Collections/CRISPR

Revision as of 20:46, 5 January 2016 by Vinoo (Talk | contribs)

This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.

Introduction to CRISPR and Cas9

<img src="UBC-CRISPR-Mechanism-Out.png" width="400px" align="right" >

From UBC 2013: CRISPRs (Clustered Regularly Interspaced Short PalindromicRepeats) are specific regions in some bacterial and archaeal genomes that, together with associated Cas (CRISPR-associated) genes, function as an adaptive immune system in prokaryotes. While the specific ‘adaptive’ nature of this immunity is still under investigation, it is known that exogenous DNA is processed by Cas proteins into short (~30 base pair) sequences that are adjacent to the Protospacer Adjacent Motif (PAM) site. These short pieces of DNA are then incorporated into the host genome between repeat sequences to formspacer elements. The repeat-spacer-repeat array is constitutively expressed (pre-CRISPR RNAs or pre-crRNAs) and processed by Cas proteins to form small RNAs (crRNAs). The small RNAs are then loaded into Cas proteins and act to guide them to initiate the sequence-specific cleavage of the target sequence.

Background from Freiburg 2013: Hidden as an uncharacterized E. coli locus for more than 15 years, Barrangou et al. identified the CRISPR (Clusterd Regularly Interspaced Short Palindromic Repeats) array as a previously unknown adaptive prokaryotic immune system. Almost half of all prokaryotes make use of this defense mechanism against unselective uptake through natural transformation, phage DNA transduction or horizontal gene transfer by conjugation. Invasive DNA or even RNA can be specifically recognized and efficiently cleaved. This unique feature results from the interaction of non-coding RNAs and CRISPR associated (Cas) proteins. From a wide range of known CRISPR subtypes we used CRISPR type II b of S. pyogenes. </p>

The recognition and degradation of invasive DNA by CRISPR/Cas type II occurs in three steps:

  1. Acquisition: Invasive DNA is recognized via a protospacer adjacent motif (PAM) – the sequence NGG. A short sequence downstream of the PAM sequence is then integrated into the host CRISPR array and is termed spacer. Spacer sequences transcribe for CRISPR RNAs(crRNAs) which help to cleave sequence-specific invasive DNA. These sequences are located between short palindromic repeats, which are neccessary for the functionality of the crRNAs.
  2. Expression/Transcription: The Cas9 endonuclease is expressed. CRISPR array is then transcribed and processed by RNAse III into crRNAs. These contain the complementary spacer sequence and the direct repeat sequence. The crRNA guides the Cas9 protein specifically to invasive DNA sequences. Furthermore trans-activating crRNAs (tracrRNA) are transcribed and bind to the direct repeat part of the crRNA. The tracrRNA is necessary for the formation of a Cas9-RNA complex.
  3. Interference: Repeatedly invading DNA, which has been integrated into the CRISPR locus, is detected by the RNA-protein complex and cleaved by Cas9.


<p> Each of these teams have worked on CRISPR based systems for at least some part of their projects. Below, you'll find abstracts for each team, direct links to their CRISPR pages and references. Here is the list of 2013 iGEM teams who worked on CRISPR in their projects:


Team Year Parts Track Project Title
Aachen 2015 Parts Manufacturing Upcycling Methanol into a Universal Carbon Source
BGU_Israel 2015 Parts Health & Medicine The Boomerang system: engineering logic gate genetic device for detection and treatment of cancer
BostonU 2015 Parts Foundational Advance Developing conditionally dimerizable split protein systems for genetic logic and genome editing applications
Chalmers-Gothenburg 2015 Parts New Application A study in Scarlet
Hong_Kong_HKU 2015 Parts New Application Controllable cell death and DNA degradation by CRISPR cas system
NJAU_China 2015 Parts New Application The Horcrux
Paris_Bettencourt 2015 Parts Food & Nutrition Ferment It Yourself
SCU_China 2015 Parts Environment E. pangu: The Pioneer of Mars
Stanford-Brown 2015 Parts Manufacturing biOrigami: A New Approach to Reduce the Cost of Space Missions
Tec-Monterrey 2015 Parts New Application Insects join iGEM: Sf9 cells as a new chassis for synthetic biology
Tufts 2015 Parts Health & Medicine Delivery of the CRISPR-Cas9 gene editing platform into epithelial cells using Clostridium difficile toxin B
Waterloo 2015 Parts Foundational Advance CRISPieR: re-engineering CRISPR-Cas9 with functional applications in eukaryotic systems
Yale 2015 Parts Foundational Advance Developing a Framework for the Genetic Manipulation of Non-Model and Environmentally Significant Microbes
USTC 2015 Parts Hardware NDM: Nanomachine Detecting Microbiotics
Vilnius-Lithuania 2015 Parts Foundational Advance Controlling the Lifetime of GMOs using ColiClock
Duke 2015 Parts Foundational Advance DNA Sequence Sensing with dCas9 Applied to Antibiotic Resistance Detection and Elimination
EPF_Lausanne 2015 Parts Information Processing Bio LOGIC: Biologic Orthogonal gRNA-Implemented Circuit
NU_Kazakhstan 2015 Parts Health & Medicine Prevention of Dental Caries by Targeting Streptococcus Mutans
Peking 2015 Parts Health & Medicine Fighting Against Tuberculosis: Making Invisible Visible
Tsinghua 2015 Parts Hardware Developing light-controlled systems to manipulate genetic information in prokaryotes
Washington 2015 Parts New Application Lab on a Strip: Developing a Novel Platform for Yeast Biosensors
William_and_Mary 2015 Parts Measurement Measurement of Promoter-Based Transcriptional Noise for Application in Gene Network Design
British_Columbia 2013 Parts Food & Energy ~
Chiba 2013 Parts New Application ~
Duke 2013 Parts New Application ~
Freiburg 2013 Parts Foundational Advance ~
MIT 2013 Parts Health & Medicine ~
NJU_NJUT_China 2013 Parts New Application ~
Paris_Bettencourt 2013 Parts Health & Medicine ~
Penn_State 2013 Parts Manufacturing ~
SJTU-BioX-Shanghai 2013 Parts New Application ~
Stanford-Brown 2013 Parts New Application ~
UCSF 2013 Parts Foundational Advance ~
WHU-China 2013 Parts New Application ~

Introduction to CRISPR and Cas9

From UBC 2013: CRISPRs (Clustered Regularly Interspaced Short PalindromicRepeats) are specific regions in some bacterial and archaeal genomes that, together with associated Cas (CRISPR-associated) genes, function as an adaptive immune system in prokaryotes. While the specific ‘adaptive’ nature of this immunity is still under investigation, it is known that exogenous DNA is processed by Cas proteins into short (~30 base pair) sequences that are adjacent to the Protospacer Adjacent Motif (PAM) site. These short pieces of DNA are then incorporated into the host genome between repeat sequences to formspacer elements. The repeat-spacer-repeat array is constitutively expressed (pre-CRISPR RNAs or pre-crRNAs) and processed by Cas proteins to form small RNAs (crRNAs). The small RNAs are then loaded into Cas proteins and act to guide them to initiate the sequence-specific cleavage of the target sequence.

Background from Freiburg 2013: Hidden as an uncharacterized E. coli locus for more than 15 years, Barrangou et al. identified the CRISPR (Clusterd Regularly Interspaced Short Palindromic Repeats) array as a previously unknown adaptive prokaryotic immune system. Almost half of all prokaryotes make use of this defense mechanism against unselective uptake through natural transformation, phage DNA transduction or horizontal gene transfer by conjugation. Invasive DNA or even RNA can be specifically recognized and efficiently cleaved. This unique feature results from the interaction of non-coding RNAs and CRISPR associated (Cas) proteins. From a wide range of known CRISPR subtypes we used CRISPR type II b of S. pyogenes.

The recognition and degradation of invasive DNA by CRISPR/Cas type II occurs in three steps:

  1. Acquisition: Invasive DNA is recognized via a protospacer adjacent motif (PAM) – the sequence NGG. A short sequence downstream of the PAM sequence is then integrated into the host CRISPR array and is termed spacer. Spacer sequences transcribe for CRISPR RNAs(crRNAs) which help to cleave sequence-specific invasive DNA. These sequences are located between short palindromic repeats, which are neccessary for the functionality of the crRNAs.
  2. Expression/Transcription: The Cas9 endonuclease is expressed. CRISPR array is then transcribed and processed by RNAse III into crRNAs. These contain the complementary spacer sequence and the direct repeat sequence. The crRNA guides the Cas9 protein specifically to invasive DNA sequences. Furthermore trans-activating crRNAs (tracrRNA) are transcribed and bind to the direct repeat part of the crRNA. The tracrRNA is necessary for the formation of a Cas9-RNA complex.
  3. Interference: Repeatedly invading DNA, which has been integrated into the CRISPR locus, is detected by the RNA-protein complex and cleaved by Cas9.

Each of these teams have worked on CRISPR based systems for at least some part of their projects. Below, you'll find abstracts for each team, direct links to their CRISPR pages and references. Here is the list of 2013 iGEM teams who worked on CRISPR in their projects:

Team Track Chassis
British_Columbia Food & Energy E. coli
Chiba New Application E. coli
Duke New Application Yeast / S. cerevisiae
Freiburg Foundational Advance E. coli / Mammalian
MIT Health & Medicine Mammalian
NJU_NJUT_China New Application E. coli
Paris_Bettencourt Health & Medicine E. coli
Penn_State Manufacturing Plants
SJTU-BioX-Shanghai New Application E. coli
Stanford-Brown New Application E. coli / B. subtilis
UCSF Foundational Advance E. coli
WHU-China New Application E. coli

CRISPR and Cas9 parts in the Registry

Many of the teams on this page have submitted parts associated with CRISPR/Cas9:

More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1218003CRISPR CasA E. coli (Modern)CodingTrevor Kalkus, Gordon Wade, Alissa Greenberg1509  . . . aaaccgcaaggagggccatcaaatggctga
BBa_K1218011Cas9CodingSophia Liang50802 . . . catgttataataggcaaaagaagagtagtg
BBa_K1129006Cas 9 from Streptococcus thermophilusCodingUBC iGEM 20134167  . . . atagaccttgccaaactaggagagggttaa
BBa_K1026002Constitutively Expressed gRNA targeting mRFPCompositeHongyi WU266  . . . caccttcgggtgggcctttctgcgtttata
BBa_K1218004CRISPR CasA (Ancestral)CodingTrevor Kalkus, Gordon Wade, Alissa Greenberg1340  . . . gatcacaaccaccgtcataagcattaatga
BBa_K1081000J13002-dcas9CompositeHangxing Jia4180  . . . cgcattgatttgagtcagctaggaggtgac
BBa_K1160000coding sequence of Cas9 from CRISPR system type IIPlasmidHuang Xingxu9159  . . . acatttccccgaaaagtgccacctgacgtc
BBa_K1150000dCas9CodingFreiburg 2013410142 . . . cggatcgacctgtctcagctgggaggcgac
BBa_K1150017dCas9 with CMV promoterDeviceFreiburg 20135012  . . . aggcatgctggggatgcggtgggctctatg
BBa_K1026000Constitutively Expressed dCas9 OperonCompositeHongyi WU4311  . . . caccttcgggtgggcctttctgcgtttata
BBa_K1150050Truncated CMV dCas9 Device #4DeviceNatalie Louis and Lisa Schmunk3626  . . . aggcatgctggggatgcggtgggctctatg
BBa_K1179002Hef1A_Cas9-VP16GeneratorBrandon Nadres5141  . . . ggtgggacgcgtgagcttcagtgcaggtga
BBa_K1137013crRNA anti KANCodingNicolas Koutsoubelis, Anne Loechner251  . . . aaacttcagcacactgagacttgttgagtt
BBa_K1982000tCas9-CIBN (Prokaryotic LACE system)DeviceZexu Li4731  . . . ccatacgatgttccagattacgcttaataa
BBa_K1982001Prokaryotic tCAS9CodingZexu Li4122  . . . aggattgacctgtcccaactgggaggcgac
BBa_K1982002Prokaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor)CodingZexu Li1854  . . . actacaagtttgggaaaaaatggttgcaaa
BBa_K1982003CIBN(the N-terminal fragment of CIB1)CodingZexu Li612  . . . ccatacgatgttccagattacgcttaataa
BBa_K1982004tCas9-CIBN (Prokaryotic LACE system)DeviceZexu Li4731  . . . ccatacgatgttccagattacgcttaataa
BBa_K1982005CRY2-VP64(Prokaryotic LACE system)DeviceZexu Li2100  . . . gactacaaggacgacgacgacaaataataa
BBa_K1982006tCas9-Vp64(Prokaryotic)DeviceZexu Li4368  . . . gactacaaggacgacgacgacaaataataa
BBa_K1994013sgRNA with dCas9 binding site sequence 9 and PP7 handle insertRNALiam Carroll189  . . . gcacgtcatctgacgtgccttttttattta
BBa_K1994017sgRNA with 5' golden gate adapter and PP7 protein binding siteRNALiam Carroll178  . . . ggcacgtcatctgacgtgccttttttattt
BBa_K2017000C-split Cas9 + DnaE C-inteinProtein_DomainMonica Victoria Gutierrez Salazar2358  . . . aaggtgcccaagaagaagaggaaggtgtga
BBa_K2017001N-split Cas9 + DnaE N-inteinProtein_DomainMonica Victoria Gutierrez Salazar2241  . . . gatttgatgagggtggacaacctccctaac
BBa_K201700735s:5'+ Ga20ox consense + SAGTI-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar3057  . . . gttactagatcggcaattccgctagagacc
BBa_K201700835s + Ga20ox consense + RSIAT-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar2836  . . . gttactagatcggcaattccgctagagacc
BBa_K201700935s + Ga20ox consense + AEK-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar2872  . . . gttactagatcggcaattccgctagagacc
BBa_K201701135s:5' + TFL consense + SAGTI-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar3057  . . . gttactagatcggcaattccgctagagacc
BBa_K2017010 35s + Ga20ox consense + RSIAT-TEV-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar2869  . . . gttactagatcggcaattccgctagagacc
BBa_K201701235s + TFL consense + RSIAT-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar2836  . . . gttactagatcggcaattccgctagagacc
BBa_K2017013 35s + TFL consense + AEK-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar2872  . . . gttactagatcggcaattccgctagagacc
BBa_K2017014 35s + TFL consense + RSIAT-TEV-Luciferase + TnosDeviceMonica Victoria Gutierrez Salazar2869  . . . gttactagatcggcaattccgctagagacc
BBa_K1982007Eukaryotic tCAS9CodingZexu Li4121  . . . aaggattgacctgtcccaactgggaggcga
BBa_K1982008tCas9-CIBN (Eukaryotic LACE system)CodingZexu Li4731  . . . ccatacgatgttccagattacgcttaataa
BBa_K1982010CRY2-VP64(Eukaryotic LACE system)CodingZexu Li2100  . . . gactacaaggacgacgacgacaaataataa
BBa_K1982011tCas9-Vp64(Eukaryoticc)CodingZexu Li4368  . . . gactacaaggacgacgacgacaaataataa
BBa_K1946002sgRNA targeting LacIRNAMusa Efe Işılak205  . . . tctgatgagtccgtgaggacgaaaaaaaaa
BBa_K1994021sgRNA containing two golden gate adaptersRNAIsobel Holden157  . . . ggcacgtcatctgacgtgccttttttattt
BBa_K1994025BsaI-GFP-dCas9 CompositeEgheosa Ogbomo5075  . . . attgatttgagtcagctaggaggtgactga
BBa_K2483005sgRNA target site couples facing each other with 6 bp spacerDNASophia Borowski850  . . . cgtctgtaatcgccctttgtacgtgaacgg
BBa_K2483006sgRNA target site couples facing each other with 18 bp spacerDNABryan Nowack955  . . . ttgaccgcggtcttcctccacattcctgtc
BBa_K2361000spdCas9CodingMart Bartelds4120  . . . cagctaggaggtgactaagtcgacctcgag
BBa_K2361001dCas9 VRERCodingMart Bartelds4108  . . . attgatttgagtcagctaggaggtgactga
BBa_K2361004CRISPR arrayRNASebald Verkuijl639  . . . tttatctgttgtttgtcggtgaacgctctc
BBa_K2371004sgRNA generator for EML4-ALK variant A 23CompositeQi Xiao164  . . . gcctctaaacgggtcttgaggggttttttg
BBa_K2371005sgRNA generator for EML4-ALK variant A 33CompositeQi Xiao164  . . . gcctctaaacgggtcttgaggggttttttg
BBa_K2371006sgRNA generator for EML4-ALK variant A 83CompositeQi Xiao164  . . . gcctctaaacgggtcttgaggggttttttg
BBa_K2558201dCas9 generator with Anderson weak promotorGeneratorTianze Huang4308  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2558003dCas9CodingTianze Huang41076 . . . attgatttgagtcagctaggaggtgactaa
BBa_K2627003crRNA targeting GltARNAZhaoqin Zhang162  . . . tttttttaagcttggctgttttggcggatg
BBa_K2627004crRNA targeting GltACompositeZhaoqin Zhang477  . . . ggatttgaacgttgcgaaggatagcaccac
BBa_K2660006N-Cas9CodingVictor Nunes de Jesus, Danielle Biscaro Pedrolli3459  . . . ctagtggttgctaaggtggaaaaagggaaa
BBa_K2660007C-Cas9CodingDanielle Biscaro Pedrolli,Victor Nunes de Jesus648  . . . attgatttgagtcagcttggcggtgactga
BBa_K3799000EiCsm6,A CRISPR system endoribonucleaseCodingShubhamay Das1293-1 . . . ttcaaccaatccatcaaggagctgctttaa
BBa_K3791000Spacer gRNA AmpicillinDNAAuba Fuster Pal, Laura Snchez Ruiz20-1tccgcctccatccagtctat
BBa_K3977000Cas12j-D394A (or dCasΦ), for more see 2021 SCU-China wiki page result and modelCodingYilong Xu2271-1 . . . accccggctcaggaaccgtcccagactagc
BBa_K3791001Spacer gRNA ChloramphenicolDNALaura Snchez Ruiz, Auba Fuster Pal20-1tgatggcttccatgtcggca
BBa_K3791002Spacer gRNA ErythromycinDNALaura Snchez Ruiz, Auba Fuster Pal20-1cgcagcagagaagcctggat
BBa_K3791003Spacer gRNA KanamycinDNALaura Snchez Ruiz, Auba Fuster Pal20-1caccatgatattcggcaagc
BBa_K3791004Spacer gRNA SpectinomycinDNALaura Snchez Ruiz, Auba Fuster Pal20-1gctcatcgccagcccagtcg
BBa_K3791005gRNA AmpicillinDNALaura Snchez Ruiz, Auba Fuster Pal41-1 . . . aagtgtagattccgcctccatccagtctat
BBa_K3791006gRNA ChloramphenicolDNALaura Snchez Ruiz, Auba Fuster Pal41-1 . . . aagtgtagattgatggcttccatgtcggca
BBa_K3791007gRNA ErythromycinDNALaura Snchez Ruiz, Auba Fuster Pal41-1 . . . aagtgtagatcgcagcagagaagcctggat
BBa_K3791008gRNA KanamycinDNALaura Snchez Ruiz, Auba Fuster Pal41-1 . . . aagtgtagatcaccatgatattcggcaagc
BBa_K3791009gRNA SpectinomycinDNALaura Snchez Ruiz, Auba Fuster Pal41-1 . . . aagtgtagatgctcatcgccagcccagtcg
BBa_K3791010gRNA Ampicillin constructDNALaura Snchez Ruiz, Auba Fuster Pal59-1 . . . aagtgtagattccgcctccatccagtctat
BBa_K3791011gRNA Chloramphenicol constructDNALaura Snchez Ruiz, Auba Fuster Pal59-1 . . . aagtgtagattgatggcttccatgtcggca
BBa_K3791012gRNA Erythromycin constructDNALaura Snchez Ruiz, Auba Fuster Pal59-1 . . . aagtgtagatcgcagcagagaagcctggat
BBa_K3791013gRNA Kanamycin constructDNALaura Snchez Ruiz, Auba Fuster Pal59-1 . . . aagtgtagatcaccatgatattcggcaagc
BBa_K3791014gRNA Spectinomycin constructDNALaura Snchez Ruiz, Auba Fuster Pal59-1 . . . aagtgtagatgctcatcgccagcccagtcg
BBa_K3791015Efficient gRNA AmpicillinDNALaura Snchez Ruiz, Auba Fuster Pal66-1 . . . tctattaattaatttctactaagtgtagat
BBa_K3791016Efficient gRNA ChloramphenicolDNALaura Snchez Ruiz, Auba Fuster Pal66-1 . . . cggcagaattaatttctactaagtgtagat
BBa_K3791017Efficient gRNA ErythromycinDNALaura Snchez Ruiz, Auba Fuster Pal66-1 . . . tggatgttataatttctactaagtgtagat
BBa_K3791018Efficient gRNA KanamycinDNALaura Snchez Ruiz, Auba Fuster Pal66-1 . . . caagcaggctaatttctactaagtgtagat
BBa_K3791019Efficient gRNA SpectinomycinDNALaura Snchez Ruiz, Auba Fuster Pal66-1 . . . agtcgggcgtaatttctactaagtgtagat
BBa_K3791020Efficient gRNA Ampicillin constructDNALaura Snchez Ruiz, Auba Fuster Pal145-1 . . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791021Efficient gRNA Chloramphenicol constructDNALaura Snchez Ruiz, Auba Fuster Pal145-1 . . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791022Efficient gRNA Erythromycin constructDNALaura Snchez Ruiz, Auba Fuster Pal145-1 . . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791023Efficient gRNA Kanamycin constructDNALaura Snchez Ruiz, Auba Fuster Pal145-1 . . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791024Efficient gRNA Spectinomycin constructDNALaura Snchez Ruiz, Auba Fuster Pal145-1 . . . cgaaaggggggccttttttcgttttggtcc
BBa_K4298001yEvolvr-TM8.3CompositeBuyao Li7802-1 . . . caacttgaaaaagtggcaccgagtcggtgc
BBa_K4298002enCas9-PolI5MCodingBuyao Li7698-1 . . . gttttgggacgctcgaaggctttaatttgc
BBa_K549000123-nt sequence binds CasRx to cleave WNV genome; modifiable target 2RNAIOANNIS VASILEIOS ELAFROPOULOS 33-1 . . . cgaagaacgccaagagagccaacacaaaac
BBa_K5490008Scaffold or direct repeat region (DR 36)RegulatoryIOANNIS VASILEIOS ELAFROPOULOS 36-1 . . . aacccctaccaactggtcggggtttgaaac
BBa_K5490009Scaffold or direct repeat region (DR 30)RegulatoryIOANNIS VASILEIOS ELAFROPOULOS 30-1aacccctaccaactggtcggggtttgaaac
BBa_K5490018gRNA FOR CASRX , SPACER 1 (WNV)RNAIOANNIS VASILEIOS ELAFROPOULOS 99-1 . . . aacccctaccaactggtcggggtttgaaac
BBa_K5490019gRNA FOR CASRX , SPACER 2 (WNV)RNAIOANNIS VASILEIOS ELAFROPOULOS 99-1 . . . aacccctaccaactggtcggggtttgaaac
BBa_K5490020gRNA FOR CASRX , SPACER 3 (WNV)RNAIOANNIS VASILEIOS ELAFROPOULOS 109-1 . . . aacccctaccaactggtcggggtttgaaac
BBa_K5177024pTF_sfmA plasmid fragment cassetteDNAJia Run Dong351-1 . . . tcaaaaccacgttgttttgaatttgaattc
BBa_K5177025Proposed pTF_fimA plasmid fragment cassetteDNAJia Run Dong351-1 . . . cctacccaggttcagggacgtcatgaattc
BBa_K1026001dCas9CodingHongyi WU41132 . . . ttgagtcagctaggaggtgactgagtcgac
BBa_K1137014tracRNA-CAS9 CodingNicolas Koutsoubelis, Anne Lchner4522  . . . aaaaaccccgcttcggcggggttttttttt
BBa_K1559002rearranged CRISPR/Cas9 system without promoterCodingXiuqi (Rex) Xia50806 . . . aatttaaactttttattttaggaggcaaaa
BBa_K1559003CRISPR/Cas9 system with Anderson high-expression constitutive promoterGeneratorXiuqi (Rex) Xia5127  . . . aatttaaactttttattttaggaggcaaaa
BBa_K1559004CRISPR/Cas9 system with Anderson medium-expression constitutive promoterGeneratorXiuqi (Rex) Xia5127  . . . aatttaaactttttattttaggaggcaaaa
BBa_K1559005CRISPR/Cas9 system with Anderson low-expression constitutive promoterGeneratorXiuqi (Rex) Xia5127  . . . aatttaaactttttattttaggaggcaaaa
BBa_K1559006CRISPR/Cas9 system with pBAD inducible promoterGeneratorXiuqi (Rex) Xia5222  . . . aatttaaactttttattttaggaggcaaaa
BBa_K1559007CRISPR/Cas9 system with pLac inducible promoterGeneratorXiuqi (Rex) Xia5147  . . . aatttaaactttttattttaggaggcaaaa
BBa_K1559008CRISPR/Cas9 system with pRha inducible promoterGeneratorXiuqi (Rex) Xia5214  . . . aatttaaactttttattttaggaggcaaaa
BBa_K1774001Cas9 (optimized for expression in E. coli)CodingHKU iGEM 201541071 . . . attgatctgagtcagctgggaggcgactaa
BBa_K1994015sgRNA with 5' golden gate adapter and COM protein binding siteRNALiam Carroll176  . . . ggcacgtcatctgacgtgccttttttattt
BBa_K1994016sgRNA with 5' golden gate adapter and MS2 coat protein binding siteRNALiam Carroll172  . . . ggcacgtcatctgacgtgccttttttattt
BBa_K1994019Multiple dCas9 binding site sequenceRegulatoryLiam Carroll2392 . . . atgattatcgttgttgctagccggcgtgga
BBa_K1982009Eukaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor)CodingZexu Li1848  . . . actacaagtttgggaaaaaatggttgcaaa
BBa_K1994044dCas9 PromoterRegulatoryEgheosa Ogbomo483 . . . tgaaatcatcaaactcattatggatttaat
BBa_K1982012VP64 transcription activitorProtein_DomainZexu Li246  . . . gactacaaggacgacgacgacaaataataa
BBa_K2483002Lac regulated dCas9 with LacI constitutively expressedDeviceBryan Nowack5674  . . . attgatttgagtcagctaggaggtgactaa
BBa_K2483004regulated dCas9 with sgRNAs and IAA enzymes fused to MS2 and PP7CompositeBryan Nowack10136  . . . ggcacgtcatctgacgtgccttttttattt
BBa_K2558006gRNA targeting PhIF promotorRNATianze Huang963 . . . caacttgaaaaagtggcaccgagtcggtgc
BBa_K2558007gRNA targeting lux pR and RiboJRNATianze Huang962 . . . caacttgaaaaagtggcaccgagtcggtgc
BBa_K3201000nCpf1 (RNA-guided DNA nickase)CodingAnastasios Galanis 3921  . . . tggctggcctacatccaggagctgcgcaac
BBa_K3454000MCR-1_crRNA_A_SynthesisOtherMingxuan Chi63-1 . . . acatctattgaccgcgaccgccaatcttac
BBa_K3454001MCR-1_crRNA_B_SynthesisOtherMingxuan Chi63-1 . . . acatctactgacacttatggcacggtctat
BBa_K549000023-nt sequence binds CasRx to cleave WNV genome modifiable target 1.RNAIOANNIS VASILEIOS ELAFROPOULOS 33-1 . . . acaacagatgatttcgtgcaccagcttcca
BBa_K549000323-nt sequence binds CasRx to cleave WNV genome; modifiable target 3RNAIOANNIS VASILEIOS ELAFROPOULOS 43-1 . . . gtacgtaatacccccaaagccgtacaagag