BBa_K2333434 | pLac0-1 mf-Lon | Other | Ethan M Jones | 3944 | . . . tcctcaatcgcactggaaacatcaaggtcg | |
BBa_K2387032 | CpxR-eYFPn[1-154] and CpxR-eYPFc[155-238] + araC/pBAD promoter | Composite | Bart Scholten | 3424 | . . . actctcggcatggacgagctgtacaagtaa | |
BBa_K2398019 | Theophylline riboswitch - geneIII for application in Phage-assisted continous evolution (PACE) | Coding | Moritz Przybilla | 1314 | . . . tgcctatcaactcgagtagtactaagatct | |
BBa_K2446028 | SV40_8_ZF_43-8 promoter | Composite | Yijie Pan | 446 | . . . actactagagagtgaggacagagtgaggac | |
BBa_K2491027 | Combination of Part 1 and Part 2 of Phenanthrene Degradation - 100 | Project | Philippe Hansen-Estruch | 7241 | . . . accttcgggtgggcctttctgcgtttatat | |
BBa_K2560272 | tfoX of V. cholerae | Composite | Memduha Muratoglu | 1664 | . . . gggcctttctgcgtttatacgcttgagacc | |
BBa_K2571006 | Dual Expression of FucO and GSH | Composite | Tugba İnanc, Ceyhun Kayihan | 3644 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2581011 | Improved fatty acid acyl-CoA biosensor with weak RBS | Composite | Laura Sans Comerma | 912 | . . . aataacgctgatagtgctagtgtagatcgc | |
BBa_K2601011 | FKBP-yEGFP-HOTag3 | Composite | Yang Jianzhao | 1164 | . . . ctgaaagaaattgccaagtccctcaaaggg | |
BBa_K2621055 | CAT-Seq Esterase (Ready for Expression) | Composite | Laurynas Karpus | 1692 | . . . gccagttttacatgcttaaaagcataataa | |
BBa_K2675042 | OmpA-SAIRGA expression cassette | Composite | Esteban Lebrun | 224 | . . . cgaaaggggggccttttttcgttttggtcc | |
BBa_K2705006 | PgltAB-LacI-Pgrac-TetA | Translational_Unit | Danqing Tong | 2790 | . . . gtatataaacattctcaaagggatttctaa | |
BBa_K2715008 | Antisense RNA targeting C. difficile toxins composite 2 | Composite | Daniel Partridge | 519 | . . . taaagaagagttaataaaactcgcatatag | |
BBa_K2738006 | Ovispirin fused to N-ter of Ferritin protein | Composite | Darshak Bhatt | 613 | . . . gaattgtcgactcttgatacccagaattga | |
BBa_K2812005 | Coding sequence for trunctated Lysostaphin with HlyA and His6-tag regulated by T7-promoter | Composite | Guido Oerlemans, Maxime van den Oetelaar and Mariska Brüls | 1496 | . . . gcatcagcacaccaccaccaccaccactga | |
BBa_K2868015 | HHTC-Re-CBD x2 Copper Binding | Composite | Advait Patil | 660 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2885002 | Gold binding polypeptide (GBP) + Protein G (ProG) Fusion | Composite | Sungho Ko | 906 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K2933102 | His+Linker a+Sumo+Linker b+SPG-1 | Composite | Dongxu Li | 1213 | 1 | . . . caacaagcggcgaatgcggatcgtcgctaa |
BBa_K3007029 | Expression device of dsRed under uric-acid-responsive regulatory system | Coding | Cheng Li | 3252 | . . . atatcaagcttatcgataccgtcgacctcg | |
BBa_K3027004 | Arabinose-inducible nuclease_A1 expression module | Composite | Arnaud Boudigou | 3161 | . . . tttatctgttgtttgtcggtgaacgctctc | |
BBa_K3032076 | Ready to use mRFP1-CarH device (strong) | Device | Denis Baronas | 2000 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K3111502 | TmEncH_DARPin929_StrepII + miniSOG_TP | Composite | Matas Deveikis | 2348 | . . . gagagaccacgacgccggttactacattga | |
BBa_K3113302 | pCAG_Gag-HiBiT-L7Ae | Project | Alejandro Salinas Illarena | 3950 | . . . ggcttctgaggcggaaagaaccagctgggg | |
BBa_K3128019 | COMP fused with T18 subpart of Bordetella Pertussis AC under constitutive promoter | Composite | PINERO Lucas | 1354 | . . . caccttcgggtgggcctttctgcgtttata | |
BBa_K3134011 | T7-Cas1Cas2 | Composite | Shiyuan Li | 1274 | . . . ttaaggttggtgtcttttttacctgtttga | |
BBa_K3156888 | pLac Promoter-ssDNA[sfGFP(ON)]-Ec86-Beta | Composite | Tingzhen Liu | 2163 | . . . tcggtgaacgctctcctgagtaggacaaat | |
BBa_K3168004 | dCas9-LargeBitNanoLuc | Composite | Eva Hanckmann, Harm van der Veer, Claire Michielsen | 4680 | . . . tcatggagccatccgcagtttgaaaaataa | |
BBa_K3182100 | pT7-CBDcipA-pCons-AsPink | Composite | Oliver Hild Walett | 1334 | . . . gcaccgagcaagctgggtcataattaataa | |
BBa_K3198007 | HicA-LuxABCDE | Composite | Chunyang Song | 8199 | . . . atgtttgccgatgcttttgcatacgtataa | |
BBa_K3264024 | TALEsp-vioA-vioB-vioC-vioE | Device | Diol Wang | 9346 | . . . gtttggtacaagattggtcgcgtgaattga | |
BBa_K3376012 | ldhp-AQP-RBS-SpxB-Tr-tpxp-KatG-Tr/pSB1C3 | Composite | Li, Sheng-Fong | 5168 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3380500 | iSpinach fluorescent RNA aptamer construct under T7 RNA polymerase promoter (BBa_z0251) | RNA | Alexandru Popov | 183 | -1 | . . . ctgatgatccttcgggatcattcatggcaa |
BBa_K3431023 | zr31_ToeholdSwitch-Regulated Invertase | Composite | Jian-An Pan, Cheng-Yang Ma, Yi-Ching Chen, Shen-Lin Chen, Huan-Jui Chang | 1474 | -1 | . . . gcctctaaacgggtcttgaggggttttttg |
BBa_K3440014 | GFP under Plux in presence of LuxR and AHL | Composite | Julie Cordier | 1826 | -1 | . . . catggcatggatgaactatacaaataataa |
BBa_K3453111 | Rosewood DmMatK Toehold Switch 1.1 with sfGFP-LVAtag | Composite | Maeva Cherriere | 931 | -1 | . . . gctcttatcgggcggctaggggttttttgt |
BBa_K3457039 | T7-RBS-SAHS 33020-T7-RBS-CAHS 106094 | Composite | Yixian Yang | 1807 | -1 | . . . gcctctaaacgggtcttgaggggttttttg |
BBa_K3482017 | aTc and heat-inducible IM2 antitoxin | Composite | Thierry Marti | 523 | -1 | . . . cagattattaatccggcttttttattattt |
BBa_K3490001 | IPTG inducible NOS, over-express csgD and csgA | Composite | Ryan Huang | 3929 | -1 | . . . aataactctgatagtgctagtgtagatctc |
BBa_K3596056 | BIOT with RBS mut4 and Pilin gene mut4A | Composite | Xinyu Liu | 8580 | -1 | . . . ctggggtatctggcctggatctcttattaa |
BBa_K3606029 | P2 driven mcbABCD and PtetR driven mcbEFG | Composite | Gaochen Zhang | 5255 | -1 | . . . agggatgtcaatctctatcactgataggga |
BBa_K3661002 | YebF-IL 22 | Composite | Weixuan Lu | 903 | -1 | . . . atgtctctgagaaatgcctgcatttgataa |
BBa_K3686012 | Chitinase from Xenorhabdus nematophila (strain 19061), complete CDs, codon-optimized. | Coding | YingJie Lei | 2000 | -1 | . . . caactgccgaaggtcactcgccgcaagagc |
BBa_K3728008 | ldhp-Phi29 DNA pol-Tr/pTol2 | Composite | Eric Shih | 2080 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3730012 | miRNA sponge, to reduce specific types of free hsa-miR-199a, 195 and 22 level in cell | Composite | Yongyin Wang | 294 | -1 | . . . ggtctgaacactggggccaccatggaattc |
BBa_K3733044 | Toxin/antitoxin HepT/MntA suicide system working at low temperatures | Composite | Zhenhao Han | 1036 | -1 | . . . gtgatttttgtcttcttgcgctaatttttt |
BBa_K3736002 | Plux promoter + RBS + LL37 + RBS + mRFP + RBS + Terminator*2 | Composite | Yi Hua Li | 1884 | -1 | . . . gactgtccacgacgctatacccaaaagaaa |
BBa_K3739109 | K525998(T7-RBS)-LMT-his-CBM-hutH-B0010 | Composite | Shichen Geng | 2157 | -1 | . . . tttatctgttgtttgtcggtgaacgctctc |
BBa_K3755041 | CMV enhancer+CMV promoter+GCaMP6m+SV40 PolyA signal | Composite | Kaijun Wang | 1983 | -1 | . . . tggtttgtccaaactcatcaatgtatctta |
BBa_K3782022 | cspA-RBS-TEE-His-FfIBP-Term | Composite | Jana Näf | 1036 | -1 | . . . aatactagagtccctgccatttggcgggga |
BBa_K3798032 | Fusion protein sequence comprised with two CBD domain and one eGFP domain | Composite | Haohui Che | 1467 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3799057 | Bidirectional AIP-1 sensor | Reporter | Shubhamay Das, Debdeep Chatterjee | 3167 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3806016 | Theophylline-binding aptazyme regulating lacZ expression (semi-cRBS). With T7 promoter. | Composite | Laura Sierra Heras | 3315 | -1 | . . . gcctctaaacgggtcttgaggggttttttg |
BBa_K3829013 | P-ss-PETase-V5tag-Anchor protein 5105-T | Composite | Jing Zhou | 3363 | -1 | . . . atgccatacagtccctacttctaaaccaga |
BBa_K3886003 | Caffeine Sensor | Composite | Meng Fankang | 5422 | -1 | . . . cagattattaatccggcttttttattattt |
BBa_K3890000 | Pollen expressed CYP6G1 and GUS reporter circuit | Composite | Beatriz Toledo Akiti | 4157 | -1 | . . . gaaaaaccgcagcagggaggcaaacaatga |
BBa_K3895009 | kerBlMKU3_dna_pET-28a(+) | Composite | Rui Zhu | 1296 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3898166 | A delicate modular enzymes system to enhance PET plastic degradation at mild temperature | Coding | Yuliang Huo | 4284 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K3904005 | Bile-regulated and cold-inducible VapXD kill-switch | Composite | Ita Čiutaitė | 934 | -1 | . . . aaaaaccccgcttcggcggggttttttcgc |
BBa_K3963001 | pBAV1k-lacI-Trc-beta-agarase YM01-3 | Plasmid | Silja Malkewitz | 3636 | -1 | . . . ggtaataatcagcagtggaaatttcagtaa |
BBa_K3989011 | plant immune elicitor elf18 fused with ClyA for OMV display | Coding | Song-Yuan Zhang | 1101 | -1 | . . . aaaccgcacgttaacgttggtaccatcggt |
BBa_K4130000 | IgG F(c) Binding Protein, EibD | Composite | Sarah Broas | 1799 | -1 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_K4134066 | BpfA-Atox1-Linker-KanR-loxP-AggC | Device | Jiankai Liu | 3078 | -1 | . . . gctttacactctatacccaacccaaattaa |
BBa_K4162117 | ribozyme+RBS+CDS module: crtYEBI | DNA | Weiwen Chen | 4836 | -1 | . . . ggtttgatgctggaggatctgatataataa |
BBa_K4170016 | SUMO-LbuCas13a coding device under T7 promoter | Device | Alexandros Giannopoulos Dimitriou | 5404 | -1 | . . . gaagagaagaaaagcgagaattaataataa |
BBa_K4179020 | Luc_Blast_OraCell | Composite | Baraah Rashed | 3291 | -1 | . . . ctcatcaatgtatcttatcatgtctggatc |
BBa_K4192121 | Plac-obcA-obcB-Plac-Fpoar, Oxalate secretion gene circuit | Composite | Muhua Liu | 3750 | -1 | . . . cgggaatggcggcaagaagatcttctctga |
BBa_K4247025 | mCherry-SnoopCatcher | Coding | Matteo Soana | 1065 | -1 | . . . tacattactaacgagccaattccgcctaag |
BBa_K4271001 | T7 Promoter + Lac operator + RBS + OPH + T7 terminator | Composite | Ethan Ho | 1307 | -1 | . . . gcctctaaacgggtcttgaggggttttttg |
BBa_K4273020 | pTDH3-Np5598-tTDH1-pPGK1-NlmysD-tPGK1 | Composite | Su Junzhe | 4772 | -1 | . . . gtttttttttcccattcgatatttctatgt |
BBa_K4365021 | SP-SUMO-turboRFP | Device | Giorgio Gilioli | 2582 | -1 | . . . gttttgggacgctcgaaggctttaatttgc |
BBa_K4400002 | InaK+Tyrosinase | Coding | Xiangkai Li | 2025 | -1 | . . . gtaggctctggccatcaccaccaccaccac |
Teams and Wikis
Year | Team Name | Section | Prize |
---|---|---|---|
2022 | INSA_Lyon1 | Undergrad | Winner |
2022 | LZU-CHINA | Overgrad | Winner |
2022 | Mingdao | High School | Winner |
2022 | Rochester | Undergrad | Nominee |
2022 | Nanjing-China | Undergrad | Nominee |
2022 | Fudan | Undergrad | Nominee |
2022 | CAU_China | Undergrad | Nominee |
2022 | Thessaloniki_Meta | Overgrad | Nominee |
2022 | Technion-Israel | Overgrad | Nominee |
2022 | UCopenhagen | Overgrad | Nominee |
2022 | TU_Dresden | Overgrad | Nominee |
2022 | Wego_Taipei | High School | Nominee |
2022 | LINKS_China | High School | Nominee |
2022 | BFSU-ICUnited | High School | Nominee |
2022 | Worldshaper-NJBIOX | High School | Nominee |
2021 | Ecuador | Undergrad | Winner |
2021 | Marburg | Overgrad | Winner |
2021 | LINKS_China | High School | Winner |
2021 | ZJU-China | Undergrad | Nominee |
2021 | NCTU_Formosa | Undergrad | Nominee |
2021 | XMU-China | Undergrad | Nominee |
2021 | ShanghaiTech_China | Undergrad | Nominee |
2021 | IISER_Kolkata | Undergrad | Nominee |
2021 | DUT_China | Undergrad | Nominee |
2021 | Vilnius-Lithuania | Undergrad | Nominee |
2021 | HZAU-China | Overgrad | Nominee |
2021 | UNILausanne | Overgrad | Nominee |
2021 | TUDelft | Overgrad | Nominee |
2021 | USP-Brazil | Overgrad | Nominee |
2021 | Heidelberg | Overgrad | Nominee |
2021 | UZurich | Overgrad | Nominee |
2021 | Mingdao | High School | Nominee |
2021 | SHSBNU_China | High School | Nominee |
2021 | IvyMaker-China | High School | Nominee |
2021 | NDNF_China | High School | Nominee |
2021 | SZ_SHD | High School | Nominee |
2020 | NCTU_Formosa | Undergrad | Winner |
2020 | BITSPilani-Goa_India | Undergrad | Winner |
2020 | TUDelft | Overgrad | Winner |
2020 | TAS_Taipei | High School | Winner |
2020 | CSMU_Taiwan | Undergrad | Nominee |
2020 | NCKU_Tainan | Undergrad | Nominee |
2020 | Fudan | Undergrad | Nominee |
2020 | CPU_CHINA | Undergrad | Nominee |
2020 | Edinburgh | Overgrad | Nominee |
2020 | Stockholm | Overgrad | Nominee |
2020 | Evry_Paris-Saclay | Overgrad | Nominee |
2020 | UNILausanne | Overgrad | Nominee |
2020 | Mingdao | High School | Nominee |
2020 | QHFZ-China | High School | Nominee |
2020 | GreatBay_SZ | High School | Nominee |
2020 | SZ-SHD | High School | Nominee |
2019 | Tsinghua | Undergrad | Winner |
2019 | TU_Darmstadt | Overgrad | Winner |
2019 | Mingdao | High School | Winner |
2019 | TJUSLS_China | Undergrad | Nominee |
2019 | Vilnius-Lithuania | Undergrad | Nominee |
2019 | UCL | Undergrad | Nominee |
2019 | Grenoble-Alpes | Undergrad | Nominee |
2019 | NUS_Singapore | Undergrad | Nominee |
2019 | GO_Paris-Saclay | Overgrad | Nominee |
2019 | Munich | Overgrad | Nominee |
2019 | TU_Eindhoven | Overgrad | Nominee |
2019 | Linkoping_Sweden | Overgrad | Nominee |
2019 | QHFZ-China | High School | Nominee |
2019 | Nanjing_High_School | High School | Nominee |
2019 | SHSBNU_China | High School | Nominee |
2019 | GreatBay_SZ | High School | Nominee |
2018 | LZU-CHINA | Undergrad | Winner |
2018 | TU_Darmstadt | Overgrad | Winner |
2018 | GreatBay_China | High School | Winner |
2018 | UPF_CRG_Barcelona | Undergrad | Nominee |
2018 | Peking | Undergrad | Nominee |
2018 | NKU_CHINA | Undergrad | Nominee |
2018 | Nottingham | Undergrad | Nominee |
2018 | Stanford-Brown-RISD | Undergrad | Nominee |
2018 | Marburg | Overgrad | Nominee |
2018 | Vilnius-Lithuania-OG | Overgrad | Nominee |
2018 | Evry_Paris-Saclay | Overgrad | Nominee |
2018 | Paris_Bettencourt | Overgrad | Nominee |
2018 | TU-Eindhoven | Overgrad | Nominee |
2018 | METU_HS_Ankara | High School | Nominee |
2018 | BioMarvel | High School | Nominee |
2017 | Vilnius-Lithuania | Undergrad | Winner |
2017 | TUDelft | Overgrad | Winner |
2017 | CLSB-UK | High School | Winner |
2017 | Shanghaitech | Undergrad | Nominee |
2017 | William_and_Mary | Undergrad | Nominee |
2017 | Heidelberg | Undergrad | Nominee |
2017 | Fudan | Undergrad | Nominee |
2017 | Bielefeld-CeBiTec | Overgrad | Nominee |
2017 | IONIS-PARIS | Overgrad | Nominee |
2017 | Munich | Overgrad | Nominee |
2017 | Wageningen_UR | Overgrad | Nominee |
2017 | Mingdao | High School | Nominee |
2017 | CCA_San_Diego | High School | Nominee |
2017 | Worldshaper-XSHS | High School | Nominee |
2016 | SYSU-MEDICINE | Undergrad | Winner |
2016 | TU_Delft | Overgrad | Winner |
2016 | Mingdao | High School | Winner |
2016 | Imperial_College | Undergrad | Nominee |
2016 | UCL | Undergrad | Nominee |
2016 | NCTU_Formosa | Undergrad | Nominee |
2016 | NUDT_CHINA | Undergrad | Nominee |
2016 | TJUSLS_China | Overgrad | Nominee |
2016 | Macquarie_Australia | Overgrad | Nominee |
2016 | Bielefeld-CeBiTec | Overgrad | Nominee |
2016 | LMU-TUM_Munich | Overgrad | Nominee |
2016 | Dundee_Schools | High School | Nominee |