Collections/Probiotics

This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.


This collection was created by iGEM Unesp Brazil 2018 Team

The microbiota plays an important role in several body functions and is correlated to various diseases and dysfunctions. For that reason, probiotics are being engineered to sense and control the production and delivery of therapeutic molecules, along with biocontainment modules to provide the biosafety needed for them to be used as living therapeutics.

To help future teams and scientists interested in engineer probiotics, our team created this collection with parts that have been used and created in the last years by iGEM teams to engineer probiotics using the most common probiotic chassis: Escherichia coli and Escherichia coli Nissle, Lactococcus lactis, Bacillus subtillis and Lactobacillus species.

The collection is organized into 4 categories: sense and control; production and delivery; memory and biocontainment, and according to the chassis in which that part was used or built. In that way, we hope to help people find the necessary modules and parts to build robust living therapeutics.

If your iGEM team is working or has worked with engineered probiotics, please feel free to help this collection grow by labeling your parts in these categories.

Sense and control

Escherichia coli


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_R0082Promoter (OmpR, positive)RegulatoryStephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004)108126 . . . attattctgcatttttggggagaatggact
BBa_K118011PcstA (glucose-repressible promoter)RegulatoryAndrew Hall13117 . . . tagaaacaaaatgtaacatctctatggaca
BBa_K216005PyeaR promoter, responsive to nitrate, nitrite and nitric oxideRegulatoryEdinburgh iGEM 200910030 . . . aatgcaaattatcaggcgtaccctgaaacg
BBa_K318512gadA (pH promoter and RBS)RegulatorySarah R. Sandock2642 . . . tattgccttcaaataaatttaaggagttcg
BBa_K554001flhDC promoterRegulatoryUNICAMP EMSE Brazil team855 . . . taaagttggttattctgggtgggaataatg
BBa_K239005NarK promoter, Fnr activated under anaerobic conditions RegulatoryAxel Nystrom1394 . . . cctttagctacagacactaaggtggcagac
BBa_K223044SoxR - SoxS Promoter SystemRegulatorySuzanne Bartram776  . . . aacgaactgtactagtagcggccgctgcag
BBa_K234095Gal 1/10 divergent promoterRegulatoryDaniel Jedrysiak6862 . . . caaggagaaaaaaccccggatcctattaaa
BBa_K875001T5 Cumate OperatorRegulatoryFederico Colombo, Elisa Clagnan854 . . . caaacagacaatctggtctgtttgtattat
BBa_K1202116pLsr Complete System (Receiver)Compositesafa tapan3450  . . . agcctgtggaaagcaccgggtctgtaataa
BBa_K1980004pCusC promoterRegulatorySam Garforth981 . . . agagcctggcgagtaaagttggcggcataa
BBa_K1980005pCopA sfGFPReporterSam Garforth810  . . . tacaaacatcatcaccaccatcactaataa
BBa_K1980008pCopA CueR sfGFP/ feedback pCopA sfGFPReporterSam Garforth1252  . . . tacaaacatcatcaccaccatcactaataa
BBa_K2447011Temperature sensitive promoter pTlpARegulatoryChee Wai Kit (david)5212 . . . ttatttgttggtttgtttgtgttataatat
BBa_K2447013Temperature-sensitive repressible systemRegulatoryChee Wai Kit (david)14093 . . . ttatttgttggtttgtttgtgttataatat
BBa_K3733002EBS-PyeaR: The promoter responsive to nitrate with extra NarL binding siteRegulatoryZhenhao Han116-1 . . . aatgcaaattatcaggcgtaccctgaaacg
BBa_K3733004PphsA151-342RegulatoryZhenhao Han192-1 . . . ctaaggacaactgtcattgggagatttaac
BBa_K223041SoxS PromoterRegulatorySuzanne Bartram1054 . . . aacgaactgtactagtagcggccgctgcag
BBa_K2118000atoC PromoterRegulatoryLaura Ros-Freixedes1151 . . . tttattatttttaaaagaggaaattaaacg
BBa_K2447014IPTG-inducible temperature-sensitive system with GFP reporterMeasurementChee Wai Kit (david)3516  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2447015Phosphate-dependent, temperature-sensitive cascaded system with GFP reporter MeasurementChee Wai Kit (david)2792  . . . caccttcgggtgggcctttctgcgtttata


Lactobacillus spp.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1725000PhlF repressible promoterRegulatoryMhairi Davidson487 . . . atgatacgaaacgtaccgtatcgttaaggt
BBa_K128006L.bulgaricus LacS PromoterRegulatoryDerek Ju197  . . . aacaagttaacacacctaaaggagaatttc
BBa_K559011Pgad - Intracellular Chloride-Sensing CassetteRegulatoryJacky, Fong Chuen, Loo12518 . . . attcaatcataaatataaggaggtatgatg
BBa_K1130003L. plantarum RBSRBSAlicia Gabriela Quiroz Rocha 33  . . . atcgcaagacaaattagaaggaggtataga
BBa_K2230012Pcar-wRBS-PhlF-T-Pr-sRBS-GFP/pSB1C3DeviceYi-Lun Huang15772 . . . catggcatggatgaactatacaaataataa
BBa_K2253000Constitutive P8 promoter and RBS compositeCompositeAndrew Ly169  . . . ttgatatagcagcagaaatggagagatata
BBa_K2253001Constitutive P32 promoter and RBS compositeCompositeAndrew Ly153  . . . aggtaaaaaaatattcggaggaattttgaa
BBa_K861170PI ,Glucose-activated promoterRegulatoryKuanwei Sheng368 . . . gctagctcaaatgtgattataatcacattt


Lactococcus lactis


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1033219Promoter CP1RegulatoryStephanie Herman, Alona Nyberg60  . . . ctcgggttgatataatatctcagtactgtt
BBa_K1033220Promoter CP8RegulatoryStephanie Herman, Alona Nyberg60  . . . tgaggactgatataataggtgagtactgtt
BBa_K1033221Promoter CP11RegulatoryStephanie Herman, Alona Nyberg593 . . . cccccctttgatataataagtagtactgtt
BBa_K1033222Promoter CP29RegulatoryStephanie Herman, Alona Nyberg594 . . . ggggacgtggtataataactgagtactgtt
BBa_K1033223Promoter CP30RegulatoryStephanie Herman, Alona Nyberg60  . . . gttactttggtataatagttgagtactgtt
BBa_K1033224Promoter CP41RegulatoryStephanie Herman, Alona Nyberg60  . . . gtagacgtggtataatagttaagtactgtt
BBa_K1033225Promoter CP44RegulatoryStephanie Herman, Alona Nyberg593 . . . tagagcctgatataatagttcagtactgtt
BBa_K2270005gal promoter from Lactococcus lactisRegulatoryNathan Vinicius Ribeiro, Danielle Biscaro Pedrolli2182 . . . agtgttatactctaaatgtgagcgatttca
BBa_K2270006regulatory small RNA for L. lactisRNANathan Vinicius Ribeiro, Danielle Biscaro Pedrolli1091 . . . aaatgaagaagaaactgtgaagcgtattta
BBa_K2270008galP-sRNA-rrnb(Bs)CompositeNathan Vinicius Ribeiro3271 . . . aaatgaagaagaaactgtgaagcgtattta
BBa_K2253000Constitutive P8 promoter and RBS compositeCompositeAndrew Ly169  . . . ttgatatagcagcagaaatggagagatata
BBa_K2253001Constitutive P32 promoter and RBS compositeCompositeAndrew Ly153  . . . aggtaaaaaaatattcggaggaattttgaa
BBa_K2660002gal promoter driving the expression of TetRRegulatoryNathan Vinicius Ribeiro10661 . . . caccttcgggtgggcctttctgcgtttata


Bacillus subtilis


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K2660002gal promoter driving the expression of TetRRegulatoryNathan Vinicius Ribeiro10661 . . . caccttcgggtgggcctttctgcgtttata
BBa_K2660005T7 RNA Polymerase regulated by TetRGeneratorDanielle Biscaro Pedrolli, Nathan Vinicius Ribeiro28721 . . . caccttcgggtgggcctttctgcgtttata
BBa_K2660010glucose-responsive regulatory circuitGeneratorDanielle Biscaro Pedrolli, Nathan Vinicius Ribeiro5044  . . . actggtggtatggatgaactttacaaataa

Production and delivery

Escherichia coli


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K569017CheYCodingDavid Golynskiy and Tyler Guinn4182 . . . agaaactgggcatgtccctttttgcaggtg
BBa_K912000Citrobacter braakii phytase CodingGrant Nicholas13024 . . . cgcgtgccagagtgtgcagttacggaataa
BBa_K899001Fructan fructan fructosyltransferase (FFT)CodingAndreas Kjr18484 . . . tctgcaccaattcatcaataccctttttaa
BBa_K1033000Tyrosine ammonia-lyase (TAL) with RBSCodingKarl Holdar, Hampus Elofsson, Emil Marklund, Kristoffer Lundmark, Marcus Hong, Lovisa Pettersson, Ken Braech-Andersen, Theodor Lwe15963 . . . cacctcttgcagcaatctcccgtctgataa
BBa_K1692004codon optimized PAL with T7 promoter and Flag TagCodingDaniel Kunin1858  . . . actgggcctttcgttttatctgttgtttgt
BBa_K569007CheZ mutantCodingDavid Golynskiy & Tyler Guinn6641 . . . ttggattttgatttgtattgcctgatgtgg
BBa_K899000Sucrose sucrose fructosyltransferase (SST)CodingAndreas Kjr18934 . . . cctcttcctgggtggactttcgaactttga
BBa_K875020β-GlucosidaseCompositeFederico Colombo, Elisa Clagnan, Marija Drikic, Giorgio Gargari, Giulia Corso, Sara Samari1653  . . . caccttcgggtgggcctttctgcgtttata
BBa_K875004T5LacO-LPP-OmpA-scFv (scFv 54.6 antinorovirus)-6HIS-TT CompositeMarija Drikic, Giorgio Gargari15165 . . . caccttcgggtgggcctttctgcgtttata
BBa_K875005T5LacO-LPP-OmpA-SIP (scFv 54.6 + alpha isotype CH3 antinorovirus)-6HIS-TT CompositeMarija Drikic, Giorgio Gargari1906  . . . caccttcgggtgggcctttctgcgtttata
BBa_K875007T5 LacO-PelB-SIP (scFv 54.6 + alpha isotype CH3 antinorovirus)-6HIS-TT CompositeMarija Drikic, Giorgio Gargari1529  . . . caccttcgggtgggcctttctgcgtttata
BBa_K875006T5LacO-PelB-scFv (scFv 54.6 antinorovirus)-6HIS-TT CompositeMarija Drikic, Giorgio Gargari1121  . . . caccttcgggtgggcctttctgcgtttata
BBa_K1033002stilbene synthase (STS) with RBSCodingLovisa Pettersson12001 . . . ctacatagcattcctatggttacaaattaa
BBa_K10330014-coumarate ligase (4CL) with RBSCodingKarl Holdar17082 . . . ctgagggcaaaactagcaaatggattgtaa
BBa_K1205000Carnitine Dehydrogenase ProteinCodingBlake Wilhelmsen2431  . . . cgggtgatcggcctgccgccggtgcgctga
BBa_K1190003Yeb-F GMCSFCodingKhateeb H. Hussain789  . . . cctttcgattgctgggagcctgtgcaggaa
BBa_K1033115Histidine Patch Thioredoxin CodingSabri Jamal354  . . . gagttcctcgacgctaacctggccggctaa
BBa_K1639006PotB59-pomACodingMustafa Yılmaz1733  . . . gcgcactggaaattgacgaactcgagtaat
BBa_K1639007DAMP-PexigananTranslational_UnitMustafa Yılmaz694  . . . ctgcgtttatactgaaaggaggaactatat
BBa_K1639008Tev Protease, single S219V mutation in the internal cleavage siteCodingMustafa Yılmaz7501 . . . aactggtgtatagccaataataactcgagt
BBa_K1954001Lycopene cassette under the control of NarK, an oxidative stress inducible promoterCompositeAbbie Rogan3532  . . . ggtttgatgctggaggatctgatataataa
BBa_K1980000TAT Copper Storage Protein 1 CodingSam Garforth4741 . . . gcggcccatcatcaccaccatcactaataa
BBa_K1980002MymTCodingSam Garforth1833 . . . gtgaaacatcatcaccaccatcactaataa
BBa_K1983013Phenylalanine-specific permease (PheP) from Escherichia coli CodingVykintas Jaunikis14165 . . . gtggcatttaaaacgctgcgtcggaaataa
BBa_K2118001patA geneCodingLaura Ros-Freixedes14001 . . . gccatgcgtgttagcgtggaagaagcataa
BBa_K2118002FMS1 geneCodingLaura Ros-Freixedes15471 . . . gcaacccgtattagcgatctgctgaaataa
BBa_K2235011Sialidase enzyme coding composite N terminally attached to secretion system type 1 CompositeShivashree Dhanaraj and Shanlin Tong6915  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2230022STM1128/pSB1C3CodingYi-Lun Huang & Pei-Hong Chen14971 . . . gaaaaacctgaaccaaaggtgacattatga
BBa_K2660001T7 promoter driving 6-his tagged GFP with penetratinReporterDanielle Biscaro Pedrolli, Paulo Jose Correa Freire981  . . . caccttcgggtgggcctttctgcgtttata
BBa_K223042Blh Gene: Cleaves beta-carotene into retinalGeneratorSuzanne Bartram8694 . . . aaaaactgatactagtagcggccgctgcag
BBa_K223043RALDH II gene: Converts retinal into retinoic acidGeneratorSuzanne Bartram15793 . . . aactcctaatactagtagcggccgctgcag
BBa_K1514005TOR-A TAT signaling domain for bacteriaProtein_DomainCarlos Goncalves159  . . . actgacgctgtcatctcgaaagagggcatt
BBa_K2235005Sialidase enzymeCodingShanlin Tong, Shivashree Dhanaraj, Sina Amoor Pour and Gilai Nachmann15483 . . . gtggctccgcaagtgggccttaccatctaa
BBa_K2235008Endo beta galactosidaseCodingShanlin Tong, Shivashree Dhanaraj, Sina Amoor Pour and Gilai Nachmann12931 . . . catcatcatcatcatcatcatcatcactaa
BBa_K2660000Penetratin, cell-penetrating peptideCodingDanielle Biscaro Pedrolli, Paulo Jose Correa Freire511 . . . tttcaaaacagaagaatgaaatggaaaaaa


Lactobacillus spp.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1033000Tyrosine ammonia-lyase (TAL) with RBSCodingKarl Holdar, Hampus Elofsson, Emil Marklund, Kristoffer Lundmark, Marcus Hong, Lovisa Pettersson, Ken Braech-Andersen, Theodor Lwe15963 . . . cacctcttgcagcaatctcccgtctgataa
BBa_K128003p1025CodingSara Mouradian101  . . . cgttctggttactagtagcggccgctgcag
BBa_K128004signal sequence from Lactobacillus bulgaricus; secretes proteinTagSara Mouradian143  . . . agctgccagtcaagaaacgctccggttacc


Lactococcus lactis


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K2230022STM1128/pSB1C3CodingYi-Lun Huang & Pei-Hong Chen14971 . . . gaaaaacctgaaccaaaggtgacattatga
BBa_K2660003mCherry codon optimized for Lactococcus lactisCodingNathan Vinicius Ribeiro7242 . . . actggtggtatggatgaactttacaaataa
BBa_K2660011T7 promoter driving mCherry productionReporterNathan Vinicius Ribeiro7551 . . . actggtggtatggatgaactttacaaataa


Bacillus subtilis


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K2660001T7 promoter driving 6-his tagged GFP with penetratinReporterDanielle Biscaro Pedrolli, Paulo Jose Correa Freire981  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2660004Pveg constitutively driving expression of mCherryReporterDanielle Biscaro Pedrolli, Nathan Vinicius Ribeiro829  . . . actggtggtatggatgaactttacaaataa
BBa_K2660000Penetratin, cell-penetrating peptideCodingDanielle Biscaro Pedrolli, Paulo Jose Correa Freire511 . . . tttcaaaacagaagaatgaaatggaaaaaa
BBa_K2660003mCherry codon optimized for Lactococcus lactisCodingNathan Vinicius Ribeiro7242 . . . actggtggtatggatgaactttacaaataa
BBa_K2660011T7 promoter driving mCherry productionReporterNathan Vinicius Ribeiro7551 . . . actggtggtatggatgaactttacaaataa

Biocontainment

Escherichia coli


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K112000T4 holin, complete CDS, berkeley standardCodingBing Xia6576 . . . gcggccagaatattaggaagggctaaataa
BBa_K875009LL 37 - CathelicidinCodingGiulia Corso, Sara Samari1235 . . . ctggtgccgcgcaccgaaagctaataataa
BBa_K131010AHL Inducible Colicin E2 with GFPGeneratorKevin McLeod4144  . . . aatgtcacaaaaattccatgtgggagatgg
BBa_K314200Toxin Tse2CodingMatthew Coyne, Ingrid Swanson, Jesa Landis, Matthew Harger4774 . . . cgccaatgggaaaaagcccgcgggctctag
BBa_K875008IPTG inducible Tse2 toxin CodingGiulia Corso, Sara Samari7222 . . . caccttcgggtgggcctttctgcgtttata
BBa_K1976048DNase domain of Colicin E2CodingAlana Gouveia, Franziska Hameister, Jonas Sindlinger, Maik Schork 4016 . . . tcatattgacatccaccgcggaaagtaaaa
BBa_K150007ColicinE1 operonCompositePascal Kraemer20921 . . . tctaaactgacggggatcgcggttcagtgg
BBa_K150010ColicinE9 operonCompositePascal Kraemer20401 . . . tttttgaaatgtcacaaaagttctcatgtg
BBa_K150012colicinE9 operon (short)CompositePascal Kraemer10241 . . . tctgcatggggttctaagccgaaaacctag
BBa_K912030pH Inducible Lysis System(w)CompositeGrant Nicholas4515  . . . aaggccgcatcagccagcgagaatacttga
BBa_K912031pH Inducible Lysis System(m)CompositeGrant Nicholas4515  . . . aaggccgcatcagccagcgagaatacttga
BBa_K2447016Phosphate-dependent, temperature-sensitive cascaded system with IM2 expressionCompositeChee Wai Kit (david)2333  . . . caccttcgggtgggcctttctgcgtttata


Lactobacillus spp.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K117000Lysis gene (promotes lysis in colicin-producing bacteria strain)CodingNguyen Xuan Hung14418 . . . gctgaactgaccggagtggaaacgcagtaa
BBa_K1159105Mature Nuclease NucA from Staphylococcus aureus (Thermonuclease) in RFC[25]CodingDong-Jiunn Jeffery TRUONG4474 . . . tggagcgaagacaacgctgattcaggtcaa


Lactococcus lactis


There are no parts for this table


Bacillus subtilis


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K2660006N-Cas9CodingVictor Nunes de Jesus, Danielle Biscaro Pedrolli3459  . . . ctagtggttgctaaggtggaaaaagggaaa
BBa_K2660007C-Cas9CodingDanielle Biscaro Pedrolli,Victor Nunes de Jesus648  . . . attgatttgagtcagcttggcggtgactga
BBa_K2660008nMagCodingDanielle Biscaro Pedrolli,Victor Nunes de Jesus450  . . . tattcaatgggatttcaatgtgaaacagaa
BBa_K2660009pMagCodingDanielle Biscaro Pedrolli, Victor Nunes de Jesus450  . . . tattcaatgggatttcaatgcgaaacagaa

Memory

Escherichia coli


There are no parts for this table

Lactobacillus spp.


There are no parts for this table

Lactococcus lactis


There are no parts for this table

Bacillus subtilis


There are no parts for this table