Collections/Probiotics
Revision as of 16:36, 20 July 2018 by Nathanribeiro (Talk | contribs)
This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.
This collection was created by iGEM Unesp Brazil 2018 Team
The microbiota plays an important role in several body functions and is correlated to various diseases and dysfunctions. For that reason, probiotics are being engineered to sense and control the production and delivery of therapeutic molecules, along with biocontainment modules to provide the biosafety needed for them to be used as living therapeutics.
To help future teams and scientists interested in engineer probiotics, our team created this collection with parts that have been used and created in the last years by iGEM teams to engineer probiotics using the most common probiotic chassis: Escherichia coli and Escherichia coli Nissle, Lactococcus lactis, Bacillus subtillis and Lactobacillus species.
The collection is organized into 4 categories: sense and control; production and delivery; memory and biocontainment, and according to the chassis in which that part was used or built. In that way, we hope to help people find the necessary modules and parts to build robust living therapeutics.
If your iGEM team is working or has worked with engineered probiotics, please feel free to help this collection grow by labeling your parts in these categories.
Sense and control
Escherichia coli
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_R0082 | Promoter (OmpR, positive) | Regulatory | Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) | 108 | 126 | . . . attattctgcatttttggggagaatggact |
| BBa_K118011 | PcstA (glucose-repressible promoter) | Regulatory | Andrew Hall | 131 | 17 | . . . tagaaacaaaatgtaacatctctatggaca |
| BBa_K216005 | PyeaR promoter, responsive to nitrate, nitrite and nitric oxide | Regulatory | Edinburgh iGEM 2009 | 100 | 30 | . . . aatgcaaattatcaggcgtaccctgaaacg |
| BBa_K318512 | gadA (pH promoter and RBS) | Regulatory | Sarah R. Sandock | 264 | 2 | . . . tattgccttcaaataaatttaaggagttcg |
| BBa_K554001 | flhDC promoter | Regulatory | UNICAMP EMSE Brazil team | 85 | 5 | . . . taaagttggttattctgggtgggaataatg |
| BBa_K239005 | NarK promoter, Fnr activated under anaerobic conditions | Regulatory | Axel Nystrom | 139 | 4 | . . . cctttagctacagacactaaggtggcagac |
| BBa_K223044 | SoxR - SoxS Promoter System | Regulatory | Suzanne Bartram | 776 | . . . aacgaactgtactagtagcggccgctgcag | |
| BBa_K234095 | Gal 1/10 divergent promoter | Regulatory | Daniel Jedrysiak | 686 | 2 | . . . caaggagaaaaaaccccggatcctattaaa |
| BBa_K875001 | T5 Cumate Operator | Regulatory | Federico Colombo, Elisa Clagnan | 85 | 4 | . . . caaacagacaatctggtctgtttgtattat |
| BBa_K1202116 | pLsr Complete System (Receiver) | Composite | safa tapan | 3450 | . . . agcctgtggaaagcaccgggtctgtaataa | |
| BBa_K1980004 | pCusC promoter | Regulatory | Sam Garforth | 98 | 1 | . . . agagcctggcgagtaaagttggcggcataa |
| BBa_K1980005 | pCopA sfGFP | Reporter | Sam Garforth | 810 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K1980008 | pCopA CueR sfGFP/ feedback pCopA sfGFP | Reporter | Sam Garforth | 1252 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K2447011 | Temperature sensitive promoter pTlpA | Regulatory | Chee Wai Kit (david) | 52 | 12 | . . . ttatttgttggtttgtttgtgttataatat |
| BBa_K2447013 | Temperature-sensitive repressible system | Regulatory | Chee Wai Kit (david) | 1409 | 3 | . . . ttatttgttggtttgtttgtgttataatat |
| BBa_K3733002 | EBS-PyeaR: The promoter responsive to nitrate with extra NarL binding site | Regulatory | Zhenhao Han | 116 | -1 | . . . aatgcaaattatcaggcgtaccctgaaacg |
| BBa_K3733004 | PphsA151-342 | Regulatory | Zhenhao Han | 192 | -1 | . . . ctaaggacaactgtcattgggagatttaac |
| BBa_K223041 | SoxS Promoter | Regulatory | Suzanne Bartram | 105 | 4 | . . . aacgaactgtactagtagcggccgctgcag |
| BBa_K2118000 | atoC Promoter | Regulatory | Laura Ros-Freixedes | 115 | 1 | . . . tttattatttttaaaagaggaaattaaacg |
| BBa_K2447014 | IPTG-inducible temperature-sensitive system with GFP reporter | Measurement | Chee Wai Kit (david) | 3516 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2447015 | Phosphate-dependent, temperature-sensitive cascaded system with GFP reporter | Measurement | Chee Wai Kit (david) | 2792 | . . . caccttcgggtgggcctttctgcgtttata |
Lactobacillus spp.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1725000 | PhlF repressible promoter | Regulatory | Mhairi Davidson | 48 | 7 | . . . atgatacgaaacgtaccgtatcgttaaggt |
| BBa_K128006 | L.bulgaricus LacS Promoter | Regulatory | Derek Ju | 197 | . . . aacaagttaacacacctaaaggagaatttc | |
| BBa_K559011 | Pgad - Intracellular Chloride-Sensing Cassette | Regulatory | Jacky, Fong Chuen, Loo | 1251 | 8 | . . . attcaatcataaatataaggaggtatgatg |
| BBa_K1130003 | L. plantarum RBS | RBS | Alicia Gabriela Quiroz Rocha | 33 | . . . atcgcaagacaaattagaaggaggtataga | |
| BBa_K2230012 | Pcar-wRBS-PhlF-T-Pr-sRBS-GFP/pSB1C3 | Device | Yi-Lun Huang | 1577 | 2 | . . . catggcatggatgaactatacaaataataa |
| BBa_K2253000 | Constitutive P8 promoter and RBS composite | Composite | Andrew Ly | 169 | . . . ttgatatagcagcagaaatggagagatata | |
| BBa_K2253001 | Constitutive P32 promoter and RBS composite | Composite | Andrew Ly | 153 | . . . aggtaaaaaaatattcggaggaattttgaa | |
| BBa_K861170 | PI ,Glucose-activated promoter | Regulatory | Kuanwei Sheng | 36 | 8 | . . . gctagctcaaatgtgattataatcacattt |
Lactococcus lactis
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1033219 | Promoter CP1 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . ctcgggttgatataatatctcagtactgtt | |
| BBa_K1033220 | Promoter CP8 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . tgaggactgatataataggtgagtactgtt | |
| BBa_K1033221 | Promoter CP11 | Regulatory | Stephanie Herman, Alona Nyberg | 59 | 3 | . . . cccccctttgatataataagtagtactgtt |
| BBa_K1033222 | Promoter CP29 | Regulatory | Stephanie Herman, Alona Nyberg | 59 | 4 | . . . ggggacgtggtataataactgagtactgtt |
| BBa_K1033223 | Promoter CP30 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . gttactttggtataatagttgagtactgtt | |
| BBa_K1033224 | Promoter CP41 | Regulatory | Stephanie Herman, Alona Nyberg | 60 | . . . gtagacgtggtataatagttaagtactgtt | |
| BBa_K1033225 | Promoter CP44 | Regulatory | Stephanie Herman, Alona Nyberg | 59 | 3 | . . . tagagcctgatataatagttcagtactgtt |
| BBa_K2270005 | gal promoter from Lactococcus lactis | Regulatory | Nathan Vinicius Ribeiro, Danielle Biscaro Pedrolli | 218 | 2 | . . . agtgttatactctaaatgtgagcgatttca |
| BBa_K2270006 | regulatory small RNA for L. lactis | RNA | Nathan Vinicius Ribeiro, Danielle Biscaro Pedrolli | 109 | 1 | . . . aaatgaagaagaaactgtgaagcgtattta |
| BBa_K2270008 | galP-sRNA-rrnb(Bs) | Composite | Nathan Vinicius Ribeiro | 327 | 1 | . . . aaatgaagaagaaactgtgaagcgtattta |
| BBa_K2253000 | Constitutive P8 promoter and RBS composite | Composite | Andrew Ly | 169 | . . . ttgatatagcagcagaaatggagagatata | |
| BBa_K2253001 | Constitutive P32 promoter and RBS composite | Composite | Andrew Ly | 153 | . . . aggtaaaaaaatattcggaggaattttgaa | |
| BBa_K2660002 | gal promoter driving the expression of TetR | Regulatory | Nathan Vinicius Ribeiro | 1066 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
Bacillus subtilis
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K2660002 | gal promoter driving the expression of TetR | Regulatory | Nathan Vinicius Ribeiro | 1066 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K2660005 | T7 RNA Polymerase regulated by TetR | Generator | Danielle Biscaro Pedrolli, Nathan Vinicius Ribeiro | 2872 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K2660010 | glucose-responsive regulatory circuit | Generator | Danielle Biscaro Pedrolli, Nathan Vinicius Ribeiro | 5044 | . . . actggtggtatggatgaactttacaaataa |
Production and delivery
Escherichia coli
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K569017 | CheY | Coding | David Golynskiy and Tyler Guinn | 418 | 2 | . . . agaaactgggcatgtccctttttgcaggtg |
| BBa_K912000 | Citrobacter braakii phytase | Coding | Grant Nicholas | 1302 | 4 | . . . cgcgtgccagagtgtgcagttacggaataa |
| BBa_K899001 | Fructan fructan fructosyltransferase (FFT) | Coding | Andreas Kjr | 1848 | 4 | . . . tctgcaccaattcatcaataccctttttaa |
| BBa_K1033000 | Tyrosine ammonia-lyase (TAL) with RBS | Coding | Karl Holdar, Hampus Elofsson, Emil Marklund, Kristoffer Lundmark, Marcus Hong, Lovisa Pettersson, Ken Braech-Andersen, Theodor Lwe | 1596 | 3 | . . . cacctcttgcagcaatctcccgtctgataa |
| BBa_K1692004 | codon optimized PAL with T7 promoter and Flag Tag | Coding | Daniel Kunin | 1858 | . . . actgggcctttcgttttatctgttgtttgt | |
| BBa_K569007 | CheZ mutant | Coding | David Golynskiy & Tyler Guinn | 664 | 1 | . . . ttggattttgatttgtattgcctgatgtgg |
| BBa_K899000 | Sucrose sucrose fructosyltransferase (SST) | Coding | Andreas Kjr | 1893 | 4 | . . . cctcttcctgggtggactttcgaactttga |
| BBa_K875020 | β-Glucosidase | Composite | Federico Colombo, Elisa Clagnan, Marija Drikic, Giorgio Gargari, Giulia Corso, Sara Samari | 1653 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K875004 | T5LacO-LPP-OmpA-scFv (scFv 54.6 antinorovirus)-6HIS-TT | Composite | Marija Drikic, Giorgio Gargari | 1516 | 5 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K875005 | T5LacO-LPP-OmpA-SIP (scFv 54.6 + alpha isotype CH3 antinorovirus)-6HIS-TT | Composite | Marija Drikic, Giorgio Gargari | 1906 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K875007 | T5 LacO-PelB-SIP (scFv 54.6 + alpha isotype CH3 antinorovirus)-6HIS-TT | Composite | Marija Drikic, Giorgio Gargari | 1529 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K875006 | T5LacO-PelB-scFv (scFv 54.6 antinorovirus)-6HIS-TT | Composite | Marija Drikic, Giorgio Gargari | 1121 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1033002 | stilbene synthase (STS) with RBS | Coding | Lovisa Pettersson | 1200 | 1 | . . . ctacatagcattcctatggttacaaattaa |
| BBa_K1033001 | 4-coumarate ligase (4CL) with RBS | Coding | Karl Holdar | 1708 | 2 | . . . ctgagggcaaaactagcaaatggattgtaa |
| BBa_K1205000 | Carnitine Dehydrogenase Protein | Coding | Blake Wilhelmsen | 2431 | . . . cgggtgatcggcctgccgccggtgcgctga | |
| BBa_K1190003 | Yeb-F GMCSF | Coding | Khateeb H. Hussain | 789 | . . . cctttcgattgctgggagcctgtgcaggaa | |
| BBa_K1033115 | Histidine Patch Thioredoxin | Coding | Sabri Jamal | 354 | . . . gagttcctcgacgctaacctggccggctaa | |
| BBa_K1639006 | PotB59-pomA | Coding | Mustafa Yılmaz | 1733 | . . . gcgcactggaaattgacgaactcgagtaat | |
| BBa_K1639007 | DAMP-Pexiganan | Translational_Unit | Mustafa Yılmaz | 694 | . . . ctgcgtttatactgaaaggaggaactatat | |
| BBa_K1639008 | Tev Protease, single S219V mutation in the internal cleavage site | Coding | Mustafa Yılmaz | 750 | 1 | . . . aactggtgtatagccaataataactcgagt |
| BBa_K1954001 | Lycopene cassette under the control of NarK, an oxidative stress inducible promoter | Composite | Abbie Rogan | 3532 | . . . ggtttgatgctggaggatctgatataataa | |
| BBa_K1980000 | TAT Copper Storage Protein 1 | Coding | Sam Garforth | 474 | 1 | . . . gcggcccatcatcaccaccatcactaataa |
| BBa_K1980002 | MymT | Coding | Sam Garforth | 183 | 3 | . . . gtgaaacatcatcaccaccatcactaataa |
| BBa_K1983013 | Phenylalanine-specific permease (PheP) from Escherichia coli | Coding | Vykintas Jaunikis | 1416 | 5 | . . . gtggcatttaaaacgctgcgtcggaaataa |
| BBa_K2118001 | patA gene | Coding | Laura Ros-Freixedes | 1400 | 1 | . . . gccatgcgtgttagcgtggaagaagcataa |
| BBa_K2118002 | FMS1 gene | Coding | Laura Ros-Freixedes | 1547 | 1 | . . . gcaacccgtattagcgatctgctgaaataa |
| BBa_K2235011 | Sialidase enzyme coding composite N terminally attached to secretion system type 1 | Composite | Shivashree Dhanaraj and Shanlin Tong | 6915 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2230022 | STM1128/pSB1C3 | Coding | Yi-Lun Huang & Pei-Hong Chen | 1497 | 1 | . . . gaaaaacctgaaccaaaggtgacattatga |
| BBa_K2660001 | T7 promoter driving 6-his tagged GFP with penetratin | Reporter | Danielle Biscaro Pedrolli, Paulo Jose Correa Freire | 981 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K223042 | Blh Gene: Cleaves beta-carotene into retinal | Generator | Suzanne Bartram | 869 | 4 | . . . aaaaactgatactagtagcggccgctgcag |
| BBa_K223043 | RALDH II gene: Converts retinal into retinoic acid | Generator | Suzanne Bartram | 1579 | 3 | . . . aactcctaatactagtagcggccgctgcag |
| BBa_K1514005 | TOR-A TAT signaling domain for bacteria | Protein_Domain | Carlos Goncalves | 159 | . . . actgacgctgtcatctcgaaagagggcatt | |
| BBa_K2235005 | Sialidase enzyme | Coding | Shanlin Tong, Shivashree Dhanaraj, Sina Amoor Pour and Gilai Nachmann | 1548 | 3 | . . . gtggctccgcaagtgggccttaccatctaa |
| BBa_K2235008 | Endo beta galactosidase | Coding | Shanlin Tong, Shivashree Dhanaraj, Sina Amoor Pour and Gilai Nachmann | 1293 | 1 | . . . catcatcatcatcatcatcatcatcactaa |
| BBa_K2660000 | Penetratin, cell-penetrating peptide | Coding | Danielle Biscaro Pedrolli, Paulo Jose Correa Freire | 51 | 1 | . . . tttcaaaacagaagaatgaaatggaaaaaa |
Lactobacillus spp.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1033000 | Tyrosine ammonia-lyase (TAL) with RBS | Coding | Karl Holdar, Hampus Elofsson, Emil Marklund, Kristoffer Lundmark, Marcus Hong, Lovisa Pettersson, Ken Braech-Andersen, Theodor Lwe | 1596 | 3 | . . . cacctcttgcagcaatctcccgtctgataa |
| BBa_K128003 | p1025 | Coding | Sara Mouradian | 101 | . . . cgttctggttactagtagcggccgctgcag | |
| BBa_K128004 | signal sequence from Lactobacillus bulgaricus; secretes protein | Tag | Sara Mouradian | 143 | . . . agctgccagtcaagaaacgctccggttacc |
Lactococcus lactis
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K2230022 | STM1128/pSB1C3 | Coding | Yi-Lun Huang & Pei-Hong Chen | 1497 | 1 | . . . gaaaaacctgaaccaaaggtgacattatga |
| BBa_K2660003 | mCherry codon optimized for Lactococcus lactis | Coding | Nathan Vinicius Ribeiro | 724 | 2 | . . . actggtggtatggatgaactttacaaataa |
| BBa_K2660011 | T7 promoter driving mCherry production | Reporter | Nathan Vinicius Ribeiro | 755 | 1 | . . . actggtggtatggatgaactttacaaataa |
Bacillus subtilis
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K2660001 | T7 promoter driving 6-his tagged GFP with penetratin | Reporter | Danielle Biscaro Pedrolli, Paulo Jose Correa Freire | 981 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2660004 | Pveg constitutively driving expression of mCherry | Reporter | Danielle Biscaro Pedrolli, Nathan Vinicius Ribeiro | 829 | . . . actggtggtatggatgaactttacaaataa | |
| BBa_K2660000 | Penetratin, cell-penetrating peptide | Coding | Danielle Biscaro Pedrolli, Paulo Jose Correa Freire | 51 | 1 | . . . tttcaaaacagaagaatgaaatggaaaaaa |
| BBa_K2660003 | mCherry codon optimized for Lactococcus lactis | Coding | Nathan Vinicius Ribeiro | 724 | 2 | . . . actggtggtatggatgaactttacaaataa |
| BBa_K2660011 | T7 promoter driving mCherry production | Reporter | Nathan Vinicius Ribeiro | 755 | 1 | . . . actggtggtatggatgaactttacaaataa |
Biocontainment
Escherichia coli
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K112000 | T4 holin, complete CDS, berkeley standard | Coding | Bing Xia | 657 | 6 | . . . gcggccagaatattaggaagggctaaataa |
| BBa_K875009 | LL 37 - Cathelicidin | Coding | Giulia Corso, Sara Samari | 123 | 5 | . . . ctggtgccgcgcaccgaaagctaataataa |
| BBa_K131010 | AHL Inducible Colicin E2 with GFP | Generator | Kevin McLeod | 4144 | . . . aatgtcacaaaaattccatgtgggagatgg | |
| BBa_K314200 | Toxin Tse2 | Coding | Matthew Coyne, Ingrid Swanson, Jesa Landis, Matthew Harger | 477 | 4 | . . . cgccaatgggaaaaagcccgcgggctctag |
| BBa_K875008 | IPTG inducible Tse2 toxin | Coding | Giulia Corso, Sara Samari | 722 | 2 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1976048 | DNase domain of Colicin E2 | Coding | Alana Gouveia, Franziska Hameister, Jonas Sindlinger, Maik Schork | 401 | 6 | . . . tcatattgacatccaccgcggaaagtaaaa |
| BBa_K150007 | ColicinE1 operon | Composite | Pascal Kraemer | 2092 | 1 | . . . tctaaactgacggggatcgcggttcagtgg |
| BBa_K150010 | ColicinE9 operon | Composite | Pascal Kraemer | 2040 | 1 | . . . tttttgaaatgtcacaaaagttctcatgtg |
| BBa_K150012 | colicinE9 operon (short) | Composite | Pascal Kraemer | 1024 | 1 | . . . tctgcatggggttctaagccgaaaacctag |
| BBa_K912030 | pH Inducible Lysis System(w) | Composite | Grant Nicholas | 4515 | . . . aaggccgcatcagccagcgagaatacttga | |
| BBa_K912031 | pH Inducible Lysis System(m) | Composite | Grant Nicholas | 4515 | . . . aaggccgcatcagccagcgagaatacttga | |
| BBa_K2447016 | Phosphate-dependent, temperature-sensitive cascaded system with IM2 expression | Composite | Chee Wai Kit (david) | 2333 | . . . caccttcgggtgggcctttctgcgtttata |
Lactobacillus spp.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K117000 | Lysis gene (promotes lysis in colicin-producing bacteria strain) | Coding | Nguyen Xuan Hung | 144 | 18 | . . . gctgaactgaccggagtggaaacgcagtaa |
| BBa_K1159105 | Mature Nuclease NucA from Staphylococcus aureus (Thermonuclease) in RFC[25] | Coding | Dong-Jiunn Jeffery TRUONG | 447 | 4 | . . . tggagcgaagacaacgctgattcaggtcaa |
Lactococcus lactis
There are no parts for this table
Bacillus subtilis
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K2660006 | N-Cas9 | Coding | Victor Nunes de Jesus, Danielle Biscaro Pedrolli | 3459 | . . . ctagtggttgctaaggtggaaaaagggaaa | |
| BBa_K2660007 | C-Cas9 | Coding | Danielle Biscaro Pedrolli,Victor Nunes de Jesus | 648 | . . . attgatttgagtcagcttggcggtgactga | |
| BBa_K2660008 | nMag | Coding | Danielle Biscaro Pedrolli,Victor Nunes de Jesus | 450 | . . . tattcaatgggatttcaatgtgaaacagaa | |
| BBa_K2660009 | pMag | Coding | Danielle Biscaro Pedrolli, Victor Nunes de Jesus | 450 | . . . tattcaatgggatttcaatgcgaaacagaa |
Memory
Escherichia coli
There are no parts for this table
Lactobacillus spp.
There are no parts for this table
Lactococcus lactis
There are no parts for this table
Bacillus subtilis
There are no parts for this table