Search results (Hint: Try the special 'Search Parts' system on the main page)

Create the page "Synthesis" on this wiki! See also the search results found.

Page title matches

• Plasmid backbones/Synthesis
  ==Plasmids used in DNA synthesis of BioBrick parts== ...t DNA synthesis. Here is a list of plasmid backbones used by assorted DNA synthesis companies.
  981 B (133 words) - 16:41, 22 December 2008
• DNA Synthesis
  32 B (4 words) - 19:06, 9 June 2020

Page text matches

• Part:BBa K419012:Experience
  ...indicates the CrtEBIY with constitutive promoter (R001) DNA fragment. The synthesis system composite was transformed into DH5-alpha E. coli for further experim ===Demonstration of Synthesis System [contains the part BBa_k419012 (constitutive promoter-CrtEBIY) in th
  5 KB (760 words) - 13:37, 6 November 2010
• Part:BBa K3580102:Experience
  ==1. <i>in vivo</i> monoterpene synthesis== ...s.png|1500px|thumb|center|Fig. 1-1 Schematic of <i>in vivo</i> monoterpene synthesis]]
  13 KB (1,932 words) - 00:43, 3 December 2020
• Chassis/Cell-Free Systems/Commercial E.coli S30/F2620
  #'''Rate of GFP synthesis''' of 100nM AHL #'''Transfer Function'''- [AHL] vs rate of GFP synthesis
  6 KB (1,037 words) - 00:37, 27 October 2007
• Part:BBa K3580101:Experience
  ==1. <i>in vivo</i> monoterpene synthesis== ...s.png|1500px|thumb|center|Fig. 1-1 Schematic of <i>in vivo</i> monoterpene synthesis]]
  11 KB (1,666 words) - 00:44, 3 December 2020
• Part:BBa K3711089
  ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu
  12 KB (1,776 words) - 13:44, 21 October 2021
• Part:BBa K4719017
  ...acterial cellulose-PHB polymer</b>. This was achieved introducing this PHB synthesis operon into <i> K. xylinus</i>. Therefore, after transformation with plasmi This construct is a polyhydroxybutyrate synthesis operon (<i>phaC, phaA, phaB</i>) producing PHB along with bacterial cellulo
  12 KB (1,760 words) - 22:09, 11 October 2023
• Part:BBa K300010:Experience
  ...mated with the algorithm described in ''Data analysis to estimate the HSL synthesis rate per cell'' section. ...oach was proposed to estimate many interesting parameters, such as the HSL synthesis rate per cell, and an algorithm was proposed in order to evaluate the O.D.s
  28 KB (4,317 words) - 01:43, 28 October 2010
• Part:BBa K300009:Experience
  ...estimated with the algorithm described ''Data analysis to estimate the HSL synthesis rate per cell'' section; ...oach was proposed to estimate many interesting parameters, such as the HSL synthesis rate per cell, and an algorithm was proposed in order to evaluate the O.D.s
  34 KB (5,311 words) - 03:18, 28 October 2010
• Part:BBa I4102:Experience
  ...estimated with the algorithm described ''Data analysis to estimate the HSL synthesis rate per cell'' section; ...oach was proposed to estimate many interesting parameters, such as the HSL synthesis rate per cell, and an algorithm was proposed in order to evaluate the O.D.s
  35 KB (5,352 words) - 00:35, 28 October 2010
• Part:BBa K3331012
  A circuit for efficient exopolysaccharide synthesis ...enzymes GalU and PmgA under the regulation of LacI-Ptrc promoter. The EPS synthesis circuit was as below:
  10 KB (1,547 words) - 11:04, 12 October 2023
• Part:BBa K4182009
  ...er conservation and sand fixation of soil. We designed and constructed EPS synthesis circuit by overexpression of pgmA (phosphoglucose mutase)and galU (UDP gluc ...enzymes GalU and PmgA under the regulation of LacI-Ptrc promoter. The EPS synthesis circuit was as below:
  7 KB (982 words) - 04:10, 14 October 2022
• Part:BBa K3633004
  ..._SFLS_SPBS--Indigo Synthesis--Pathway.png|600px|center|thumb|Fig 1. Indigo Synthesis Pathway]] ...l had lots of drawbacks that it can cause pollution and the substrates for synthesis were harmful to people's health.<br>
  8 KB (1,242 words) - 07:06, 4 October 2021
• Part:BBa K3711088
  ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu
  11 KB (1,611 words) - 13:43, 21 October 2021
• Part:BBa K4182009:Design
  To facilitate the modularized design of plasmids, we named the EPS synthesis verification plasmid 4, which will be referred to as plasmid 4 in the follo ...n gene progenitor contains the EPS synthesis gene, LacI regulatory protein synthesis gene + Ptrc promoter, as shown in Figure 1.
  7 KB (1,089 words) - 05:57, 12 October 2022
• Part:BBa K2365052
  === Origin: Saccharomyces cerevisiae, synthesis === Origin: synthesis
  14 KB (2,015 words) - 06:49, 20 October 2021
• Part:BBa K2753002
  ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co
  14 KB (2,217 words) - 03:24, 28 October 2020
• Part:BBa K3711080
  ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o
  9 KB (1,390 words) - 13:34, 21 October 2021
• Part:BBa K3711083
  ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o
  9 KB (1,383 words) - 13:39, 21 October 2021
• Part:BBa K3711085
  ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o
  9 KB (1,382 words) - 13:41, 21 October 2021
• Part:BBa K3996014
  === Origin: Saccharomyces cerevisiae, synthesis === Origin: synthesis
  14 KB (1,932 words) - 16:53, 21 October 2021
• Part:BBa K4595018
  ...eered bacterium <i> S.o oneidensis</i> MR-1, strengthening the common NAD+ synthesis pathway, and adding a new exogenous pathway for de novo NAD+ synthesis. Thus, the intracellular NAD+
  7 KB (1,109 words) - 03:02, 12 October 2023
• Part:BBa K3932000:Design
  <li><b>The synthesis of Proteinase-K starts if our ECN senses arabinose by its pBAD promoter</b> ...ow ammonia level, activated NtrC induce the glnAp2 promoter to start TetR synthesis</li>
  20 KB (2,866 words) - 02:37, 22 October 2021
• Part:BBa K4155002
  ...hesis method to synthesize zinc responsive promoter (pzntR) and riboflavin synthesis gene (ribB). ...lavin synthesis gene (ribB) by direct DNA synthesis method. The riboflavin synthesis gene for riboflavin expression promotes electron transfer from the cell to
  7 KB (1,056 words) - 08:27, 12 October 2022
• Part:BBa F2620:Experience/Endy/Data analysis
  ...d, we can calculate the total synthesis rate of GFP and hence the per cell synthesis rate of GFP without considering dilution due to cell growth. ...r sec). We defined the output of <partinfo>BBa_E0240</partinfo> to be the synthesis rate of mature GFP, S_{cell} (GFP molecules per cell sec). The model inclu
  8 KB (1,329 words) - 17:16, 11 February 2008
• Part:BBa K1349001
  <p>This part was designed to allow the rapid synthesis of the alarmone ppGpp, responsible for the stringent response in E. coli. I <p>When <em>Escherichia coli</em> cells are exposed to extreme starvation, synthesis of their rRNA is quickly curtailed for adapting the undernourished environm
  8 KB (1,297 words) - 22:12, 27 October 2020
• Part:BBa K2587024
  ...R and then to the P_<i>lux</i> promoter, which will activate the synthesis of the lysis protein E from the bacteriophage phiX174. ...ivity, which is necessary for catalysis of lipid I, a factor for cell wall synthesis (<strong>Cytolysis</strong>) (1) </li>
  10 KB (1,599 words) - 00:38, 18 October 2018
• Part:BBa K3504015
  ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...the identified interactions of nsP3 with host factors influence viral RNA synthesis or whether they are indicative of another nsP3 function that regulates the
  5 KB (713 words) - 20:35, 26 October 2020
• Part:BBa K3633010
  ..._SFLS_SPBS--Indigo Synthesis--Pathway.png|600px|center|thumb|Fig 1. Indigo Synthesis Pathway]] ...l had lots of drawbacks that it can cause pollution and the substrates for synthesis were harmful to people's health.<br>
  4 KB (618 words) - 10:13, 27 October 2020
• Part:BBa K3711090
  ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy
  10 KB (1,600 words) - 13:36, 21 October 2021
• Part:BBa K3711091
  ...er and blocks the expression of its downstream proteins, thus blocking the synthesis of pigment. ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy
  10 KB (1,548 words) - 13:40, 21 October 2021
• Part:BBa K4085015
  GDP-L-fucose is a key precursor for the synthesis of 2-FL, and it can be synthesized through two pathways. One is the de novo ...using the enzyme-catalyzed synthesis route, the yield of enzyme-catalyzed synthesis of 2'-FL is not high due to the expensive substrate guanosine 5’-diphosph
  16 KB (2,401 words) - 14:44, 12 October 2022
• Part:BBa K4885006
  ...yl-CoA dehydrogenase are rate-limiting enzymes in the butyrate and butanol synthesis pathway. ...engineer C. tyrobutyricum to overexpressed several enzymes to enhance the synthesis pathway of butyrate and butanol. BBa_K4885002 were constructed to enhance t
  6 KB (828 words) - 13:29, 12 October 2023
• Plasmid backbones/Synthesis
  ==Plasmids used in DNA synthesis of BioBrick parts== ...t DNA synthesis. Here is a list of plasmid backbones used by assorted DNA synthesis companies.
  981 B (133 words) - 16:41, 22 December 2008
• Part:BBa K528004
  ===The mechanism of A/U-rich 5'-UTR to promote protein synthesis=== Fig.1. The mechanism of A/U-rich 5'-UTR to promote protein synthesis.<BR>
  4 KB (565 words) - 01:26, 22 October 2019
• Part:BBa K554005
  Origin: synthesis ...We thus decided to create a completely new biobrick, responsible for Il-12 synthesis. The IL-12 gene is used by [http://2011.igem.org/Team:UNICAMP-EMSE_Brazil U
  8 KB (1,266 words) - 07:53, 6 October 2022
• Part:BBa K759004
  Bacterial cellulose-PHB composite was achieved by introducing PHB synthesis operon into <i> K. xylinus</i>. This way, bacteria are able to simultaneous ...719017">BBa_K4719017</a>, containing <i>phaA</i>, is a polyhydroxybutyrate synthesis operon (<i>phaC, phaA, phaB</i>), producing PHB along with bacterial cellul
  4 KB (591 words) - 14:50, 12 October 2023
• Part:BBa K2110105
  ...ethod in molecular biology. Production of proteins using cell-free protein synthesis usually takes a few hours, in contrast to production of proteins in cells, ...reeening of enzymes activities. In the post-genomic era, cell-free protein synthesis has rapidly become the preferred approach for high-throughput functional an
  6 KB (859 words) - 12:03, 20 October 2016
• Part:BBa K1973012
  ...ve the implementation of a system that allows us to control externally the synthesis and turn-down of c-diGMP, we had cloned both genes pleD* and yhjH separatel ...of PleD* increases the intracellular concentration of c-diGMP, whereas the synthesis of YhjH decreases the intracellular concentration of this second messenger.
  10 KB (1,550 words) - 22:52, 19 October 2016
• Part:BBa K1973023
  ...ve the implementation of a system that allows us to control externally the synthesis and turn-down of c-diGMP, we had cloned both genes pleD* and yhjH separatel ...of PleD* increases the intracellular concentration of c-diGMP, whereas the synthesis of YhjH decreases the intracellular concentration of this second messenger.
  10 KB (1,526 words) - 22:50, 19 October 2016
• Part:BBa K274001
  ...s: League of Enhanced MicroGladiators." One of our methods of nanoparticle synthesis and attachment to cells is titled the recombinant method. Through the use o With this data, we intended to perform nanoparticle synthesis with L-tyrosine and MelA-transformed <i>E. coli</i> cells, and have these c
  11 KB (1,605 words) - 15:27, 12 October 2022
• Part:BBa K2205002
  ...y designed by Shin and Noireaux (2010) for expression in cell-free protein synthesis systems and is more efficiently translated than other variants. ...characteristics of an experiment, such as sensitivity, leakage, etc. DeGFP synthesis rate differs for the same element in different chassis. <br>
  6 KB (892 words) - 14:29, 21 October 2021
• Part:BBa K2417000
  ...-Proinsulin, both cell lines showed significantly higher rates of glycogen synthesis than basal levels (Figure 3 and 4), and showed some glucose oxidation activ ...eated with Ecotin-Proinsulin showed significantly higher rates of glycogen synthesis than those at basal levels, and a slight increase in glucose oxidation was
  7 KB (1,008 words) - 01:55, 1 November 2017
• Part:BBa K2417001
  ...-Proinsulin, both cell lines showed significantly higher rates of glycogen synthesis than basal levels (Figure 3 and 4), and also showed significantly greater g ...with Cytoplasmic-Proinsulin showed significantly higher rates of glycogen synthesis and glucose oxidation than basal levels. Significance calculated using an u
  6 KB (804 words) - 01:56, 1 November 2017
• Part:BBa K2753015
  ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co
  11 KB (1,720 words) - 08:21, 27 October 2020
• Part:BBa K3022002
  .... We validated the function of KPD+CFPPK by performing intracellular polyP synthesis using phosphite as the substrate. ...P, +3 valance) as the solo phosphorus source was adopted to evaluate polyP synthesis.
  8 KB (1,161 words) - 13:32, 11 October 2022
• Part:BBa K1807009
  Polyphosphate kinase (PPK) catalyzes the synthesis of polyphosphate (polyP). PolyP is a polyanionic biopolymer and generally s ...K. We validated the effectiveness of PPK-M on enhanced intracellular polyP synthesis by comparison with PPK.
  5 KB (695 words) - 12:18, 27 September 2022
• Part:BBa K3504002
  ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...the identified interactions of nsP3 with host factors influence viral RNA synthesis or whether they are indicative of another nsP3 function that regulates the
  7 KB (1,096 words) - 08:37, 21 October 2021
• Part:BBa K3711081
  ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy ...". It exists widely in nature. ACC is a rate-limiting enzyme for ab initio synthesis of fatty acids, which catalyzes acetyl-CoA to malonyl-CoA, which eventually
  8 KB (1,337 words) - 13:38, 21 October 2021
• Part:BBa K3711082
  ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy ...". It exists widely in nature. ACC is a rate-limiting enzyme for ab initio synthesis of fatty acids, which catalyzes acetyl-CoA to malonyl-CoA, which eventually
  8 KB (1,333 words) - 13:38, 21 October 2021
• Part:BBa K3711084
  ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy ...". It exists widely in nature. ACC is a rate-limiting enzyme for ab initio synthesis of fatty acids, which catalyzes acetyl-CoA to malonyl-CoA, which eventually
  8 KB (1,329 words) - 13:41, 21 October 2021
• Part:BBa K3885311
  ...characteristics of an experiment, such as sensitivity, leakage, etc. DeGFP synthesis rate differs for the same element in different chassis. <br> ...2">(BBa_K2205002)</a> registered by iGEM17_Newcastle in the Parts, but the synthesis rate of deGFP in the Cell-Free system was lower than that in a cell-based s
  9 KB (1,462 words) - 18:13, 21 October 2021
• Part:BBa K4292018
  ...using the enzyme-catalyzed synthesis route, the yield of enzyme-catalyzed synthesis of 2'-FL is not high due to the expensive substrate guanosine 5’-diphosph ...gmd, wcaG and Wbgl, are encoding the important enzymes involving the 2'-FL synthesis. Amongst these enzymes, gmd and wcaG are converted the abundant intracellul
  16 KB (2,326 words) - 10:22, 27 September 2022
• Part:BBa K4344051
  ...cloning of a PCR amplified backbone and an insert obtained by solid phase synthesis. Primers for pUC19 backbone amplification were analysed on a temperature gr ...se synthesis derived cassette. Both cassettes derived from the solid-phase synthesis did not yield any visible dsRNA, while our cassette produced a dsRNA at a s
  8 KB (1,375 words) - 15:02, 12 October 2022
• Part:BBa K4155001
  ...hesis method to synthesize zinc responsive promoter (pzntR) and riboflavin synthesis gene (ribB). ...lavin synthesis gene (ribB) by direct DNA synthesis method. The riboflavin synthesis gene for riboflavin expression promotes electron transfer from the cell to
  5 KB (683 words) - 08:31, 12 October 2022
• Part:BBa K4604023
  ...a greater yield of AdoCbl, the naturally occurring gene <i>bluB</i> of the synthesis pathway of <i>sinorhizobium meliloti</i> 2011 [3]. ...ogen source despite ethanolamine. Since nitrogen is crucial for amino acid synthesis and ultimately cell survival, <i>E. coli</i> is unable to grow in such a me
  35 KB (5,319 words) - 14:18, 12 October 2023
• Part:BBa I51001:Design
  ...growth and replication of ''E. coli'', the processes of DNA design and DNA synthesis cannot be easily decoupled.
  2 KB (304 words) - 17:17, 22 March 2008
• Part:BBa R0010:Experience
  ...artinfo>pSB1A3</partinfo>). The results are shown here as the relative RFP synthesis rate per cell. |[[Image:PV_hc_r001110LB.png|500px|thumb|Relative RFP synthesis rate per cell in <partinfo>pSB1A2</partinfo>-<partinfo>BBa_J107010</partinf
  22 KB (3,531 words) - 15:09, 11 October 2022
• Part:BBa K190022
  ...hesis method to synthesize zinc responsive promoter (pzntR) and riboflavin synthesis gene (ribB). ...lavin synthesis gene (ribB) by direct DNA synthesis method. The riboflavin synthesis gene for riboflavin expression promotes electron transfer from the cell to
  5 KB (715 words) - 08:29, 12 October 2022
• Part:BBa R0011:Experience/iGEM10 UNIPV-Pavia
  ...artinfo>pSB1A3</partinfo>). The results are shown here as the relative RFP synthesis rate per cell. |[[Image:PV_hc_r001110LB.png|500px|thumb|Relative RFP synthesis rate per cell in <partinfo>pSB1A2</partinfo>-<partinfo>BBa_J107010</partinf
  9 KB (1,400 words) - 11:20, 30 October 2010
• Part:BBa K934001
  [[Image:metabolism.png|thumb|right|200px|Fig.1 synthesis mechanism of P(3HB)]] The pathway and regulation of Poly[(R)-3-hydroxybutyrate] ,P(3HB) synthesis in <I>Ralstonia eutropha</I> H16 is shown in Fig1. Pyruvic acid is metaboli
  8 KB (1,279 words) - 05:49, 13 December 2019
• Part:BBa K801081
  ==== Origin: Saccharomyces cerevisiae, Saccharomycopsis fibuligera, synthesis ==== ==== Origin: Saccharomycopsis fibuligera, synthesis ====
  15 KB (2,134 words) - 03:55, 22 October 2021
• Part:BBa K1172303
  The riboflavin synthesis gene cluster (''rib''-gene-cluster) consists of four different genes that f ...ielefeld 2013 Rib cluster2.png|500px|thumb|left|'''Figure 4:''' Riboflavin synthesis gene cluster, cloned from ''Shewanella oneidensis'' MR-1, 3697 bp; with non
  27 KB (3,978 words) - 04:33, 17 December 2021
• Part:BBa K2086001
  ===Synthesis of SerA Gene=== ===Plasmid Synthesis===
  5 KB (714 words) - 00:55, 17 October 2016
• Part:BBa K2753003
  ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co
  10 KB (1,547 words) - 17:46, 25 October 2020
• Part:BBa K2753016
  ...eraniol synthesis in E. coli, so at the beginning, we expressed a geraniol synthesis operon (https://parts.igem.org/Parts:BBa_K2753016) containing an <em>Abies .... Thus we decided to co-express an MVA pathway in addition to the geraniol synthesis operon. The pathway can either be added by cotransformation of a plasmid co
  8 KB (1,262 words) - 07:30, 17 October 2018
• Part:BBa K3264022
  ...gy that not only circumvents the use of toxic reagents for indigo chemical synthesis but also removes the need for a reducing agent for dye solubilization. .... The hidden pathway for production is encoded by the VioABCDE operon. Bio-synthesis starts from L-tryptophan, converted into protodeoxyviolaceinic acid by VioA
  25 KB (3,706 words) - 18:25, 21 October 2021
• Part:BBa K857000
  ...ge, 1981). When sugars are used as the carbon source, cytosolic acetyl-CoA synthesis in S. cerevisiae occurs via the concerted action of pyruvate decarboxylase ...ynthesis corresponds to 1 mol of glucose that needs to be respired for the synthesis of 1 mol of product.
  87 KB (12,171 words) - 05:10, 21 October 2021
• Part:BBa K3585006
  In E. coli, the presence of glucose inhibits the synthesis of many catabolic enzymes, a phenomenon called "glucose effect" or "glucose ...strain contained pMTL83151-J23100-butyrate plasmids and expressed butyrate synthesis gene cluster; placY represents that the host strain contained p15A-J23200-l
  6 KB (839 words) - 14:01, 27 October 2020
• Part:BBa K3504016
  ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...olutely conserved N-terminal tyrosine interacts with nsP1 for minus-strand synthesis. Stollar and colleagues have determined several determinants of promoter bi
  5 KB (714 words) - 21:23, 26 October 2020
• Part:BBa K3633005
  ...l had lots of drawbacks that it can cause pollution and the substrates for synthesis were harmful to people's health.<br> ...ncluding FMO and sty gene group were discovered useful for bacteria indigo synthesis (Choi et al., 2003, Han, Bang, Lim and Kim, 2010). To achieve our goal of p
  4 KB (564 words) - 10:13, 27 October 2020
• Part:BBa K1131000
  ..., including drug detoxification, xenobiotic metabolism and bio-catalytic synthesis by catalyzation of the oxygenation of many nitrogen-, sulfur-, pho <h5>3.2.3 Involvement in Bio-indigo Synthesis</h5>
  27 KB (4,094 words) - 13:20, 21 October 2021
• Part:BBa K3728002
  ...ref><ref name="x">Rustad M, Eastlund A, Marshall R, Jardine P, Noireaux V. Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression Syste ...><ref name="x">Rustad M, Eastlund A, Jardine P, Noireaux V. Cell-free TXTL synthesis of infectious bacteriophage T4 in a single test tube reaction. Synth Biol (
  28 KB (4,272 words) - 08:05, 19 October 2021
• Part:BBa K3932011:Design
  <li><b>The synthesis of SUMO-PGLa-AMI starts if our ECN senses the presence of ammonia</b></li> First of all, synthesis of an active AMP inside a bacteria will negatively affect the host (our E.
  25 KB (3,713 words) - 21:36, 21 October 2021
• Part:BBa K3904106
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Herpetosiphon aurantiacus</i> TAL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the non-o
  3 KB (401 words) - 08:07, 19 October 2021
• Part:BBa K3904107
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Glycine max</i> 4CL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze phenylpro
  3 KB (393 words) - 08:17, 19 October 2021
• Part:BBa K3904108
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Arabidopsis thaliana</i> CHS gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the conve
  3 KB (393 words) - 08:22, 19 October 2021
• Part:BBa K3904109
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. <i>Medicago sativa</i> CHI gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyzes the intr
  3 KB (410 words) - 08:27, 19 October 2021
• Part:BBa K3904101
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...ter and <i>Herpetosiphon aurantiacus</i> TAL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the non-o
  4 KB (531 words) - 17:33, 21 October 2021
• Part:BBa K3904102
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...ing slpA promoter and <i>Glycine max</i> 4CL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently synthesize 3,4',5-
  4 KB (519 words) - 17:31, 21 October 2021
• Part:BBa K3904103
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...ter and <i>Herpetosiphon aurantiacus</i> TAL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the non-o
  3 KB (407 words) - 07:28, 19 October 2021
• Part:BBa K3904104
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...promoter and <i>Arabidopsis thaliana</i> CHS gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the conve
  3 KB (398 words) - 07:37, 19 October 2021
• Part:BBa K3904105
  ...n synthesis, Since we attempted to optimize proteins needed for naringenin synthesis for two organisms <i>E. coli</i> and <i>L. casei</i>. ...slpA promoter and <i>Medicago sativa</i> 4CL gene optimized for naringenin synthesis in <i>E. coli</i> and <i>L. casei</i> should efficiently catalyze the intra
  3 KB (411 words) - 07:58, 19 October 2021
• Part:BBa K3711046
  ...slated into 4-Coumarate:Coenzyme A Ligase，which is the key enzyme in the synthesis of lycopene. It participates in the transformation from ferulic acid to p-C ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy
  4 KB (656 words) - 12:59, 21 October 2021
• Part:BBa K4000005
  ==== Origin: Saccharomyces cerevisiae, Saccharomycopsis fibuligera, synthesis ==== ==== Origin: Saccharomycopsis fibuligera, synthesis ====
  11 KB (1,502 words) - 03:54, 22 October 2021
• Part:BBa K4408008
  ...2(Cpa fdx terminator). In our program, we use this device to construct the synthesis pathways of butanol in Clostridium tyrobutyricum. By introducing adhE2&#652 ...lizing a de novo synthesis pathway of butanol while maintaining the native synthesis pathway of butyrate (Figure 3).
  8 KB (1,084 words) - 16:37, 11 October 2023
• Part:BBa K4182012
  This is an improvements on the previous pGPP synthesis circuit (BBa_K3052010) by the replicon optimization from p15Aori (5-10 copi This is an improvements on the previous pGPP synthesis circuit (BBa_K3052010) by the replicon optimization from p15Aori (5-10 copi
  7 KB (1,072 words) - 03:32, 14 October 2022
• Part:BBa K4719028
  ...rene monooxygenase pKARA_RT3 into one operon. <b>This composite allows the synthesis of a self-dyeing plastic-like polymer</b>. This construct is a combination of a polyhydroxybutyrate synthesis operon (<i>phaC, phaA, phaB</i>) producing PHB along with bacterial cellulo
  5 KB (796 words) - 15:25, 12 October 2023
• Part:BBa K4772000
  ...ing the catalytic efficiency of AGPase, the rate-limiting enzyme in starch synthesis. The modified AGPase exhibits higher specific activity and substrate affini ...iting step in starch synthesis in ''Chlamydomonas'', so we promoted starch synthesis by expressing more efficient AGPase in ''Chlamydomonas''.
  11 KB (1,624 words) - 11:43, 12 October 2023
• Part:BBa K4759020:Experience
  ...we tried to increase intracellular heme content by strengthening the heme synthesis pathway of Endogenous synthesis of heme
  3 KB (501 words) - 07:02, 10 October 2023
• Part:BBa K4759025:Experience
  ...we tried to increase intracellular heme content by strengthening the heme synthesis pathway of Endogenous synthesis of heme
  3 KB (501 words) - 07:04, 10 October 2023
• Part:BBa K4818025
  ...ucial element within messenger RNA (mRNA) that plays a key role in protein synthesis, particularly in prokaryotic organisms like bacteria. It is also sometimes Here's how the RBS works and its significance in protein synthesis:
  2 KB (380 words) - 22:00, 5 October 2023
• Part:BBa K4885012
  ...engineer C. tyrobutyricum to overexpressed several enzymes to enhance the synthesis pathway of butyrate and butanol. BBa_K4885002 were constructed to enhance t ...tter product ratio. In this way, we directly and indirectly reinforced the synthesis of butyrate and butanol in C. tyrobutyricum.
  7 KB (979 words) - 13:30, 12 October 2023
• Part:BBa K5004001
  ...color in organisms is melanin. We hope to darken hair by promoting melanin synthesis. The Tyr gene encodes a tyrosinase enzyme, which can convert tyrosine into .... This observation can serve as a reference for subsequent, cost-effective synthesis decisions
  4 KB (611 words) - 08:18, 12 October 2023
• Part:BBa K4595013
  is responsible for introducing NAMN synthesis pathway with Na as a precursor into ...e downstream pathway expression. We got a sequence of it through corporate synthesis.
  5 KB (795 words) - 14:52, 12 October 2023
• Part:BBa K4941105
  ylER and LhYida expression plasmids for the de novo synthesis of erythritol. The plasmids carry the Amp resistance gene, URA screening ma ...e the expression of erythrose 4-phosphate (E4P) and facilitate the de novo synthesis of erythritol, thereby increasing its yield.
  7 KB (1,063 words) - 08:35, 12 October 2023
• Part:BBa I51000
  ...nthesis difficulties largely stemmed from the dependence of commercial DNA synthesis processes on cloning, assembly and propagation of synthesized DNA in ''E. c
  1 KB (152 words) - 23:26, 24 January 2008
• Part:BBa K091109
  ...me="Second">Shen, G., Rajan, R., Zhu, J., Bell, C. E. & Pei, D. Design and Synthesis of Substrate and Intermediate Analogue Inhibitors of S -Ribosylhomocysteina AI-2 synthesis:
  9 KB (1,335 words) - 14:15, 17 December 2020
• Part:BBa K118014
  ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu <h2>'''Pigment synthesis'''</h2>
  10 KB (1,539 words) - 12:14, 21 October 2021
• Part:BBa K300000:Experience
  ...ch well, the S_cell signal (proportional to the reporter protein synthesis rate per cell) was computed as (1/OD600*dXFP/dt), where OD600 is the normal ...xpressing clones. Note: as a reference, typical values of the relative RFP synthesis rate measured for PconRFP in a low copy vector (~5 plasmids per cell) are a
  25 KB (3,992 words) - 17:39, 25 January 2013
• Part:BBa K322921
  ...Bacillus subtilis levansucrase, which catalyses hydrolysis of sucrose and synthesis of levans (high molecular weight fructose polymers). It is lethal to gram-n ...creted enzyme levansucrase. The enzyme catalyzes hydrolysis of sucrose and synthesis of levans, which are high-molecular-weight fructose polymers. In the gram-n
  11 KB (1,577 words) - 15:48, 12 October 2022
• Part:BBa K929103:Design
  Gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus). ...nition site according to life technologies manual (AcTEV TM Protease),gene synthesis by GeneArt, optimized for expression in CHO cells (Cricetulus griseus)
  1 KB (137 words) - 10:36, 24 September 2012
• Part:BBa K1217003
  ...the phosphate level in the medium by its incorporation into polyphosphate synthesis inside the bacteria. We test the constructs' efficiency from 2 parameters: poly-P synthesis efficiency and phosphate removal efficiency from the medium.
  3 KB (465 words) - 06:35, 5 October 2013
• Part:BBa K1060000
  ...verproduction of tyrosine: <i>tyrA-aroG-tktA-ppsA</i>/pet-28a for vanillin synthesis <b>BBa_K4256011</b>. ...ed aroG-fbr (BBa_K4146502) to enhance the synthesis pathway in the de novo synthesis of 2-phenylethyl alcohol.'''<br>
  10 KB (1,537 words) - 08:55, 12 October 2022
• Part:BBa K1139100
  ...e which catalyzes the synthesis of cytokinin. The mechanisms of cytokinin synthesis are shown in Fig. 1 (Takei et al., 2001). We ordered a DNA sequence of <i> ...00_main_Fig1.jpg|thumb|center|500px|<b>Fig. 1.</b> Mechanisms of cytokinin synthesis]]
  1 KB (211 words) - 06:40, 27 September 2013
• Part:BBa K1139101
  ...e which catalyzes the synthesis of cytokinin. The mechanisms of cytokinin synthesis are shown in Fig. 1 (Takei et al., 2001). We ordered a DNA sequence of <i> ...01_main_Fig1.jpg|thumb|center|500px|<b>Fig. 1.</b> Mechanisms of cytokinin synthesis]]
  1 KB (211 words) - 06:42, 27 September 2013
• Part:BBa K2259000
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  18 KB (3,014 words) - 12:18, 20 September 2018
• Part:BBa K2259001
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  18 KB (3,014 words) - 03:31, 2 November 2017
• Part:BBa K2259002
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  18 KB (3,014 words) - 03:32, 2 November 2017
• Part:BBa K2259003
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  18 KB (3,014 words) - 03:32, 2 November 2017
• Part:BBa K2259004
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  18 KB (3,014 words) - 03:32, 2 November 2017
• Part:BBa K2259005
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  12 KB (2,033 words) - 03:41, 2 November 2017
• Part:BBa K2259006
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:42, 2 November 2017
• Part:BBa K2259007
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:43, 2 November 2017
• Part:BBa K2259008
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:43, 2 November 2017
• Part:BBa K2259009
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:43, 2 November 2017
• Part:BBa K2259022
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:43, 2 November 2017
• Part:BBa K2259024
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:45, 2 November 2017
• Part:BBa K2259025
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:44, 2 November 2017
• Part:BBa K2259026
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  12 KB (1,954 words) - 03:44, 2 November 2017
• Part:BBa K2259029
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:44, 2 November 2017
• Part:BBa K2259031
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  13 KB (2,082 words) - 03:44, 2 November 2017
• Part:BBa K2259056
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,041 words) - 12:58, 1 November 2017
• Part:BBa K2259057
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,041 words) - 12:58, 1 November 2017
• Part:BBa K2259058
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,041 words) - 12:59, 1 November 2017
• Part:BBa K2259059
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,040 words) - 12:59, 1 November 2017
• Part:BBa K2259080
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,097 words) - 20:33, 1 November 2017
• Part:BBa K2259060
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,041 words) - 13:03, 1 November 2017
• Part:BBa K2259061
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,041 words) - 13:03, 1 November 2017
• Part:BBa K2259062
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,041 words) - 13:04, 1 November 2017
• Part:BBa K2259063
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,040 words) - 13:03, 1 November 2017
• Part:BBa K2259064
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,041 words) - 13:03, 1 November 2017
• Part:BBa K2259066
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,040 words) - 13:03, 1 November 2017
• Part:BBa K2259078
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,097 words) - 20:35, 1 November 2017
• Part:BBa K2259079
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  6 KB (1,097 words) - 20:35, 1 November 2017
• Part:BBa K2276001
  .... coli by inserting TPH and TDC genes, so that it can become the exogenous synthesis pathway of 5-HT, so as to increase the amount of 5-HT. .... coli by inserting TPH and TDC genes, so that it can become the exogenous synthesis pathway of 5-HT, so as to increase the amount of 5-HT.
  19 KB (2,740 words) - 15:20, 20 October 2021
• Part:BBa K2398000
  ===Cytochrome c for the synthesis of organosilicons=== .../Team:Heidelberg/Predcel">PREDCEL</a>}}) approach to improve organosilicon synthesis by cytochrome engineering.
  4 KB (638 words) - 01:37, 2 November 2017
• Part:BBa K2417007
  ...treatment with YncM Winsulin, these cells showed higher rates of glycogen synthesis than basal levels, and showed glucose oxidation activity above basal level ...xidation. Cells treated with YncM-Winsulin showed higher rates of glycogen synthesis than those at basal levels, and an increase in glucose oxidation was observ
  6 KB (952 words) - 05:28, 1 November 2017
• Part:BBa K2259086
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  12 KB (1,951 words) - 03:44, 2 November 2017
• Part:BBa K2571005
  ...GEM teams to further build upon the application of the gshF in glutathione synthesis in industry and hence, increase the resistance of engineered cells to react
  20 KB (2,942 words) - 12:17, 27 October 2020
• Part:BBa K2593001
  ...ing gluconuronic acid and acetaminoglucose transfer reaction. In vivo, the synthesis of hyaluronic acid is achieved by the alternating aggregation of monosaccha ...ase to produce the main precursor, glucose-6-phosphate (G6P).From here, HA synthesis pathway can then be divided into two distinct pathways that syntheses the t
  4 KB (660 words) - 01:10, 18 October 2018
• Part:BBa K2753019
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  17 KB (2,616 words) - 01:21, 22 October 2019
• Part:BBa K2973007
  ...th our <i>in vitro</i> translation kit (PURExpress <i>In vitro</i> Protein Synthesis Kit), as it cannot be expressed with any of the usual <i>in vitro</i> trans ...i> experiments were performed with the PURExpress <i>Ιn Vitro</i> Protein Synthesis Kit provided by New England Biolabs (NEB). We followed the standard protoco
  13 KB (1,973 words) - 14:19, 21 October 2019
• Part:BBa K3052010
  In our study, we aim to achieve limonene and linalool synthesis in <i>E.coli</i> DH5<i>α</i>. According to 2018 GreatBay_China team’s ex ...HINA--project3.png |700px|thumb|center|<b>Figure 1:</b> (A)MVA pathway. (B)Synthesis of limonene and linalool]]</div>
  4 KB (548 words) - 03:19, 22 October 2019
• Part:BBa K3209000
  ..., L109G, L110E, H281V, Q282F and A460M. BFD-M7 can catalyze glycolaldehyde synthesis from formaldehye, then the glycolaldehyde reacts with formaldehyde to form ...(DHA) from formaldehyde, catalyzed by BFD-M7. This enzyme can catalyze the synthesis of two compounds Glycolaldehyde and Dihydroxyacetone, using formadehyde.
  2 KB (352 words) - 00:21, 21 October 2019
• Part:BBa K3141001
  ...s more, we alternated a short region on HPI gene to increase its protein synthesis and secretion. ..., suppression of hepatic glucose production(HGP), and the induction of the synthesis of fatty acids for energy storage and further utilization. We can assume pr
  3 KB (517 words) - 22:36, 20 October 2019
• Part:BBa K3728008
  ...49p.</ref><ref>Rustad M, Eastlund A, Jardine P, Noireaux V. Cell-free TXTL synthesis of infectious bacteriophage T4 in a single test tube reaction. Synth Biol ( ...hyeon Shin<ref name="a">Shin J, Jardine P, Noireaux V. Genome replication, synthesis, and assembly of the bacteriophage T7 in a single cell-free reaction. ACS S
  23 KB (3,556 words) - 07:29, 19 October 2021
• Part:BBa K3504003
  ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...olutely conserved N-terminal tyrosine interacts with nsP1 for minus-strand synthesis. Stollar and colleagues have determined several determinants of promoter bi
  5 KB (751 words) - 17:45, 19 October 2021
• Part:BBa K3504014
  ...ex responsible for the synthesis positive-sense viral RNAs, results in the synthesis of both the genomic and subgenomic RNAs, of which the subgenomic RNA is pro ...roles, nsP2 is intimately involved in the shutoff of host macro-molecular synthesis.nsP2 functions as a helicase to unwind RNA secondary structures formed duri
  6 KB (879 words) - 20:32, 26 October 2020
• Part:BBa K3580102
  ...enter|Fig. 1 Parts and metabolic pathways in the experiment of monoterpene synthesis and a schematic diagram of the experiment ]] In this cell-free monoterpene synthesis, we mixed two E. coli extracts each of which has either first 7 or last 2 e
  5 KB (842 words) - 01:02, 28 October 2020
• Part:BBa K3580101
  ...enter|Fig. 1 Parts and metabolic pathways in the experiment of monoterpene synthesis and a schematic diagram of the experiment ]] In this cell-free monoterpene synthesis, we mixed two E. coli extracts each of which has either first 7 or last 2 e
  5 KB (810 words) - 01:01, 28 October 2020
• Part:BBa S04123
  ...ible for helping galactose pass through the cell membrane and the butyrate synthesis cluster is responsible for accelerating the degradation of galactose (Fig2) ...strain contained pMTL83151-J23100-butyrate plasmids and expressed butyrate synthesis gene cluster; placY represents that the host strain contained p15A-J23200-l
  5 KB (800 words) - 07:54, 27 October 2020
• Part:BBa K3731000
  ...bly, and mainly synthesize GTP. The ppk1 codes PPK1, which can promote the synthesis(major function) and decomposition(minor function) of polyP with the residue ...er, if the concentration of ATP is lower than 5 μM, there is virtually no synthesis of polyP for 20 min.
  2 KB (282 words) - 08:55, 14 September 2021
• Part:BBa K3875011
  In <i>E. coli</i>, chorismate is a branching point for the synthesis of aromatic amino acids, and we intend to insert four related genes that fa ...l pterin cycle (MH4 cycle) can be formed to ensure the final step of 5-HTP synthesis.<br>
  3 KB (551 words) - 16:32, 19 October 2021
• Part:BBa K3852005
  ...ence the selectivity and specificity of taste responses.We acquire it from synthesis company. ====1. Modification and synthesis of T1R1 gene====
  5 KB (694 words) - 11:24, 17 October 2021
• Part:BBa K3724015
  The riboflavin synthesis gene cluster consists of the genes <i>ribd</i> ([https://parts.igem.org/wik The riboflavin gene synthesis cluster comprises genes that are integral in the riboflavin biosynthesis pa
  18 KB (2,837 words) - 04:34, 17 December 2021
• Part:BBa K3711005
  ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu <h1>'''Pigment synthesis'''</h1>
  9 KB (1,463 words) - 13:31, 21 October 2021
• Part:BBa K3711009
  ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy
  9 KB (1,439 words) - 13:07, 21 October 2021
• Part:BBa K3711042
  ...to Geranylgeranyl pyrophosphate synthase，which is the key enzyme for the synthesis of curcumin. It participates in the transformation from Farnessee pyrophosp ...her level of LTV radiation and phototoxic environment, indicating that the synthesis of carotenoid may be very important for the survival of E.herbicola in natu
  3 KB (463 words) - 12:54, 21 October 2021
• Part:BBa K3711061
  ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy
  2 KB (336 words) - 09:45, 21 October 2021
• Part:BBa K3711074
  ...rates to produce acyl CoA thiolipids for subsequent reactions. Through the synthesis of these phenylpropane derivatives CoA lipids (e.g. p-gumaroyl CoA, feruloy
  3 KB (489 words) - 10:32, 21 October 2021
• Part:BBa K3999004
  .... coli by inserting TPH and TDC genes, so that it can become the exogenous synthesis pathway of 5-HT, so as to increase the amount of 5-HT. ...(such as in Parkinson's disease), and the rate-limiting step of serotonin synthesis in people treated with 5-HTP (such as in mild depression or dysthymia). AAD
  14 KB (2,079 words) - 03:52, 22 October 2021
• Part:BBa K4171024
  <p style="text-align:center;">Fig. 1. Melanin synthesis pathway</p> <p style="text-align:center;">Fig. 2. Selenomelanin synthesis pathway</p>
  7 KB (933 words) - 15:28, 12 October 2022
• Part:BBa K4146502
  ...improving enzyme activity to enhance the synthesis pathway in the de novo synthesis of 2-phenylethyl alcohol. ...yzes the synthesis of DAHP, which directs carbon flow to the phenylalanine synthesis pathway. The phenylalanine-bound hydrophobic pocket consists of 12 amino ac
  4 KB (587 words) - 10:14, 12 October 2022
• Part:BBa K4305005
  ...1]. The technique for synthesizing DNA has developed, with the cost of DNA synthesis dropping annually. With this, the use of DNA as an information storage medi [1] Hughes, Randall A. and Ellington, Andrew D. Synthetic DNA Synthesis and Assembly: Putting the Synthetic in Synthetic Biology. Cold Spring Harb
  5 KB (792 words) - 21:54, 9 October 2022
• Part:BBa K4432120
  ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed
  19 KB (2,724 words) - 08:27, 13 October 2022
• Part:BBa K4432121
  ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed
  19 KB (2,724 words) - 08:26, 13 October 2022
• Part:BBa K4432320
  ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed
  19 KB (2,753 words) - 09:12, 13 October 2022
• Part:BBa K4432321
  ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed
  19 KB (2,753 words) - 09:12, 13 October 2022
• Part:BBa K4432220
  ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed
  19 KB (2,724 words) - 08:27, 13 October 2022
• Part:BBa K4432221
  ...]) which was shown to efficiently catalyze both steps of the canthaxanthin synthesis from ß-carotene [4]. One prerequisite for canthaxanthin production is the ß-carotene synthesis. This can be ‘easily’ achieved in ''E. coli'' by using part constructed
  19 KB (2,724 words) - 08:27, 13 October 2022
• Part:BBa K4399012
  == Induction of anthocyanin synthesis == ...solution was added in liquid M medium. The results showed that anthocyanin synthesis was successfully induced in the IA hairy roots on the 1st and 5th day, impl
  6 KB (864 words) - 04:54, 8 October 2022
• Part:BBa K4399013
  == Induction of anthocyanin synthesis == ...ution was added in liquid M medium. The results showed that no anthocyanin synthesis was induced in the NC hairy roots on the 1st and 5th day, implying that the
  6 KB (882 words) - 04:55, 8 October 2022
• Part:BBa K4452004
  ...igments. Chloroplasts are an example of plastids that are involved in food synthesis and they contain the green pigment chlorophyll.</p> ...ed as a chloroplast import sequence, but due to SS4’s function in starch synthesis, the sequence could target amyloplasts as well. Upon advice from Dr. Hsou-m
  4 KB (680 words) - 05:16, 10 October 2022
• Part:BBa K4452005
  ...igments. Chloroplasts are an example of plastids that are involved in food synthesis and they contain the green pigment chlorophyll.</p> ...an enzyme involved in the starch biosynthesis pathway, specifically in the synthesis of amylose, one of the two distinct polymers within statolith starch granul
  5 KB (715 words) - 05:18, 10 October 2022
• Part:BBa K4182005
  ...ing dihydroxylation-dehydase (DHAD) in the plant branched-chain amino acid synthesis pathway (BCAA). Its biosynthetic path is shown in the following figure: Figure 1: Precursor synthesis
  4 KB (608 words) - 04:15, 14 October 2022
• Part:BBa K4182005:Design
  ...ing dihydroxylation-dehydase (DHAD) in the plant branched-chain amino acid synthesis pathway (BCAA). Its biosynthetic path is shown in the following figure: Figure 1: Precursor synthesis
  3 KB (510 words) - 04:41, 11 October 2022
• Part:BBa K4182010
  The AA synthesis circuit (Plasmid 3) was constructed based on the medium-copy number backbon ...esults of Yan Y et al). AA targets dihydroxylation dehydrase (DHAD) in the synthesis pathway branched-chain amino acid and leads to the growth inhibition of pla
  4 KB (652 words) - 04:00, 14 October 2022
• Part:BBa K4182010:Design
  ...ing dihydroxylation-dehydase (DHAD) in the plant branched-chain amino acid synthesis pathway (BCAA). Its biosynthetic path is shown in the following figure: Figure 1: Precursor synthesis
  4 KB (666 words) - 07:15, 12 October 2022
• Part:BBa K4182008
  ...gi (Yan Y et al, 2018). AA targets dihydroxylation dehydrase (DHAD) in the synthesis pathway branched-chain amino acid and leads to the growth inhibition of pla ...esults of Yan Y et al). AA targets dihydroxylation dehydrase (DHAD) in the synthesis pathway branched-chain amino acid and leads to the growth inhibition of pla
  5 KB (765 words) - 03:58, 14 October 2022
• Part:BBa K4885004
  ...engineer C. tyrobutyricum to overexpressed several enzymes to enhance the synthesis pathway of butyrate and butanol. BBa_K4885002 were constructed to enhance t ...tter product ratio. In this way, we directly and indirectly reinforced the synthesis of butyrate and butanol in C. tyrobutyricum.
  5 KB (670 words) - 13:29, 12 October 2023
• Part:BBa K4885004:Design
  ...By expressing adhE2 gene in C. tyrobutyricum, we can construct the butanol synthesis pathway. We used a strong transcriptional promoter, Pthl, in C. tyrobutyric ...acetate and indirectly enhance the metabolic flux of butyrate and butanol synthesis.
  2 KB (263 words) - 06:14, 10 October 2023
• Part:BBa K4885006:Design
  ...By expressing adhE2 gene in C. tyrobutyricum, we can construct the butanol synthesis pathway. We used a strong transcriptional promoter, Pthl, in C. tyrobutyric ...adhE2, crt and bcd in C. tyrobutyricum to enhance the butyrate and butanol synthesis pathway.
  2 KB (253 words) - 06:49, 30 September 2023
• Part:BBa K4885002:Design
  ...By expressing adhE2 gene in C. tyrobutyricum, we can construct the butanol synthesis pathway. We used a strong transcriptional promoter, Pthl, in C. tyrobutyric ...etylase, we can enhance the acetylation and deacetylation interplay in the synthesis pathway of butyrate and butanol, and thus improve the efficiency of the pat
  2 KB (257 words) - 06:41, 30 September 2023
• Part:BBa K4921011
  ...the reaction is the availability of electron donors or acceptors. Pyruvate synthesis by PFOR requires electron donors (reduced ferredoxin) while pyruvate breakd ...ACS Publications). This is because PFOR can assimilate CO2 in the pyruvate synthesis reaction and convert CO2 into a central metabolite, pyruvate, which can be
  3 KB (419 words) - 08:42, 11 October 2023
• Part:BBa K4595017
  ...e downstream pathway expression. We got a sequence of it through corporate synthesis. ...thetaseto promote the efficient expression of this pathway and improve the synthesis efficiency of
  13 KB (1,978 words) - 15:07, 12 October 2023
• Part:BBa K4595024
  ...inator Tpsbc. gshA and gshB are responsible for the high expression of Gsh synthesis, thus the synthesis of Damage suppressor protein in cells, improving the DNA strength of engine
  6 KB (806 words) - 13:20, 12 October 2023
• Part:BBa K4941106
  ...e the expression of erythrose 4-phosphate (E4P) and facilitate the de novo synthesis of erythritol, thereby increasing its yield. &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;To enable the de novo synthesis of erythritol in Y. lipolytica, we selected the Yida and ER genes from Y. l
  7 KB (1,064 words) - 09:27, 12 October 2023
• IGEM:MIT/2006/Transcriptional control devices
  ...ential phase transcriptional control device produced an initially high GFP synthesis rate which dropped off as cell density increased. Data shown are averages
  1 KB (178 words) - 00:28, 8 March 2008
• RSBP Draft Documentation Standards
  10. Synthesis details (if part was created by DNA synthesis). 12. Synthesis details (if part was made by DNA synthesis).
  6 KB (898 words) - 17:23, 18 March 2008
• Part:BBa K118002
  ...arotenoids. The early steps of carotenoid biosynthesis pathway include the synthesis of Geranylgeranyl pyrophosphate (GGPP), the condensation of two molecules o ...precursors, only in photosynthetic organisms and some microorganisms. The synthesis of carotenoids is encoded by plasmids or chromosome genes. The genes that e
  10 KB (1,580 words) - 12:19, 21 October 2021
• Protein domains
  ...ommend you use <span style="color:red">DNA synthesis</span> . We recommend synthesis for the following reasons: #'''Life is too short'''. DNA Synthesis is available to iGEM Teams. Check out the iGEM partner programs.
  5 KB (655 words) - 12:58, 1 August 2018
• Part:BBa M10046:Design
  Odvs003 Gene Synthesis of CBK basic part CCATAGAATTCATGAGATCTGGTTCTGGTCCGACCCAGTCTCACTACGGTCAGTGCG Odvs004 Gene Synthesis of CBK basic part CGCAAACGGTCGGACCAGAGTAACCGATACCACCGCACTGACCGTAGTGAGACTG
  1 KB (126 words) - 23:14, 10 May 2009
• Part:BBa K343000
  ...sub>2</sub>). It constitutes the first class in the three classed flagella synthesis cascade. Class II consist of genes encoding proteins that make up the basal
  4 KB (558 words) - 22:48, 27 October 2010
• Part:BBa K404112
  ...n of cytosine to uracil. Subsequently, cytosine can be used for pyrimidine synthesis [Kilstrup et al., 1989, Anderson et al., 1989]. The expression of codA is r ...ymidylate synthetase and subsequently loss of dTTPs. Hence, during the DNA synthesis, both FdUTP as well as uridine throphosphate become incorporated into the D
  4 KB (593 words) - 00:39, 28 October 2010
• Part:BBa K343100
  ...sub>2</sub>). It constitutes the first class in the three classed flagella synthesis cascade. Class II consist of genes encoding proteins that make up the basal
  4 KB (552 words) - 23:09, 27 October 2010
• Part:BBa K343004
  ...sub>2</sub>). It constitutes the first class in the three classed flagella synthesis cascade. Class II consist of genes encoding proteins that make up the basal
  10 KB (1,489 words) - 19:07, 5 November 2010
• Part:BBa K404100:Design
  ...y continued with PCR and cloning, because they knew by experience that DNA synthesis could possibly take long. ...because the ordered rebellious ITRs didn’t arrive until now – even DNA synthesis seems to be difficult….<br/>
  12 KB (1,828 words) - 19:56, 23 October 2010
• Part:BBa K404101:Design
  ...y continued with PCR and cloning, because they knew by experience that DNA synthesis could possibly take long. ...because the ordered rebellious ITRs didn’t arrive until now – even DNA synthesis seems to be difficult….<br/>
  12 KB (1,771 words) - 23:53, 22 October 2010
• Part:BBa K530000
  Enzyme in the pathway required for B-Carotene Synthesis. This enzyme is a combination, it is the full Phytoene Synthase enzyme spli ...r cell basis for different combinations of parts involved in beta-carotene synthesis. These are compared with a wild type control. tHMG1 is used to funnel more
  7 KB (961 words) - 19:15, 8 October 2020
• Part:BBa K733018
  3. GFP synthesis rate was then obtained by calculating the slope of linear regression line o ...t inducer concentrations were calculated by dividing the corresponding GFP synthesis rate over the average OD595 value;
  16 KB (2,311 words) - 22:15, 26 September 2015
• Part:BBa K801074
  ...feine synthesis can go on. To support this irreversible, stepwise caffeine synthesis, we used the strongest promoter for this enzyme, to establish high concentr ...On the Specificity of Caffeine Effects, MGG, 1972), but previous caffeine synthesis experiments (see below) have only led to a concentration of about 5 µg/g (
  7 KB (1,114 words) - 10:11, 24 October 2012
• Part:BBa K842003
  ...and 4 areas and structurally are really diverse. 28 is involved in the synthesis of flagell in E.coli(Paget, 2015). For that work of sigma factor the great ...iciency of synthesis differed for two promoters as well: the efficiency of synthesis for flgMp was higher than that one for modAp1.
  7 KB (1,051 words) - 14:15, 27 October 2017
• Part:BBa K814014
  ...icular pathway was chosen so that one less enzyme would be required in the synthesis (compared to three in C. arabica). ====Origin: Saccharomyces cerevisiae, E. coli, synthesis, genome====
  14 KB (1,998 words) - 06:28, 20 October 2021
• Part:BBa K861074:Experience
  ...that the overexpression of adrA can help increase the ability of cellulose synthesis.</p> ...ll these results indicated that AdrA can increase the ability of cellulose synthesis.Actually, BcsB can be activated by c-di-GMP. But till the deadline, we have
  2 KB (337 words) - 16:52, 26 October 2012
• Part:BBa K1045003:Experience
  ...activity of [[Part:BBa_K1045003|BBa_K1045003]]'''. (A) SDS PAGE confirmed synthesis of DAC using [[Part:BBa_K1045003|BBa_K1045003]] in three independent biolog ...molecules as an indirect marker. Each PP that is released during c-di-AMP synthesis was cleaved by the PP phosphatase to yield 2 P molecules. Consequently, 4 P
  42 KB (5,560 words) - 22:49, 28 October 2013
• Part:BBa K1185000
  ...sible for the synthesis of enzymes involved in production of peptidoglycan synthesis. Disruption of this pathway can be utilised to down-regulate production of ...s can be seen shortening and widening over time as peptidoglycan cell wall synthesis is down-regulated and insufficient amounts of cell wall are able to maintai
  15 KB (2,148 words) - 12:08, 26 October 2013
• Part:BBa K1217008
  We test the constructs' efficiency from 2 parameters: poly-P synthesis efficiency and phosphate removal efficiency from the medium. ==='''Efficiency of poly-P synthesis and phosphate removal from environment'''===
  3 KB (394 words) - 06:38, 5 October 2013
• Part:BBa K1104300
  ...mic membrane, activation of autolysin, inhibition of DNA, RNA, and protein synthesis, and inhibition of certain enzymes. One emerging technique for the study of
  2 KB (354 words) - 16:20, 15 October 2018
• Part:BBa K1104301
  ...mic membrane, activation of autolysin, inhibition of DNA, RNA, and protein synthesis, and inhibition of certain enzymes. One emerging technique for the study of
  3 KB (371 words) - 16:23, 15 October 2018
• Part:BBa K1373000
  ...evel is increased thereby up-regulating genes whose products catalyze NADH synthesis. Therefore the augmented pool size of NAD⁺(H) result in promotio <strong>Fig. 1 De novo synthesis and salvage pathway of NAD biosynthesis.</strong>
  4 KB (532 words) - 14:45, 12 October 2023
• Part:BBa K500000:Experience
  .../Science/Proto">here</a>, was codon-optimized for <em>E. coli</em> K12 and synthesis was requested along with the BioBrick prefix and suffix. While we were able ...h data for the toxicity issues that they encountered. In summary, in-vitro synthesis presented no particular problems, but when the sequence was cloned into the
  7 KB (1,083 words) - 21:43, 17 October 2018
• Part:BBa K1363002
  ...It can inhibit one of the Hfs protein family-HfsJ. So it can block up the synthesis of polysaccharide. HfiA, It is regulated downstream of lovK-lovR and the re ...evelopment via direct interaction with an enzyme required for holdfast bio-synthesis.</p>
  2 KB (243 words) - 02:21, 2 November 2014
• Part:BBa K1363005
  ...It can inhibit one of the Hfs protein family-HfsJ. So it can block up the synthesis of polysaccharide. HfiA, It is regulated downstream of lovK-lovR and the re ...evelopment via direct interaction with an enzyme required for holdfast bio-synthesis.</p>
  2 KB (300 words) - 05:38, 1 November 2014
• Part:BBa K1712000
  ...r the organism's enoyl acyl-carrier-protein reductase in type 2 fatty acid synthesis. The enzyme this encodes for uses NADH and crotonyl COA as substrates. Triclosan inhibits type 2 fatty acid synthesis (FASII), an essential pathway in the Bacterial and Eukaryotic domains by in
  7 KB (952 words) - 23:16, 18 September 2015
• Part:BBa K1758102
  ...ns et al. 1989]), is especially helpful in ''in vitro'' cell free protein synthesis. The 5'-UTR sequence contains a spacer of 10 adenine bases which has been s ...we developed cell-free biosensors with the help of <i>in vitro</i> protein synthesis. This part became our positive control due to superior performance compared
  4 KB (691 words) - 19:16, 19 September 2015
• Part:BBa K1758377
  ...eviously. We conducted a <a data-toggle="tooltip" title="Cell free protein synthesis">CFPS</a> with extract from strain constitutivly expressing BlcR. As report ...andard cell extract. For GHB the effect was even greater, stopping protein synthesis completely at 3% (v/v) final concentration as depicted in the graphs. </p>
  14 KB (2,174 words) - 19:55, 19 September 2015
• Part:BBa K1598008:Experience
  ...cholesterol into Pregnenolone. With her help we designed the pregnenolone synthesis biobrick, but there were some problems. Firstly, for pregnenolone to be syn ...10 working days we have left in the competition. In point of fact the DNA synthesis will take longer than 10 working days.'
  15 KB (2,405 words) - 19:36, 18 October 2016
• Part:BBa K2086000
  ===Synthesis of the napDABC operon=== <p>Synthesis of the napDABC operon BioBrick was complicated due to the presence of an il
  4 KB (639 words) - 21:33, 19 October 2016
• Part:BBa K2023001
  ...s a bit different because it is optimized for E.Coli DH5-Alpha and for IDT synthesis. <br> ...llowed by 6 histidines and optimized it for a use in <i>E.coli</i> and IDT synthesis. In our plasmid, this gene is positioned after an inducible promoter, the P
  25 KB (3,824 words) - 21:17, 20 October 2016
• Part:BBa K2023013:Experience
  ...r-RBS-XylR-RBS-mRFP-Terminator. This BioBrick was designed to monitor XylR synthesis by our cells. <br/> ...of the red protein mRFP meaning that the Pr promoter trigger XylR and mRFP synthesis.
  2 KB (309 words) - 01:42, 20 October 2016
• Part:BBa K1988019
  ...P favors polyphosphate hydrolysis, and PPK2’s affinity for hydrolysis or synthesis varies by homolog. [2] We have selected four PPK homologs from <i>M. phosph ...een previously characterized, the affinity for polyphosphate hydrolysis or synthesis could be predicted by phylogenetic analysis for PPK1, PPK2 homolog A, and P
  10 KB (1,586 words) - 21:40, 29 October 2016
• Part:BBa K2213001
  <u><font size="+0.5">Optimising conditions for EutM synthesis using 'Design of Experiments'</font></u> <li>concentration of Tetracyclin inducer (induces EutMN synthesis)</li>
  13 KB (2,025 words) - 10:35, 21 October 2019
• Part:BBa K2259021
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  3 KB (426 words) - 19:53, 1 November 2017
• Part:BBa K2259023
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  3 KB (444 words) - 12:52, 1 November 2017
• Part:BBa K2259027
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  3 KB (502 words) - 17:05, 1 November 2017
• Part:BBa K2259028
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  3 KB (445 words) - 12:55, 1 November 2017
• Part:BBa K2259065
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  3 KB (538 words) - 17:31, 1 November 2017
• Part:BBa K2259067
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  7 KB (1,075 words) - 23:42, 1 November 2017
• Part:BBa K2259068
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  7 KB (1,075 words) - 23:42, 1 November 2017
• Part:BBa K2259069
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  7 KB (1,149 words) - 23:42, 1 November 2017
• Part:BBa K2259071
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A). ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  7 KB (1,075 words) - 23:41, 1 November 2017
• Part:BBa K2278011
  ...taneously oxidized into diacetyl (figure 1). This enzyme is crucial in the synthesis pathway of diacetyl in <i>Lactococcus lactic</i>. ...trong RBS (BBa_B0034) and a terminator (BBa_B1006). IDT performed the DNA synthesis and delivered the part as gBlock. 
  6 KB (916 words) - 09:31, 31 October 2017
• Part:BBa K2372003
  ...ular closure. In our project we were using BLS for activating our chemical synthesis by formation of a β-lactam ring in vitro. In order to simplify purificatio <tr> <td>Source</td> <td>IDT (DNA synthesis) </td></tr>
  2 KB (326 words) - 20:26, 1 November 2017
• Part:BBa K2259088
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  9 KB (1,485 words) - 03:47, 2 November 2017
• Part:BBa K2259091
  ...leaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).<ref>Itoh, T. and Tomizawa, J. (1980). Fo ...eplication origin and proceeds in the direction opposite to that of RNA II synthesis and terminates near the RNA II transcription initiation site. <b>RNA I bind
  9 KB (1,414 words) - 03:46, 2 November 2017
• Part:BBa K2571005:Experience
  ...GEM teams to further build upon the application of the gshF in glutathione synthesis in industry and hence, increase the resistance of engineered cells to react
  7 KB (1,100 words) - 12:19, 27 October 2020
• Part:BBa K2753020
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,676 words) - 15:53, 16 October 2018
• Part:BBa K2753030
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,679 words) - 03:01, 19 October 2019
• Part:BBa K2753018
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,703 words) - 06:20, 17 October 2018
• Part:BBa K2753021
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,676 words) - 15:53, 16 October 2018
• Part:BBa K2753022
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,676 words) - 15:53, 16 October 2018
• Part:BBa K2753024
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,676 words) - 16:01, 16 October 2018
• Part:BBa K2753025
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,719 words) - 16:06, 16 October 2018
• Part:BBa K2753026
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,676 words) - 16:01, 16 October 2018
• Part:BBa K2753027
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,676 words) - 16:01, 16 October 2018
• Part:BBa K2753029
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  11 KB (1,676 words) - 16:02, 16 October 2018
• Part:BBa K2753023
  ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https: ...ison to pTac, a frequently-used IPTG inducible promoter, using an geraniol synthesis operon (https://parts.igem.org/Part:BBa_K2753015) containing a GPPS (https:
  13 KB (1,956 words) - 03:41, 17 October 2018
• Part:BBa K2796029
  ...n the G2 phase decreased. This indicated that mir-135b-3p affected the DNA synthesis of gastric cancer cell MKN45, i.e. S phase.
  8 KB (1,210 words) - 12:49, 16 October 2018
• Part:BBa K2796029:Experience
  ...n the G2 phase decreased. This indicated that mir-135b-3p affected the DNA synthesis of gastric cancer cell MKN45, i.e. S phase.
  5 KB (766 words) - 09:55, 16 October 2018
• Part:BBa K2804010
  ...iously codon-optimised for expression in Escherichia coli of the Cellulose Synthesis elements CmcAx and CcpAx. This part should be used together with the Parts ...els of BcsB and BcsC which are proteins members of the bacterial cellulose synthesis complex indicating CcpAx also plays a regulatory role in BC biosynthesis.
  2 KB (268 words) - 03:09, 15 October 2018