Difference between revisions of "DNA/Assembly"

Revision as of 23:24, 1 March 2009

BioBrick cloning sites • Other cloning sites • BioBrick restriction enzyme sites • BioBrick scars • Bioscaffold sites •

BioBrick-compatible restriction enzyme sites • BioBrick-compatible scars • Other restriction enzyme sites • Other scars • Single nucleotides

BioBrick cloning sites

To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site. The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site.

In most BioBrick plasmid backbones, including those constructed from the BioBrick base vector, the BioBrick prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information.

There are no parts for this table

Other cloning sites

Some plasmid backbones available in the Registry adhere to other standards for physical composition or simply have multiple cloning sites typical of most molecular biology vectors. Parts encoding non-BioBrick cloning sites are listed here.

*More...*
Name	Description	Sequence	Length
BBa_G00000	BioBrick cloning site prefix	gaattcgcggccgcttctagag	22
BBa_G00001	BioBrick cloning site suffix	tactagtagcggccgctgcag	21
BBa_I13450	Removes BioBrick End	. . . agagtaataaactgtgataatcaatgcatg	74
BBa_I13452	Adds another BioBrick site	. . . agattagtcacacgcgatccattgcagtgg	52
BBa_I13455	Insertion site plus RNAse E cut site	. . . taggtcttcgaatccgatccattgcagtgg	78
BBa_I13456	Insertion site plus RNAse E	. . . taggtcttcgaatccgatccattgcagtgg	55
BBa_I13457	Improved insertion site with two RNAse E cut sites	. . . tctctcgagagattagtacctttggagatc	111
BBa_I732007	BglII + BamHI	gaagatcttccggatccgg	19
BBa_J56011	MCSII	ttaattaaggaaggaaactagt	22

BioBrick restriction enzyme sites

The BioBrick standard for physical composition includes the EcoRI, NotI, XbaI, SpeI, and PstI restriction sites. Parts encoding each of the BioBrick restriction enzyme sites are listed here.

There are no parts for this table

BioBrick scars

When a BioBrick part digested with EcoRI and SpeI is assembled with a BioBrick parts digested with XbaI and PstI, the partial SpeI and XbaI sites combined to form a mixed site or scar that cannot be cut by either SpeI or XbaI. A part encoding the BioBrick scar sequence is listed here.

There are no parts for this table

Bioscaffold sites

Bioscaffold/Credit

*More...*
Name	Description	Sequence	Length
BBa_J70010	A BioScaffold Part (Uses PpiI), for offset see Part Design page	. . . taattaattaaacctggtgaacgtggtctc	53
BBa_J70012	A BioScaffold Part (Uses PsrI), Protein Head Remover see Part Design page	. . . gcgccggcgcgccagctggtgaacaccagg	52
BBa_J70030	A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page	. . . taattaattaaaccaggtgaacgtggtctc	48
BBa_J70032	A Composite BioScaffold Part (PpiI and PsrI) for Protein Fusions (see Design Page)	. . . gcgccggcgcgccagctggtgaacaccagg	138
BBa_J70034	A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page)	. . . gagtcccgggagctggaactcccacctgca	45
BBa_J70036	A BioScaffold Part (Uses AarI) for Library Insert Preparation (see Part Design page)	. . . tcccgggagctggaactcccacctgcatat	51
BBa_J70040	A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page)	. . . gggtcccgggagcaccaggtcccacctgca	45
BBa_J70050	Left Library Insert Preparation Part (To use with J70052, and J70040)	cacctgcatat	11
BBa_J70052	Right Library Insert Preparation Part (To use with J70050, and J70040)	atagcaggtg	10
BBa_K259002	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ctagctcctcagtggcagcggtgaggaggc	88
BBa_K259004	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . tatgtaagtagtaacaagtagcgtggggca	81
BBa_K259008	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ggtatgtaagtagtacaagtagcgtggggc	79
BBa_K259009	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . atgtaagtagtaacaagtagcgtggggcag	82
BBa_K606026	tetO Array	. . . tctatcactgatagggacccccaactctgt	3628

References

Bioscaffold/References

BioBrick-compatible restriction enzyme sites

Some restriction enzymes produce DNA ends that are compatible with the DNA ends produced by the BioBrick restriction enzymes. These BioBrick compatible restriction enzyme sites are useful for certain applications, such as building BioBrick vectors. We list the parts encoding those restriction enzymes sites here.

There are no parts for this table

BioBrick-compatible scars

When a DNA fragment digested with a BioBrick enzyme is assembled with a second DNA fragment digested with a BioBrick-compatible enzyme, the ligated DNA forms a mixed site or scar. Parts encoding the possible scars from BioBrick-compatible sites are listed here.

There are no parts for this table

Other restriction enzyme sites

Parts encoding miscellaneous restriction enzyme sites, including those used in other physical composition standards, are listed here. Rich Roberts, who won the Nobel Prize in Physiology or Medicine in 1993 for his work on restriction enzymes, maintains a restriction enzyme database at http://rebase.neb.com.

*More...*
Name	Description	Sequence	Length
BBa_B0045	NheI restriction enzyme site (XbaI, SpeI compatible overhang)	gctagc	6
BBa_B0046	NsiI restriction enzyme site (PstI compatible overhang)	atgcat	6
BBa_B0047	MfeI restriction enzyme site (EcoRI compatible overhang)	caattg	6
BBa_B0048	AvrII restriction enzyme site (XbaI, SpeI compatible overhang)	cctagg	6
BBa_B0102	SapI restriction enzyme site (offset cutter)	gctcttct	8
BBa_B0103	SapI restriction enzyme site, reversed (offset cutter)	atgtgaagagctg	13
BBa_I11071	KpnI restriction enzyme site with extra flanking nucleotides	atcggtaccgca	12
BBa_I11072	AclI restriction enzyme site with extra nucleotides	gcaaacgttcga	12
BBa_I11073	PvuI restriction enzyme site with extra flanking nucleotides	acacgatcggta	12
BBa_I11074	XmaI restriction enzyme site with extra flanking nucleotides	attcccgggtca	12
BBa_I11075	BmtI restriction enzyme site with extra flanking nucleotides	cttgctagc	9
BBa_I11076	HindIII restriction enzyme site with extra flanking nucleotides	tacaagcttct	11
BBa_I11077	SalI restriction enzyme site with extra flanking nucleotides	atcgtcgacgca	12
BBa_I11078	SacII restriction enzyme site with extra flanking nucleotides	gcaccgcggcga	12
BBa_I11079	MluI restriction enzyme site with flanking nucleotides	acaacgcgtgta	12
BBa_I11080	ApaI restriction site with extra flanking nucleotides	cgtgggccctca	12
BBa_I11081	BamHI restriction site with extra flanking nucleotides	caaggatcc	9
BBa_I11082	XbaI restriction site with extra flanking nucleotides	ggatctagacc	11
BBa_K150008	BamHI restriction enzyme site	ggatcc	6
BBa_K175002	I-PpoI homing endonuclease site	ctctcttaaggtagc	15
BBa_K175027	I-SceI restriction site	agttacgctagggataacagggtaatatag	30
BBa_K259002	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ctagctcctcagtggcagcggtgaggaggc	88
BBa_K259004	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . tatgtaagtagtaacaagtagcgtggggca	81
BBa_K259008	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ggtatgtaagtagtacaagtagcgtggggc	79
BBa_K259009	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . atgtaagtagtaacaagtagcgtggggcag	82
BBa_K4816001	napA primer forward	cagtcacatatgatgaccatctcgcggc	28
BBa_K792013	BamHI restriction site (standalone)	ggatcc	6
BBa_M31950	HpaI restriction enzyme site	gtt	3
BBa_M31952	AatII restriction enzyme site	gacgtc	6
BBa_M31953	Acc65I restriction enzyme site	ggtacc	6
BBa_M31955	ApaI restriction enzyme site	gggccc	6
BBa_M31956	AfeI restriction enzyme site	agcgct	6
BBa_M31958	AseI restriction enzyme site	attaat	6
BBa_M31961	BbvCI restriction enzyme site	cctcagc	7
BBa_M31962	BccI restriction enzyme site	ccatc	5
BBa_M31964	BciVI restriction enzyme site	gtatcc	6
BBa_M31965	BclI restriction enzyme site	tgatca	6
BBa_M31967	BfaI restriction enzyme site	ctag	4
BBa_M31968	BfuAI restriction enzyme site	acctgc	6
BBa_M31982	NotI restriction enzyme site	gcggccgc	8
BBa_M31983	EcoRI restriction enzyme site	gaattc	6
BBa_M31984	PspOMI restriction enzyme site	gggccc	6
BBa_M31985	BglII restriction enzyme site	agatct	6
BBa_M31986	EagI restriction enzyme site	cggccg	6
BBa_M31987	BclI restriction enzyme site	tgatca	6
BBa_M31988	MluI restriction enzyme site	acgcgt	6
BBa_M31989	BssHII restriction enzyme site	gcgcgc	6
BBa_M31990	AscI restriction enzyme site	ggcgcgcc	8
BBa_M31991	XbaI restriction enzyme site	tctaga	6
BBa_M31992	SpeI restriction enzyme site	actagt	6
BBa_M31995	BsrGI restriction enzyme site	tgtaca	6
BBa_M31996	BsiWI restriction enzyme site	cgtacg	6
BBa_M31997	Acc65I restriction enzyme site	ggtacc	6

Other scars

Other possible mixed sites or scars are listed here.

*More...*
Name	Description	Sequence	Length
BBa_B0104	AvrII/XbaI mixed site	cctaga	6
BBa_B0105	RFC 25 Scar Sequence	accggc	6
BBa_G0000	SpeI/XbaI scar for RBS-CDS junctions	tactag	6
BBa_G0001	XbaI/SpeI mixed site, reverse	ctctagta	8
BBa_G0002	SpeI/XbaI mixed site	tactagag	8
BBa_G0003	NheI/XbaI mixed site	gctagag	7
BBa_G0004	SpeI/NheI mixed site	tactagc	7
BBa_G0005	NheI/SpeI mixed site	gctagta	7
BBa_G0006	XbaI/NheI mixed site	ctctagc	7
BBa_K106015	AarI "A" site scar sequence	atgctcgagggagct	15
BBa_K106016	AarI "B" site scar sequence	ggtagttcccta	12
BBa_K106017	AarI "D" site scar sequence	tgcgggatcctgagtaaataagcggccgc	29
BBa_K112999	BBb1 scar sequence	ggatct	6
BBa_K1319106	RFC 25 Translation Start Scar Sequence	tactagatggccggc	15
BBa_K1319107	RFC 25 Translation Stop Scar Sequence	accggttaatactagag	17
BBa_K245009	RFC 37 Scar Sequence	tccggc	6

Single nucleotides

When specifying composite BioBrick parts, it can be helpful to sometimes specify a single nucleotide within the composite part. Thus, parts encoding each nucleotide alone are listed for convenience.

*More...*
Name	Description	Sequence	Length
BBa_G0009	The nucleotide A	a	1
BBa_G0010	The nucleotide C	c	1
BBa_G0011	The nucleotide G	g	1
BBa_G0012	The nucleotide T	t	1
BBa_K1402010	Lac Promoter	. . . ccactagaaataattttgtttaactttaag	79
BBa_K361001	Message gene template	. . . caagatagactaatagtcggatccctcgag	438
BBa_K4105001	DNAzyme	. . . ttaggcccagtcctggcgccctctgtttga	100
BBa_K4105002	a region of mif23 gene	. . . aatccgggtcaggaccgcgggagacaaact	88
BBa_K649204	lox2272	. . . cttcgtataggatactttatacgaagttat	34
BBa_M34014	Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana	. . . ttttctttttgtttttaaataaatatttag	2646

@@ Line 56: / Line 56: @@
 ==Bioscaffold sites==
-{|
+{{:Bioscaffold/Credit}}
-| [[Image:JulieNorvillePhoto.jpg|50px|center]]
-| Julie Norville, as a graduate student in Tom Knight and Angie Belcher's lab at MIT, developed a new set of DNA parts called Bioscaffold sites.  Bioscaffold sites can be assembled as regular BioBrick parts, but enable you to remove BioBrick scars, create protein fusions, and insert part libraries within composite parts.
-|}
 <parttable>bioscaffold_site_DNA</parttable>
@@ Line 66: / Line 63: @@
 ===References===
-#[http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15 BioBricks Foundation RFC 15] by Julie Norville, Angie Belcher and Tom Knight
+{{:Bioscaffold/References}}
 ==BioBrick-compatible restriction enzyme sites==