Difference between revisions of "Promoters/Catalog/Constitutive"

 
Line 6: Line 6:
 
===Constitutive ''E. coli'' &sigma;<sup>70</sup> promoters===
 
===Constitutive ''E. coli'' &sigma;<sup>70</sup> promoters===
 
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''E. coli'' &sigma;<sup>70</sup> RNAP]].  &sigma;<sup>70</sup> is the major ''E. coli'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
 
This section lists promoters that are recognized by [[Help:Promoters/Prokaryotic RNAP#E. coli RNA polymerases|''E. coli'' &sigma;<sup>70</sup> RNAP]].  &sigma;<sup>70</sup> is the major ''E. coli'' sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).<br>
 
+
*[[Promoters/Catalog/Anderson|'''Anderson Promoter Collection''']] - a well-characterized collection of ''E. coli'' &sigma;<sup>70</sup> constitutive promoters contributed to the registry by Chris Anderson.
 
<parttable>promoter_ecoli_constitutive_sigma70</parttable>
 
<parttable>promoter_ecoli_constitutive_sigma70</parttable>
  

Latest revision as of 03:40, 17 May 2009

ConstitutivePromoter.png

Constitutive E. coli promoters

All the promoters in this section are E. coli promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcription factors. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself!

Constitutive E. coli σ70 promoters

This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).

  • Anderson Promoter Collection - a well-characterized collection of E. coli σ70 constitutive promoters contributed to the registry by Chris Anderson.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I14018P(Bla) . . . gtttatacataggcgagtactctgttatgg351422In stock
BBa_I14033P(Cat) . . . agaggttccaactttcaccataatgaaaca381882In stock
BBa_I14034P(Kat) . . . taaacaactaacggacaattctacctaaca454429In stock
BBa_I732021Template for Building Primer Family Member . . . acatcaagccaaattaaacaggattaacac1592643Not in stock
BBa_I742126Reverse lambda cI-regulated promoter . . . gaggtaaaatagtcaacacgcacggtgtta491618Not in stock
BBa_J01006Key Promoter absorbs 3 . . . caggccggaataactccctataatgcgcca591822Not in stock
BBa_J23100constitutive promoter family member . . . ggctagctcagtcctaggtacagtgctagc3583466In stock
BBa_J23101constitutive promoter family member . . . agctagctcagtcctaggtattatgctagc3553848In stock
BBa_J23102constitutive promoter family member . . . agctagctcagtcctaggtactgtgctagc3536949In stock
BBa_J23103constitutive promoter family member . . . agctagctcagtcctagggattatgctagc3515860In stock
BBa_J23104constitutive promoter family member . . . agctagctcagtcctaggtattgtgctagc3517036In stock
BBa_J23105constitutive promoter family member . . . ggctagctcagtcctaggtactatgctagc3542371In stock
BBa_J23106constitutive promoter family member . . . ggctagctcagtcctaggtatagtgctagc3563432In stock
BBa_J23107constitutive promoter family member . . . ggctagctcagccctaggtattatgctagc3510063It's complicated
BBa_J23108constitutive promoter family member . . . agctagctcagtcctaggtataatgctagc357608In stock
BBa_J23109constitutive promoter family member . . . agctagctcagtcctagggactgtgctagc3512460In stock
BBa_J23110constitutive promoter family member . . . ggctagctcagtcctaggtacaatgctagc3531909In stock
BBa_J23111constitutive promoter family member . . . ggctagctcagtcctaggtatagtgctagc3510020In stock
BBa_J23112constitutive promoter family member . . . agctagctcagtcctagggattatgctagc3520261In stock
BBa_J23113constitutive promoter family member . . . ggctagctcagtcctagggattatgctagc3512165In stock
BBa_J23114constitutive promoter family member . . . ggctagctcagtcctaggtacaatgctagc3539200In stock
BBa_J23115constitutive promoter family member . . . agctagctcagcccttggtacaatgctagc3513866In stock
BBa_J23116constitutive promoter family member . . . agctagctcagtcctagggactatgctagc3525084In stock
BBa_J23117constitutive promoter family member . . . agctagctcagtcctagggattgtgctagc3512453In stock
BBa_J23118constitutive promoter family member . . . ggctagctcagtcctaggtattgtgctagc3538811In stock
BBa_J23119constitutive promoter family member . . . agctagctcagtcctaggtataatgctagc3531843In stock
BBa_J231501bp mutant from J23107 . . . ggctagctcagtcctaggtattatgctagc351155In stock
BBa_J231511bp mutant from J23114 . . . ggctagctcagtcctaggtacaatgctagc351154Not in stock
BBa_J44002pBAD reverse . . . aaagtgtgacgccgtgcaaataatcaatgt1301341In stock
BBa_J48104NikR promoter, a protein of the ribbon helix-helix family of trancription factors that repress expre . . . gacgaatacttaaaatcgtcatacttattt401228Not in stock
BBa_J54200lacq_Promoter . . . aaacctttcgcggtatggcatgatagcgcc501204Not in stock
BBa_J56015lacIQ - promoter sequence . . . tgatagcgcccggaagagagtcaattcagg571223Not in stock
BBa_J64951E. Coli CreABCD phosphate sensing operon promoter . . . ttatttaccgtgacgaactaattgctcgtg811229Not in stock
BBa_K088007GlnRS promoter . . . catacgccgttatacgttgtttacgctttg381306It's complicated
BBa_K119000Constitutive weak promoter of lacZ . . . ttatgcttccggctcgtatgttgtgtggac381269Not in stock
BBa_K119001Mutated LacZ promoter . . . ttatgcttccggctcgtatggtgtgtggac381322Not in stock
BBa_K1330002Constitutive promoter (J23105) . . . ggctagctcagtcctaggtactatgctagc352011In stock
BBa_K137029constitutive promoter with (TA)10 between -10 and -35 elements . . . atatatatatatatataatggaagcgtttt391496It's complicated
BBa_K137030constitutive promoter with (TA)9 between -10 and -35 elements . . . atatatatatatatataatggaagcgtttt371499It's complicated
BBa_K137031constitutive promoter with (C)10 between -10 and -35 elements . . . ccccgaaagcttaagaatataattgtaagc621499It's complicated
BBa_K137032constitutive promoter with (C)12 between -10 and -35 elements . . . ccccgaaagcttaagaatataattgtaagc641494It's complicated
BBa_K137085optimized (TA) repeat constitutive promoter with 13 bp between -10 and -35 elements . . . tgacaatatatatatatatataatgctagc311251Not in stock
BBa_K137086optimized (TA) repeat constitutive promoter with 15 bp between -10 and -35 elements . . . acaatatatatatatatatataatgctagc331251Not in stock
BBa_K137087optimized (TA) repeat constitutive promoter with 17 bp between -10 and -35 elements . . . aatatatatatatatatatataatgctagc351251Not in stock
BBa_K137088optimized (TA) repeat constitutive promoter with 19 bp between -10 and -35 elements . . . tatatatatatatatatatataatgctagc371251Not in stock
BBa_K137089optimized (TA) repeat constitutive promoter with 21 bp between -10 and -35 elements . . . tatatatatatatatatatataatgctagc391251Not in stock
BBa_K137090optimized (A) repeat constitutive promoter with 17 bp between -10 and -35 elements . . . aaaaaaaaaaaaaaaaaatataatgctagc351250Not in stock
BBa_K137091optimized (A) repeat constitutive promoter with 18 bp between -10 and -35 elements . . . aaaaaaaaaaaaaaaaaatataatgctagc361250Not in stock
BBa_K1585100Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782212Not in stock
BBa_K1585101Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782173Not in stock
BBa_K1585102Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782175Not in stock
BBa_K1585103Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782172Not in stock
BBa_K1585104Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782175Not in stock
BBa_K1585105Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782174Not in stock
BBa_K1585106Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782174Not in stock
BBa_K1585110Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782130Not in stock
BBa_K1585113Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782175Not in stock
BBa_K1585115Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782176Not in stock
BBa_K1585116Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782174Not in stock
BBa_K1585117Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782175Not in stock
BBa_K1585118Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782174Not in stock
BBa_K1585119Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca782175Not in stock
BBa_K1824896J23100 + RBS . . . gattaaagaggagaaatactagagtactag881390It's complicated
BBa_K2486171A reverse complement version of BBa_J23114 . . . cattgtacctaggactgagctagccataaa351639Not in stock
BBa_K256002J23101:GFP . . . caccttcgggtgggcctttctgcgtttata9181176In stock
BBa_K256018J23119:IFP . . . caccttcgggtgggcctttctgcgtttata11671372It's complicated
BBa_K256020J23119:HO1 . . . caccttcgggtgggcctttctgcgtttata9491886It's complicated
BBa_K256033Infrared signal reporter (J23119:IFP:J23119:HO1) . . . caccttcgggtgggcctttctgcgtttata212410501It's complicated
BBa_K292000Double terminator + constitutive promoter . . . ggctagctcagtcctaggtacagtgctagc1381836It's complicated
BBa_K292001Double terminator + Constitutive promoter + Strong RBS . . . tgctagctactagagattaaagaggagaaa1612027It's complicated
BBa_K418000IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca14161151Not in stock
BBa_K418002IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca14141169It's complicated
BBa_K418003IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca14161169It's complicated
BBa_K823004Anderson promoter J23100 . . . ggctagctcagtcctaggtacagtgctagc357740In stock
BBa_K823005Anderson promoter J23101 . . . agctagctcagtcctaggtattatgctagc357970In stock
BBa_K823006Anderson promoter J23102 . . . agctagctcagtcctaggtactgtgctagc357716In stock
BBa_K823007Anderson promoter J23103 . . . agctagctcagtcctagggattatgctagc357716In stock
BBa_K823008Anderson promoter J23106 . . . ggctagctcagtcctaggtatagtgctagc357716In stock
BBa_K823010Anderson promoter J23113 . . . ggctagctcagtcctagggattatgctagc357716In stock
BBa_K823011Anderson promoter J23114 . . . ggctagctcagtcctaggtacaatgctagc357716In stock
BBa_K823013Anderson promoter J23117 . . . agctagctcagtcctagggattgtgctagc357716In stock
BBa_K823014Anderson promoter J23118 . . . ggctagctcagtcctaggtattgtgctagc357715In stock
BBa_M13101M13K07 gene I promoter . . . cctgtttttatgttattctctctgtaaagg471492Not in stock
BBa_M13102M13K07 gene II promoter . . . aaatatttgcttatacaatcttcctgtttt481493Not in stock
BBa_M13103M13K07 gene III promoter . . . gctgataaaccgatacaattaaaggctcct481495Not in stock
BBa_M13104M13K07 gene IV promoter . . . ctcttctcagcgtcttaatctaagctatcg491494Not in stock
BBa_M13105M13K07 gene V promoter . . . atgagccagttcttaaaatcgcataaggta501491Not in stock
BBa_M13106M13K07 gene VI promoter . . . ctattgattgtgacaaaataaacttattcc491493Not in stock
BBa_M13108M13K07 gene VIII promoter . . . gtttcgcgcttggtataatcgctgggggtc471496Not in stock
BBa_M13110M13110 . . . ctttgcttctgactataatagtcagggtaa481491Not in stock
BBa_M31519Modified promoter sequence of g3. . . . aaaccgatacaattaaaggctcctgctagc601506Not in stock
BBa_R1074Constitutive Promoter I . . . caccacactgatagtgctagtgtagatcac741253Not in stock
BBa_R1075Constitutive Promoter II . . . gccggaataactccctataatgcgccacca491503Not in stock
BBa_S03331--Specify Parts List--ttgacaagcttttcctcagctccgtaaact301586Not in stock

Constitutive E. coli σS promoters

This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_J45992Full-length stationary phase osmY promoter . . . ggtttcaaaattgtgatctatatttaacaa19910676In stock
BBa_J45993Minimal stationary phase osmY promoter . . . ggtttcaaaattgtgatctatatttaacaa573463Not in stock

Constitutive E. coli σ32 promoters

This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_J45504htpG Heat Shock Promoter . . . tctattccaataaagaaatcttcctgcgtg4051497Not in stock
BBa_K1895002dnaK Promoter . . . gaccgaatatatagtggaaacgtttagatg1822645Not in stock
BBa_K1895003htpG Promoter . . . ccacatcctgtttttaaccttaaaatggca2871890Not in stock

Constitutive E. coli σ54 promoters

This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.


There are no parts for this table

Constitutive B. subtilis σA promoters

This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143012Promoter veg a constitutive promoter for B. subtilis . . . aaaaatgggctcgtgttgtacaataaatgt976561In stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock
BBa_K780003Strong constitutive promoter for Bacillus subtilis . . . aattgcagtaggcatgacaaaatggactca361559It's complicated
BBa_K823000PliaG . . . caagcttttcctttataatagaatgaatga1217765In stock
BBa_K823002PlepA . . . tctaagctagtgtattttgcgtttaatagt1577245In stock
BBa_K823003Pveg . . . aatgggctcgtgttgtacaataaatgtagt23714126In stock

Constitutive B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143010Promoter ctc for B. subtilis . . . atccttatcgttatgggtattgtttgtaat564297Not in stock
BBa_K143011Promoter gsiB for B. subtilis . . . taaaagaattgtgagcgggaatacaacaac382765Not in stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock

Constitutive promoters from miscellaneous prokaryotes

The promoters in this table are prokaryotic promoters that are constitutive meaning that the activity of these promoters is dependent only on the concentration of the appropriate RNA polymerase and sigma factor. Constitutive prokaryotic promoters other than those from E. coli or B. subtilis are listed here. The equivalent pages for E. coli and B. subtilis are listed here and here. Note that many prokaryotic RNA polymerases recognize similar promoter sequences so many of these promoter sequences will work in other prokaryotes.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K112706Pspv2 from Salmonella . . . tacaaaataattcccctgcaaacattatca4741855Not in stock
BBa_K112707Pspv from Salmonella . . . tacaaaataattcccctgcaaacattatcg19561844Not in stock

Constitutive promoters from bacteriophage T7

ConstitutivePromoter.png

These promoters are recognized by the T7 RNA Polymerase and are constitutive meaning that their activity is dependent on the availability of RNA polymerase, but is not affected by any transcription factors. T7 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I712074T7 promoter (strong promoter from T7 bacteriophage) . . . agggaatacaagctacttgttctttttgca461938In stock
BBa_I719005T7 Promotertaatacgactcactatagggaga237912In stock
BBa_J34814T7 Promotergaatttaatacgactcactatagggaga281190Not in stock
BBa_J64997T7 consensus -10 and resttaatacgactcactatagg1910154It's complicated
BBa_K113010overlapping T7 promoter . . . gagtcgtattaatacgactcactatagggg401553It's complicated
BBa_K113011more overlapping T7 promoter . . . agtgagtcgtactacgactcactatagggg371601It's complicated
BBa_K113012weaken overlapping T7 promoter . . . gagtcgtattaatacgactctctatagggg401630It's complicated
BBa_K1614000T7 promoter for expression of functional RNAtaatacgactcactatag185219In stock
BBa_K3633015T7 promotertaatacgactcactatagg19 It's complicated
BBa_R0085T7 Consensus Promoter Sequencetaatacgactcactatagggaga232072In stock
BBa_R0180T7 RNAP promoterttatacgactcactatagggaga231654Not in stock
BBa_R0181T7 RNAP promotergaatacgactcactatagggaga231651Not in stock
BBa_R0182T7 RNAP promotertaatacgtctcactatagggaga231653Not in stock
BBa_R0183T7 RNAP promotertcatacgactcactatagggaga231653Not in stock
BBa_Z0251T7 strong promoter . . . taatacgactcactatagggagaccacaac351887Not in stock
BBa_Z0252T7 weak binding and processivity . . . taattgaactcactaaagggagaccacagc351667Not in stock
BBa_Z0253T7 weak binding promoter . . . cgaagtaatacgactcactattagggaaga351400Not in stock

Constitutive promoters from bacteriophage SP6

All the promoters in this table are recognized by the SP6 RNA Polymerase and are constitutive meaning that their activity is dependent on the availability of RNA polymerase, but is not affected by any transcription factors. SP6 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_J64998consensus -10 and rest from SP6atttaggtgacactataga191155Not in stock

Constitutive promoters from yeast

All the promoters in this table are yeast promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcriptional regulators.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I766555pCyc (Medium) Promoter . . . acaaacacaaatacacacactaaattaata2443344Not in stock
BBa_I766556pAdh (Strong) Promoter . . . ccaagcatacaatcaactatctcatataca15013301Not in stock
BBa_I766557pSte5 (Weak) Promoter . . . gatacaggatacagcggaaacaacttttaa6013594Not in stock
BBa_J63005yeast ADH1 promoter . . . tttcaagctataccaagcatacaatcaact14457638It's complicated
BBa_K105027cyc100 minimal promoter . . . cctttgcagcataaattactatacttctat1031876It's complicated
BBa_K105028cyc70 minimal promoter . . . cctttgcagcataaattactatacttctat1031833It's complicated
BBa_K105029cyc43 minimal promoter . . . cctttgcagcataaattactatacttctat1031832It's complicated
BBa_K105030cyc28 minimal promoter . . . cctttgcagcataaattactatacttctat1031832It's complicated
BBa_K105031cyc16 minimal promoter . . . cctttgcagcataaattactatacttctat1031832It's complicated
BBa_K122000pPGK1 . . . ttatctactttttacaacaaatataaaaca14976078It's complicated
BBa_K124000pCYC Yeast Promoter . . . acaaacacaaatacacacactaaattaata2882076Not in stock
BBa_K124002Yeast GPD (TDH3) Promoter . . . gtttcgaataaacacacataaacaaacaaa6814340Not in stock
BBa_K319005yeast mid-length ADH1 promoter . . . ccaagcatacaatcaactatctcatataca7203236It's complicated
BBa_M31201Yeast CLB1 promoter region, G2/M cell cycle specific . . . accatcaaaggaagctttaatcttctcata5001858Not in stock

Constitutive promoters from miscellaneous eukaryotes

All the promoters in the table below are eukaryotic promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcription factors.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I712004CMV promoter . . . agaacccactgcttactggcttatcgaaat65410909In stock
BBa_K076017Ubc Promoter . . . ggccgtttttggcttttttgttagacgaag12191353Not in stock
BBa_K1021010PgpdA from A. nidulans . . . tatattcatcttcccatccaagaaccttta7231756In stock
BBa_K3046001PLEAPglaA_2 . . . ctttatattatatttgcgcagtcgcctcgc6837781Not in stock
BBa_K3046002PLEAPsonB_1 . . . tccataatccgcagcaacaacaaacagcaa8427590Not in stock
BBa_K3046003PLEAPgpdA_1 . . . ctaccccgcccccaacagacacatctaaac9264619Not in stock
BBa_K3046004PLEAPgpdA_2 . . . ctaccccgccctaaacagacacatccacac9264808Not in stock
BBa_K3046005PLEAPmstA_1 . . . tcacgcagtctcctcctcgacatcagtcac9864854Not in stock
BBa_K3046006PLEAPunk_1 . . . tcgcattcttgtccacggaacggcaccagt9334755Not in stock
BBa_K3046007PLEAPgfaA_1 . . . tcccttaatctcctcttaacattcatcaac9734852Not in stock
BBa_K3046008PLEAPhfbD_1 . . . ctcaggcttacaaagaactcaatctatcac10144819Not in stock