Collections/CRISPR
Introduction to CRISPR and Cas9
From UBC 2013: CRISPRs (Clustered Regularly Interspaced Short PalindromicRepeats) are specific regions in some bacterial and archaeal genomes that, together with associated Cas (CRISPR-associated) genes, function as an adaptive immune system in prokaryotes. While the specific ‘adaptive’ nature of this immunity is still under investigation, it is known that exogenous DNA is processed by Cas proteins into short (~30 base pair) sequences that are adjacent to the Protospacer Adjacent Motif (PAM) site. These short pieces of DNA are then incorporated into the host genome between repeat sequences to formspacer elements. The repeat-spacer-repeat array is constitutively expressed (pre-CRISPR RNAs or pre-crRNAs) and processed by Cas proteins to form small RNAs (crRNAs). The small RNAs are then loaded into Cas proteins and act to guide them to initiate the sequence-specific cleavage of the target sequence.
Background from Freiburg 2013: Hidden as an uncharacterized E. coli locus for more than 15 years, Barrangou et al. identified the CRISPR array as a previously unknown adaptive prokaryotic immune system. Almost half of all prokaryotes make use of this defense mechanism against unselective uptake through natural transformation, phage DNA transduction or horizontal gene transfer by conjugation. Invasive DNA or even RNA can be specifically recognized and efficiently cleaved. This unique feature results from the interaction of non-coding RNAs and CRISPR associated (Cas) proteins. From a wide range of known CRISPR subtypes we used CRISPR type II b of S. pyogenes.
The recognition and degradation of invasive DNA by CRISPR/Cas type II occurs in three steps:
- Acquisition: Invasive DNA is recognized via a protospacer adjacent motif (PAM) – the sequence NGG. A short sequence downstream of the PAM sequence is then integrated into the host CRISPR array and is termed spacer. Spacer sequences transcribe for CRISPR RNAs(crRNAs) which help to cleave sequence-specific invasive DNA. These sequences are located between short palindromic repeats, which are neccessary for the functionality of the crRNAs.
- Expression/Transcription: The Cas9 endonuclease is expressed. CRISPR array is then transcribed and processed by RNAse III into crRNAs. These contain the complementary spacer sequence and the direct repeat sequence. The crRNA guides the Cas9 protein specifically to invasive DNA sequences. Furthermore trans-activating crRNAs (tracrRNA) are transcribed and bind to the direct repeat part of the crRNA. The tracrRNA is necessary for the formation of a Cas9-RNA complex.
- Interference: Repeatedly invading DNA, which has been integrated into the CRISPR locus, is detected by the RNA-protein complex and cleaved by Cas9.
Each of these teams have worked on CRISPR based systems for at least some part of their projects. Below, you'll find abstracts for each team, direct links to their CRISPR pages and references. Here is the list of iGEM teams who worked on CRISPR in their projects:
| Team | Year | Parts | Track | Project Title |
|---|---|---|---|---|
| Aachen | 2015 | Parts | Manufacturing | Upcycling Methanol into a Universal Carbon Source |
| BGU_Israel | 2015 | Parts | Health & Medicine | The Boomerang system: engineering logic gate genetic device for detection and treatment of cancer |
| BostonU | 2015 | Parts | Foundational Advance | Developing conditionally dimerizable split protein systems for genetic logic and genome editing applications |
| Chalmers-Gothenburg | 2015 | Parts | New Application | A study in Scarlet |
| Hong_Kong_HKU | 2015 | Parts | New Application | Controllable cell death and DNA degradation by CRISPR cas system |
| NJAU_China | 2015 | Parts | New Application | The Horcrux |
| Paris_Bettencourt | 2015 | Parts | Food & Nutrition | Ferment It Yourself |
| SCU_China | 2015 | Parts | Environment | E. pangu: The Pioneer of Mars |
| Stanford-Brown | 2015 | Parts | Manufacturing | biOrigami: A New Approach to Reduce the Cost of Space Missions |
| Tec-Monterrey | 2015 | Parts | New Application | Insects join iGEM: Sf9 cells as a new chassis for synthetic biology |
| Tufts | 2015 | Parts | Health & Medicine | Delivery of the CRISPR-Cas9 gene editing platform into epithelial cells using Clostridium difficile toxin B |
| Waterloo | 2015 | Parts | Foundational Advance | CRISPieR: re-engineering CRISPR-Cas9 with functional applications in eukaryotic systems |
| Yale | 2015 | Parts | Foundational Advance | Developing a Framework for the Genetic Manipulation of Non-Model and Environmentally Significant Microbes |
| USTC | 2015 | Parts | Hardware | NDM: Nanomachine Detecting Microbiotics |
| Vilnius-Lithuania | 2015 | Parts | Foundational Advance | Controlling the Lifetime of GMOs using ColiClock |
| Duke | 2015 | Parts | Foundational Advance | DNA Sequence Sensing with dCas9 Applied to Antibiotic Resistance Detection and Elimination |
| EPF_Lausanne | 2015 | Parts | Information Processing | Bio LOGIC: Biologic Orthogonal gRNA-Implemented Circuit |
| NU_Kazakhstan | 2015 | Parts | Health & Medicine | Prevention of Dental Caries by Targeting Streptococcus Mutans |
| Peking | 2015 | Parts | Health & Medicine | Fighting Against Tuberculosis: Making Invisible Visible |
| Tsinghua | 2015 | Parts | Hardware | Developing light-controlled systems to manipulate genetic information in prokaryotes |
| Washington | 2015 | Parts | New Application | Lab on a Strip: Developing a Novel Platform for Yeast Biosensors |
| William_and_Mary | 2015 | Parts | Measurement | Measurement of Promoter-Based Transcriptional Noise for Application in Gene Network Design |
| British_Columbia | 2013 | Parts | Food & Energy | ~ |
| Chiba | 2013 | Parts | New Application | ~ |
| Duke | 2013 | Parts | New Application | ~ |
| Freiburg | 2013 | Parts | Foundational Advance | ~ |
| MIT | 2013 | Parts | Health & Medicine | ~ |
| NJU_NJUT_China | 2013 | Parts | New Application | ~ |
| Paris_Bettencourt | 2013 | Parts | Health & Medicine | ~ |
| Penn_State | 2013 | Parts | Manufacturing | ~ |
| SJTU-BioX-Shanghai | 2013 | Parts | New Application | ~ |
| Stanford-Brown | 2013 | Parts | New Application | ~ |
| UCSF | 2013 | Parts | Foundational Advance | ~ |
| WHU-China | 2013 | Parts | New Application | ~ |
CRISPR and Cas9 parts in the Registry
Many of the teams on this page have submitted parts associated with CRISPR/Cas9:
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1218003 | CRISPR CasA E. coli (Modern) | Coding | Trevor Kalkus, Gordon Wade, Alissa Greenberg | 1509 | . . . aaaccgcaaggagggccatcaaatggctga | |
| BBa_K1218011 | Cas9 | Coding | Sophia Liang | 5080 | 2 | . . . catgttataataggcaaaagaagagtagtg |
| BBa_K1129006 | Cas 9 from Streptococcus thermophilus | Coding | UBC iGEM 2013 | 4167 | . . . atagaccttgccaaactaggagagggttaa | |
| BBa_K1026002 | Constitutively Expressed gRNA targeting mRFP | Composite | Hongyi WU | 266 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1218004 | CRISPR CasA (Ancestral) | Coding | Trevor Kalkus, Gordon Wade, Alissa Greenberg | 1340 | . . . gatcacaaccaccgtcataagcattaatga | |
| BBa_K1081000 | J13002-dcas9 | Composite | Hangxing Jia | 4180 | . . . cgcattgatttgagtcagctaggaggtgac | |
| BBa_K1160000 | coding sequence of Cas9 from CRISPR system type II | Plasmid | Huang Xingxu | 9159 | . . . acatttccccgaaaagtgccacctgacgtc | |
| BBa_K1150000 | dCas9 | Coding | Freiburg 2013 | 4101 | 42 | . . . cggatcgacctgtctcagctgggaggcgac |
| BBa_K1150017 | dCas9 with CMV promoter | Device | Freiburg 2013 | 5012 | . . . aggcatgctggggatgcggtgggctctatg | |
| BBa_K1026000 | Constitutively Expressed dCas9 Operon | Composite | Hongyi WU | 4311 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1150050 | Truncated CMV dCas9 Device #4 | Device | Natalie Louis and Lisa Schmunk | 3626 | . . . aggcatgctggggatgcggtgggctctatg | |
| BBa_K1179002 | Hef1A_Cas9-VP16 | Generator | Brandon Nadres | 5141 | . . . ggtgggacgcgtgagcttcagtgcaggtga | |
| BBa_K1137013 | crRNA anti KAN | Coding | Nicolas Koutsoubelis, Anne Loechner | 251 | . . . aaacttcagcacactgagacttgttgagtt | |
| BBa_K1982000 | tCas9-CIBN (Prokaryotic LACE system) | Device | Zexu Li | 4731 | . . . ccatacgatgttccagattacgcttaataa | |
| BBa_K1982001 | Prokaryotic tCAS9 | Coding | Zexu Li | 4122 | . . . aggattgacctgtcccaactgggaggcgac | |
| BBa_K1982002 | Prokaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor) | Coding | Zexu Li | 1854 | . . . actacaagtttgggaaaaaatggttgcaaa | |
| BBa_K1982003 | CIBN(the N-terminal fragment of CIB1) | Coding | Zexu Li | 612 | . . . ccatacgatgttccagattacgcttaataa | |
| BBa_K1982004 | tCas9-CIBN (Prokaryotic LACE system) | Device | Zexu Li | 4731 | . . . ccatacgatgttccagattacgcttaataa | |
| BBa_K1982005 | CRY2-VP64(Prokaryotic LACE system) | Device | Zexu Li | 2100 | . . . gactacaaggacgacgacgacaaataataa | |
| BBa_K1982006 | tCas9-Vp64(Prokaryotic) | Device | Zexu Li | 4368 | . . . gactacaaggacgacgacgacaaataataa | |
| BBa_K1994013 | sgRNA with dCas9 binding site sequence 9 and PP7 handle insert | RNA | Liam Carroll | 189 | . . . gcacgtcatctgacgtgccttttttattta | |
| BBa_K1994017 | sgRNA with 5' golden gate adapter and PP7 protein binding site | RNA | Liam Carroll | 178 | . . . ggcacgtcatctgacgtgccttttttattt | |
| BBa_K2017000 | C-split Cas9 + DnaE C-intein | Protein_Domain | Monica Victoria Gutierrez Salazar | 2358 | . . . aaggtgcccaagaagaagaggaaggtgtga | |
| BBa_K2017001 | N-split Cas9 + DnaE N-intein | Protein_Domain | Monica Victoria Gutierrez Salazar | 2241 | . . . gatttgatgagggtggacaacctccctaac | |
| BBa_K2017007 | 35s:5'+ Ga20ox consense + SAGTI-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 3057 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K2017008 | 35s + Ga20ox consense + RSIAT-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 2836 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K2017009 | 35s + Ga20ox consense + AEK-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 2872 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K2017011 | 35s:5' + TFL consense + SAGTI-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 3057 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K2017010 | 35s + Ga20ox consense + RSIAT-TEV-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 2869 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K2017012 | 35s + TFL consense + RSIAT-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 2836 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K2017013 | 35s + TFL consense + AEK-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 2872 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K2017014 | 35s + TFL consense + RSIAT-TEV-Luciferase + Tnos | Device | Monica Victoria Gutierrez Salazar | 2869 | . . . gttactagatcggcaattccgctagagacc | |
| BBa_K1982007 | Eukaryotic tCAS9 | Coding | Zexu Li | 4121 | . . . aaggattgacctgtcccaactgggaggcga | |
| BBa_K1982008 | tCas9-CIBN (Eukaryotic LACE system) | Coding | Zexu Li | 4731 | . . . ccatacgatgttccagattacgcttaataa | |
| BBa_K1982010 | CRY2-VP64(Eukaryotic LACE system) | Coding | Zexu Li | 2100 | . . . gactacaaggacgacgacgacaaataataa | |
| BBa_K1982011 | tCas9-Vp64(Eukaryoticc) | Coding | Zexu Li | 4368 | . . . gactacaaggacgacgacgacaaataataa | |
| BBa_K1946002 | sgRNA targeting LacI | RNA | Musa Efe Işılak | 205 | . . . tctgatgagtccgtgaggacgaaaaaaaaa | |
| BBa_K1994021 | sgRNA containing two golden gate adapters | RNA | Isobel Holden | 157 | . . . ggcacgtcatctgacgtgccttttttattt | |
| BBa_K1994025 | BsaI-GFP-dCas9 | Composite | Egheosa Ogbomo | 5075 | . . . attgatttgagtcagctaggaggtgactga | |
| BBa_K2483005 | sgRNA target site couples facing each other with 6 bp spacer | DNA | Sophia Borowski | 850 | . . . cgtctgtaatcgccctttgtacgtgaacgg | |
| BBa_K2483006 | sgRNA target site couples facing each other with 18 bp spacer | DNA | Bryan Nowack | 955 | . . . ttgaccgcggtcttcctccacattcctgtc | |
| BBa_K2361000 | spdCas9 | Coding | Mart Bartelds | 4120 | . . . cagctaggaggtgactaagtcgacctcgag | |
| BBa_K2361001 | dCas9 VRER | Coding | Mart Bartelds | 4108 | . . . attgatttgagtcagctaggaggtgactga | |
| BBa_K2361004 | CRISPR array | RNA | Sebald Verkuijl | 639 | . . . tttatctgttgtttgtcggtgaacgctctc | |
| BBa_K2371004 | sgRNA generator for EML4-ALK variant A 23 | Composite | Qi Xiao | 164 | . . . gcctctaaacgggtcttgaggggttttttg | |
| BBa_K2371005 | sgRNA generator for EML4-ALK variant A 33 | Composite | Qi Xiao | 164 | . . . gcctctaaacgggtcttgaggggttttttg | |
| BBa_K2371006 | sgRNA generator for EML4-ALK variant A 83 | Composite | Qi Xiao | 164 | . . . gcctctaaacgggtcttgaggggttttttg | |
| BBa_K2558201 | dCas9 generator with Anderson weak promotor | Generator | Tianze Huang | 4308 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2558003 | dCas9 | Coding | Tianze Huang | 4107 | 6 | . . . attgatttgagtcagctaggaggtgactaa |
| BBa_K2627003 | crRNA targeting GltA | RNA | Zhaoqin Zhang | 162 | . . . tttttttaagcttggctgttttggcggatg | |
| BBa_K2627004 | crRNA targeting GltA | Composite | Zhaoqin Zhang | 477 | . . . ggatttgaacgttgcgaaggatagcaccac | |
| BBa_K2660006 | N-Cas9 | Coding | Victor Nunes de Jesus, Danielle Biscaro Pedrolli | 3459 | . . . ctagtggttgctaaggtggaaaaagggaaa | |
| BBa_K2660007 | C-Cas9 | Coding | Danielle Biscaro Pedrolli,Victor Nunes de Jesus | 648 | . . . attgatttgagtcagcttggcggtgactga | |
| BBa_K3799000 | EiCsm6,A CRISPR system endoribonuclease | Coding | Shubhamay Das | 1293 | -1 | . . . ttcaaccaatccatcaaggagctgctttaa |
| BBa_K3791000 | Spacer gRNA Ampicillin | DNA | Auba Fuster Pal, Laura Snchez Ruiz | 20 | -1 | tccgcctccatccagtctat |
| BBa_K3977000 | Cas12j-D394A (or dCasΦ), for more see 2021 SCU-China wiki page result and model | Coding | Yilong Xu | 2271 | -1 | . . . accccggctcaggaaccgtcccagactagc |
| BBa_K3791001 | Spacer gRNA Chloramphenicol | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 20 | -1 | tgatggcttccatgtcggca |
| BBa_K3791002 | Spacer gRNA Erythromycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 20 | -1 | cgcagcagagaagcctggat |
| BBa_K3791003 | Spacer gRNA Kanamycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 20 | -1 | caccatgatattcggcaagc |
| BBa_K3791004 | Spacer gRNA Spectinomycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 20 | -1 | gctcatcgccagcccagtcg |
| BBa_K3791005 | gRNA Ampicillin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 41 | -1 | . . . aagtgtagattccgcctccatccagtctat |
| BBa_K3791006 | gRNA Chloramphenicol | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 41 | -1 | . . . aagtgtagattgatggcttccatgtcggca |
| BBa_K3791007 | gRNA Erythromycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 41 | -1 | . . . aagtgtagatcgcagcagagaagcctggat |
| BBa_K3791008 | gRNA Kanamycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 41 | -1 | . . . aagtgtagatcaccatgatattcggcaagc |
| BBa_K3791009 | gRNA Spectinomycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 41 | -1 | . . . aagtgtagatgctcatcgccagcccagtcg |
| BBa_K3791010 | gRNA Ampicillin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 59 | -1 | . . . aagtgtagattccgcctccatccagtctat |
| BBa_K3791011 | gRNA Chloramphenicol construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 59 | -1 | . . . aagtgtagattgatggcttccatgtcggca |
| BBa_K3791012 | gRNA Erythromycin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 59 | -1 | . . . aagtgtagatcgcagcagagaagcctggat |
| BBa_K3791013 | gRNA Kanamycin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 59 | -1 | . . . aagtgtagatcaccatgatattcggcaagc |
| BBa_K3791014 | gRNA Spectinomycin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 59 | -1 | . . . aagtgtagatgctcatcgccagcccagtcg |
| BBa_K3791015 | Efficient gRNA Ampicillin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 66 | -1 | . . . tctattaattaatttctactaagtgtagat |
| BBa_K3791016 | Efficient gRNA Chloramphenicol | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 66 | -1 | . . . cggcagaattaatttctactaagtgtagat |
| BBa_K3791017 | Efficient gRNA Erythromycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 66 | -1 | . . . tggatgttataatttctactaagtgtagat |
| BBa_K3791018 | Efficient gRNA Kanamycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 66 | -1 | . . . caagcaggctaatttctactaagtgtagat |
| BBa_K3791019 | Efficient gRNA Spectinomycin | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 66 | -1 | . . . agtcgggcgtaatttctactaagtgtagat |
| BBa_K3791020 | Efficient gRNA Ampicillin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 145 | -1 | . . . cgaaaggggggccttttttcgttttggtcc |
| BBa_K3791021 | Efficient gRNA Chloramphenicol construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 145 | -1 | . . . cgaaaggggggccttttttcgttttggtcc |
| BBa_K3791022 | Efficient gRNA Erythromycin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 145 | -1 | . . . cgaaaggggggccttttttcgttttggtcc |
| BBa_K3791023 | Efficient gRNA Kanamycin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 145 | -1 | . . . cgaaaggggggccttttttcgttttggtcc |
| BBa_K3791024 | Efficient gRNA Spectinomycin construct | DNA | Laura Snchez Ruiz, Auba Fuster Pal | 145 | -1 | . . . cgaaaggggggccttttttcgttttggtcc |
| BBa_K4298001 | yEvolvr-TM8.3 | Composite | Buyao Li | 7802 | -1 | . . . caacttgaaaaagtggcaccgagtcggtgc |
| BBa_K4298002 | enCas9-PolI5M | Coding | Buyao Li | 7698 | -1 | . . . gttttgggacgctcgaaggctttaatttgc |
| BBa_K5490001 | 23-nt sequence binds CasRx to cleave WNV genome; modifiable target 2 | RNA | IOANNIS VASILEIOS ELAFROPOULOS | 33 | -1 | . . . cgaagaacgccaagagagccaacacaaaac |
| BBa_K5490008 | Scaffold or direct repeat region (DR 36) | Regulatory | IOANNIS VASILEIOS ELAFROPOULOS | 36 | -1 | . . . aacccctaccaactggtcggggtttgaaac |
| BBa_K5490009 | Scaffold or direct repeat region (DR 30) | Regulatory | IOANNIS VASILEIOS ELAFROPOULOS | 30 | -1 | aacccctaccaactggtcggggtttgaaac |
| BBa_K5490018 | gRNA FOR CASRX , SPACER 1 (WNV) | RNA | IOANNIS VASILEIOS ELAFROPOULOS | 99 | -1 | . . . aacccctaccaactggtcggggtttgaaac |
| BBa_K5490019 | gRNA FOR CASRX , SPACER 2 (WNV) | RNA | IOANNIS VASILEIOS ELAFROPOULOS | 99 | -1 | . . . aacccctaccaactggtcggggtttgaaac |
| BBa_K5490020 | gRNA FOR CASRX , SPACER 3 (WNV) | RNA | IOANNIS VASILEIOS ELAFROPOULOS | 109 | -1 | . . . aacccctaccaactggtcggggtttgaaac |
| BBa_K5177024 | pTF_sfmA plasmid fragment cassette | DNA | Jia Run Dong | 351 | -1 | . . . tcaaaaccacgttgttttgaatttgaattc |
| BBa_K5177025 | Proposed pTF_fimA plasmid fragment cassette | DNA | Jia Run Dong | 351 | -1 | . . . cctacccaggttcagggacgtcatgaattc |
| BBa_K1026001 | dCas9 | Coding | Hongyi WU | 4113 | 2 | . . . ttgagtcagctaggaggtgactgagtcgac |
| BBa_K1137014 | tracRNA-CAS9 | Coding | Nicolas Koutsoubelis, Anne Lchner | 4522 | . . . aaaaaccccgcttcggcggggttttttttt | |
| BBa_K1559002 | rearranged CRISPR/Cas9 system without promoter | Coding | Xiuqi (Rex) Xia | 5080 | 6 | . . . aatttaaactttttattttaggaggcaaaa |
| BBa_K1559003 | CRISPR/Cas9 system with Anderson high-expression constitutive promoter | Generator | Xiuqi (Rex) Xia | 5127 | . . . aatttaaactttttattttaggaggcaaaa | |
| BBa_K1559004 | CRISPR/Cas9 system with Anderson medium-expression constitutive promoter | Generator | Xiuqi (Rex) Xia | 5127 | . . . aatttaaactttttattttaggaggcaaaa | |
| BBa_K1559005 | CRISPR/Cas9 system with Anderson low-expression constitutive promoter | Generator | Xiuqi (Rex) Xia | 5127 | . . . aatttaaactttttattttaggaggcaaaa | |
| BBa_K1559006 | CRISPR/Cas9 system with pBAD inducible promoter | Generator | Xiuqi (Rex) Xia | 5222 | . . . aatttaaactttttattttaggaggcaaaa | |
| BBa_K1559007 | CRISPR/Cas9 system with pLac inducible promoter | Generator | Xiuqi (Rex) Xia | 5147 | . . . aatttaaactttttattttaggaggcaaaa | |
| BBa_K1559008 | CRISPR/Cas9 system with pRha inducible promoter | Generator | Xiuqi (Rex) Xia | 5214 | . . . aatttaaactttttattttaggaggcaaaa | |
| BBa_K1774001 | Cas9 (optimized for expression in E. coli) | Coding | HKU iGEM 2015 | 4107 | 1 | . . . attgatctgagtcagctgggaggcgactaa |
| BBa_K1994015 | sgRNA with 5' golden gate adapter and COM protein binding site | RNA | Liam Carroll | 176 | . . . ggcacgtcatctgacgtgccttttttattt | |
| BBa_K1994016 | sgRNA with 5' golden gate adapter and MS2 coat protein binding site | RNA | Liam Carroll | 172 | . . . ggcacgtcatctgacgtgccttttttattt | |
| BBa_K1994019 | Multiple dCas9 binding site sequence | Regulatory | Liam Carroll | 239 | 2 | . . . atgattatcgttgttgctagccggcgtgga |
| BBa_K1982009 | Eukaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor) | Coding | Zexu Li | 1848 | . . . actacaagtttgggaaaaaatggttgcaaa | |
| BBa_K1994044 | dCas9 Promoter | Regulatory | Egheosa Ogbomo | 48 | 3 | . . . tgaaatcatcaaactcattatggatttaat |
| BBa_K1982012 | VP64 transcription activitor | Protein_Domain | Zexu Li | 246 | . . . gactacaaggacgacgacgacaaataataa | |
| BBa_K2483002 | Lac regulated dCas9 with LacI constitutively expressed | Device | Bryan Nowack | 5674 | . . . attgatttgagtcagctaggaggtgactaa | |
| BBa_K2483004 | regulated dCas9 with sgRNAs and IAA enzymes fused to MS2 and PP7 | Composite | Bryan Nowack | 10136 | . . . ggcacgtcatctgacgtgccttttttattt | |
| BBa_K2558006 | gRNA targeting PhIF promotor | RNA | Tianze Huang | 96 | 3 | . . . caacttgaaaaagtggcaccgagtcggtgc |
| BBa_K2558007 | gRNA targeting lux pR and RiboJ | RNA | Tianze Huang | 96 | 2 | . . . caacttgaaaaagtggcaccgagtcggtgc |
| BBa_K3201000 | nCpf1 (RNA-guided DNA nickase) | Coding | Anastasios Galanis | 3921 | . . . tggctggcctacatccaggagctgcgcaac | |
| BBa_K3454000 | MCR-1_crRNA_A_Synthesis | Other | Mingxuan Chi | 63 | -1 | . . . acatctattgaccgcgaccgccaatcttac |
| BBa_K3454001 | MCR-1_crRNA_B_Synthesis | Other | Mingxuan Chi | 63 | -1 | . . . acatctactgacacttatggcacggtctat |
| BBa_K5490000 | 23-nt sequence binds CasRx to cleave WNV genome modifiable target 1. | RNA | IOANNIS VASILEIOS ELAFROPOULOS | 33 | -1 | . . . acaacagatgatttcgtgcaccagcttcca |
| BBa_K5490003 | 23-nt sequence binds CasRx to cleave WNV genome; modifiable target 3 | RNA | IOANNIS VASILEIOS ELAFROPOULOS | 43 | -1 | . . . gtacgtaatacccccaaagccgtacaagag |