Revision as of 14:53, 17 June 2015

Introduction to CRISPR and Cas9

From UBC 2013: CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) are specific regions in some bacterial and archaeal genomes that, together with associated Cas (CRISPR-associated) genes, function as an adaptive immune system in prokaryotes. While the specific ‘adaptive’ nature of this immunity is still under investigation, it is known that exogenous DNA is processed by Cas proteins into short (~30 base pair) sequences that are adjacent to the Protospacer Adjacent Motif (PAM) site. These short pieces of DNA are then incorporated into the host genome between repeat sequences to form spacer elements. The repeat-spacer-repeat array is constitutively expressed (pre-CRISPR RNAs or pre-crRNAs) and processed by Cas proteins to form small RNAs (crRNAs). The small RNAs are then loaded into Cas proteins and act to guide them to initiate the sequence-specific cleavage of the target sequence.

Background from Freiburg 2013: Hidden as an uncharacterized E. coli locus for more than 15 years, the CRISPR (Clusterd Regularly Interspaced Short Palindromic Repeats) array was identified by Barrangou et al. as a previously unknown adaptive prokaryotic immune system. Almost half of all prokaryotes make use of this defense mechanism against unselective uptake through natural transformation, phage DNA transduction or horizontal gene transfer by conjugation. Invasive DNA or even RNA can be specifically recognized and efficiently cleaved. This unique feature results from the interaction of non-coding RNAs and CRISPR associated (Cas) proteins. From a wide range of known CRISPR subtypes, we used CRISPR type II b of S. pyogenes.

The recognition and degradation of invasive DNA by CRISPR/Cas type II occurs in three steps:

Acquisition: Invasive DNA is recognized via a protospacer adjacent motif (PAM) – the sequence NGG. A short sequence downstream of the PAM sequence is then integrated into the host CRISPR array and is termed spacer. Spacer sequences transcribe for CRISPR RNAs(crRNAs) which help to cleave sequence-specific invasive DNA. These sequences are located between short palindromic repeats, which are necessary for the functionality of the crRNAs.
Expression/Transcription: The Cas9 endonuclease is expressed. CRISPR array is then transcribed and processed by RNAse III into crRNAs. These contain the complementary spacer sequence and the direct repeat sequence. The crRNA guides the Cas9 protein specifically to invasive DNA sequences. Furthermore trans-activating crRNAs (tracrRNA) are transcribed and bind to the direct repeat part of the crRNA. The tracrRNA is necessary for the formation of a Cas9-RNA complex.
Interference: Repeatedly invading DNA, which has been integrated into the CRISPR locus, is detected by the RNA-protein complex and cleaved by Cas9.

Each of these teams have worked on CRISPR based systems for at least some part of their projects. Below, you'll find abstracts for each team, and direct links to their CRISPR pages and references. Here is the list of 2013 iGEM teams who worked on CRISPR in their projects:

Team	Track	Chassis
British_Columbia	Food & Energy	E. coli
Chiba	New Application	E. coli
Duke	New Application	Yeast / S. cerevisiae
Freiburg	Foundational Advance	E. coli / Mammalian
MIT	Health & Medicine	Mammalian
NJU_NJUT_China	New Application	E. coli
Paris_Bettencourt	Health & Medicine	E. coli
Penn_State	Manufacturing	Plants
SJTU-BioX-Shanghai	New Application	E. coli
Stanford-Brown	New Application	E. coli / B. subtilis
UCSF	Foundational Advance	E. coli
WHU-China	New Application	E. coli

CRISPR and Cas9 parts in the Registry

Many of the teams on this page have submitted parts associated with CRISPR/Cas9:

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_K1218003	CRISPR CasA E. coli (Modern)	Coding	Trevor Kalkus, Gordon Wade, Alissa Greenberg	1509		. . . aaaccgcaaggagggccatcaaatggctga
BBa_K1218011	Cas9	Coding	Sophia Liang	5080	2	. . . catgttataataggcaaaagaagagtagtg
BBa_K1129006	Cas 9 from Streptococcus thermophilus	Coding	UBC iGEM 2013	4167		. . . atagaccttgccaaactaggagagggttaa
BBa_K1026002	Constitutively Expressed gRNA targeting mRFP	Composite	Hongyi WU	266		. . . caccttcgggtgggcctttctgcgtttata
BBa_K1218004	CRISPR CasA (Ancestral)	Coding	Trevor Kalkus, Gordon Wade, Alissa Greenberg	1340		. . . gatcacaaccaccgtcataagcattaatga
BBa_K1081000	J13002-dcas9	Composite	Hangxing Jia	4180		. . . cgcattgatttgagtcagctaggaggtgac
BBa_K1160000	coding sequence of Cas9 from CRISPR system type II	Plasmid	Huang Xingxu	9159		. . . acatttccccgaaaagtgccacctgacgtc
BBa_K1150000	dCas9	Coding	Freiburg 2013	4101	42	. . . cggatcgacctgtctcagctgggaggcgac
BBa_K1150017	dCas9 with CMV promoter	Device	Freiburg 2013	5012		. . . aggcatgctggggatgcggtgggctctatg
BBa_K1026000	Constitutively Expressed dCas9 Operon	Composite	Hongyi WU	4311		. . . caccttcgggtgggcctttctgcgtttata
BBa_K1150050	Truncated CMV dCas9 Device #4	Device	Natalie Louis and Lisa Schmunk	3626		. . . aggcatgctggggatgcggtgggctctatg
BBa_K1179002	Hef1A_Cas9-VP16	Generator	Brandon Nadres	5141		. . . ggtgggacgcgtgagcttcagtgcaggtga
BBa_K1137013	crRNA anti KAN	Coding	Nicolas Koutsoubelis, Anne Loechner	251		. . . aaacttcagcacactgagacttgttgagtt
BBa_K1982000	tCas9-CIBN (Prokaryotic LACE system)	Device	Zexu Li	4731		. . . ccatacgatgttccagattacgcttaataa
BBa_K1982001	Prokaryotic tCAS9	Coding	Zexu Li	4122		. . . aggattgacctgtcccaactgggaggcgac
BBa_K1982002	Prokaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor)	Coding	Zexu Li	1854		. . . actacaagtttgggaaaaaatggttgcaaa
BBa_K1982003	CIBN(the N-terminal fragment of CIB1)	Coding	Zexu Li	612		. . . ccatacgatgttccagattacgcttaataa
BBa_K1982004	tCas9-CIBN (Prokaryotic LACE system)	Device	Zexu Li	4731		. . . ccatacgatgttccagattacgcttaataa
BBa_K1982005	CRY2-VP64(Prokaryotic LACE system)	Device	Zexu Li	2100		. . . gactacaaggacgacgacgacaaataataa
BBa_K1982006	tCas9-Vp64(Prokaryotic)	Device	Zexu Li	4368		. . . gactacaaggacgacgacgacaaataataa
BBa_K1994013	sgRNA with dCas9 binding site sequence 9 and PP7 handle insert	RNA	Liam Carroll	189		. . . gcacgtcatctgacgtgccttttttattta
BBa_K1994017	sgRNA with 5' golden gate adapter and PP7 protein binding site	RNA	Liam Carroll	178		. . . ggcacgtcatctgacgtgccttttttattt
BBa_K2017000	C-split Cas9 + DnaE C-intein	Protein_Domain	Monica Victoria Gutierrez Salazar	2358		. . . aaggtgcccaagaagaagaggaaggtgtga
BBa_K2017001	N-split Cas9 + DnaE N-intein	Protein_Domain	Monica Victoria Gutierrez Salazar	2241		. . . gatttgatgagggtggacaacctccctaac
BBa_K2017007	35s:5'+ Ga20ox consense + SAGTI-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	3057		. . . gttactagatcggcaattccgctagagacc
BBa_K2017008	35s + Ga20ox consense + RSIAT-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2836		. . . gttactagatcggcaattccgctagagacc
BBa_K2017009	35s + Ga20ox consense + AEK-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2872		. . . gttactagatcggcaattccgctagagacc
BBa_K2017011	35s:5' + TFL consense + SAGTI-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	3057		. . . gttactagatcggcaattccgctagagacc
BBa_K2017010	35s + Ga20ox consense + RSIAT-TEV-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2869		. . . gttactagatcggcaattccgctagagacc
BBa_K2017012	35s + TFL consense + RSIAT-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2836		. . . gttactagatcggcaattccgctagagacc
BBa_K2017013	35s + TFL consense + AEK-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2872		. . . gttactagatcggcaattccgctagagacc
BBa_K2017014	35s + TFL consense + RSIAT-TEV-Luciferase + Tnos	Device	Monica Victoria Gutierrez Salazar	2869		. . . gttactagatcggcaattccgctagagacc
BBa_K1982007	Eukaryotic tCAS9	Coding	Zexu Li	4121		. . . aaggattgacctgtcccaactgggaggcga
BBa_K1982008	tCas9-CIBN (Eukaryotic LACE system)	Coding	Zexu Li	4731		. . . ccatacgatgttccagattacgcttaataa
BBa_K1982010	CRY2-VP64(Eukaryotic LACE system)	Coding	Zexu Li	2100		. . . gactacaaggacgacgacgacaaataataa
BBa_K1982011	tCas9-Vp64(Eukaryoticc)	Coding	Zexu Li	4368		. . . gactacaaggacgacgacgacaaataataa
BBa_K1946002	sgRNA targeting LacI	RNA	Musa Efe Işılak	205		. . . tctgatgagtccgtgaggacgaaaaaaaaa
BBa_K1994021	sgRNA containing two golden gate adapters	RNA	Isobel Holden	157		. . . ggcacgtcatctgacgtgccttttttattt
BBa_K1994025	BsaI-GFP-dCas9	Composite	Egheosa Ogbomo	5075		. . . attgatttgagtcagctaggaggtgactga
BBa_K2483005	sgRNA target site couples facing each other with 6 bp spacer	DNA	Sophia Borowski	850		. . . cgtctgtaatcgccctttgtacgtgaacgg
BBa_K2483006	sgRNA target site couples facing each other with 18 bp spacer	DNA	Bryan Nowack	955		. . . ttgaccgcggtcttcctccacattcctgtc
BBa_K2361000	spdCas9	Coding	Mart Bartelds	4120		. . . cagctaggaggtgactaagtcgacctcgag
BBa_K2361001	dCas9 VRER	Coding	Mart Bartelds	4108		. . . attgatttgagtcagctaggaggtgactga
BBa_K2361004	CRISPR array	RNA	Sebald Verkuijl	639		. . . tttatctgttgtttgtcggtgaacgctctc
BBa_K2371004	sgRNA generator for EML4-ALK variant A 23	Composite	Qi Xiao	164		. . . gcctctaaacgggtcttgaggggttttttg
BBa_K2371005	sgRNA generator for EML4-ALK variant A 33	Composite	Qi Xiao	164		. . . gcctctaaacgggtcttgaggggttttttg
BBa_K2371006	sgRNA generator for EML4-ALK variant A 83	Composite	Qi Xiao	164		. . . gcctctaaacgggtcttgaggggttttttg
BBa_K2558201	dCas9 generator with Anderson weak promotor	Generator	Tianze Huang	4308		. . . caccttcgggtgggcctttctgcgtttata
BBa_K2558003	dCas9	Coding	Tianze Huang	4107	6	. . . attgatttgagtcagctaggaggtgactaa
BBa_K2627003	crRNA targeting GltA	RNA	Zhaoqin Zhang	162		. . . tttttttaagcttggctgttttggcggatg
BBa_K2627004	crRNA targeting GltA	Composite	Zhaoqin Zhang	477		. . . ggatttgaacgttgcgaaggatagcaccac
BBa_K2660006	N-Cas9	Coding	Victor Nunes de Jesus, Danielle Biscaro Pedrolli	3459		. . . ctagtggttgctaaggtggaaaaagggaaa
BBa_K2660007	C-Cas9	Coding	Danielle Biscaro Pedrolli,Victor Nunes de Jesus	648		. . . attgatttgagtcagcttggcggtgactga
BBa_K3799000	EiCsm6,A CRISPR system endoribonuclease	Coding	Shubhamay Das	1293	-1	. . . ttcaaccaatccatcaaggagctgctttaa
BBa_K3791000	Spacer gRNA Ampicillin	DNA	Auba Fuster Pal�, Laura S�nchez Ruiz	20	-1	tccgcctccatccagtctat
BBa_K3977000	Cas12j-D394A (or dCasΦ), for more see 2021 SCU-China wiki page result and model	Coding	Yilong Xu	2271	-1	. . . accccggctcaggaaccgtcccagactagc
BBa_K3791001	Spacer gRNA Chloramphenicol	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	20	-1	tgatggcttccatgtcggca
BBa_K3791002	Spacer gRNA Erythromycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	20	-1	cgcagcagagaagcctggat
BBa_K3791003	Spacer gRNA Kanamycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	20	-1	caccatgatattcggcaagc
BBa_K3791004	Spacer gRNA Spectinomycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	20	-1	gctcatcgccagcccagtcg
BBa_K3791005	gRNA Ampicillin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	41	-1	. . . aagtgtagattccgcctccatccagtctat
BBa_K3791006	gRNA Chloramphenicol	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	41	-1	. . . aagtgtagattgatggcttccatgtcggca
BBa_K3791007	gRNA Erythromycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	41	-1	. . . aagtgtagatcgcagcagagaagcctggat
BBa_K3791008	gRNA Kanamycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	41	-1	. . . aagtgtagatcaccatgatattcggcaagc
BBa_K3791009	gRNA Spectinomycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	41	-1	. . . aagtgtagatgctcatcgccagcccagtcg
BBa_K3791010	gRNA Ampicillin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	59	-1	. . . aagtgtagattccgcctccatccagtctat
BBa_K3791011	gRNA Chloramphenicol construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	59	-1	. . . aagtgtagattgatggcttccatgtcggca
BBa_K3791012	gRNA Erythromycin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	59	-1	. . . aagtgtagatcgcagcagagaagcctggat
BBa_K3791013	gRNA Kanamycin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	59	-1	. . . aagtgtagatcaccatgatattcggcaagc
BBa_K3791014	gRNA Spectinomycin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	59	-1	. . . aagtgtagatgctcatcgccagcccagtcg
BBa_K3791015	Efficient gRNA Ampicillin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	66	-1	. . . tctattaattaatttctactaagtgtagat
BBa_K3791016	Efficient gRNA Chloramphenicol	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	66	-1	. . . cggcagaattaatttctactaagtgtagat
BBa_K3791017	Efficient gRNA Erythromycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	66	-1	. . . tggatgttataatttctactaagtgtagat
BBa_K3791018	Efficient gRNA Kanamycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	66	-1	. . . caagcaggctaatttctactaagtgtagat
BBa_K3791019	Efficient gRNA Spectinomycin	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	66	-1	. . . agtcgggcgtaatttctactaagtgtagat
BBa_K3791020	Efficient gRNA Ampicillin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	145	-1	. . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791021	Efficient gRNA Chloramphenicol construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	145	-1	. . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791022	Efficient gRNA Erythromycin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	145	-1	. . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791023	Efficient gRNA Kanamycin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	145	-1	. . . cgaaaggggggccttttttcgttttggtcc
BBa_K3791024	Efficient gRNA Spectinomycin construct	DNA	Laura S�nchez Ruiz, Auba Fuster Pal�	145	-1	. . . cgaaaggggggccttttttcgttttggtcc
BBa_K4298001	yEvolvr-TM8.3	Composite	Buyao Li	7802	-1	. . . caacttgaaaaagtggcaccgagtcggtgc
BBa_K4298002	enCas9-PolI5M	Coding	Buyao Li	7698	-1	. . . gttttgggacgctcgaaggctttaatttgc
BBa_K5490001	23-nt sequence binds CasRx to cleave WNV genome; modifiable target 2	RNA	IOANNIS VASILEIOS ELAFROPOULOS	33	-1	. . . cgaagaacgccaagagagccaacacaaaac
BBa_K5490008	Scaffold or direct repeat region (DR 36)	Regulatory	IOANNIS VASILEIOS ELAFROPOULOS	36	-1	. . . aacccctaccaactggtcggggtttgaaac
BBa_K5490009	Scaffold or direct repeat region (DR 30)	Regulatory	IOANNIS VASILEIOS ELAFROPOULOS	30	-1	aacccctaccaactggtcggggtttgaaac
BBa_K5490018	gRNA FOR CASRX , SPACER 1 (WNV)	RNA	IOANNIS VASILEIOS ELAFROPOULOS	99	-1	. . . aacccctaccaactggtcggggtttgaaac
BBa_K5490019	gRNA FOR CASRX , SPACER 2 (WNV)	RNA	IOANNIS VASILEIOS ELAFROPOULOS	99	-1	. . . aacccctaccaactggtcggggtttgaaac
BBa_K5490020	gRNA FOR CASRX , SPACER 3 (WNV)	RNA	IOANNIS VASILEIOS ELAFROPOULOS	109	-1	. . . aacccctaccaactggtcggggtttgaaac
BBa_K5177024	pTF_sfmA plasmid fragment cassette	DNA	Jia Run Dong	351	-1	. . . tcaaaaccacgttgttttgaatttgaattc
BBa_K5177025	Proposed pTF_fimA plasmid fragment cassette	DNA	Jia Run Dong	351	-1	. . . cctacccaggttcagggacgtcatgaattc
BBa_K1026001	dCas9	Coding	Hongyi WU	4113	2	. . . ttgagtcagctaggaggtgactgagtcgac
BBa_K1137014	tracRNA-CAS9	Coding	Nicolas Koutsoubelis, Anne L�chner	4522		. . . aaaaaccccgcttcggcggggttttttttt
BBa_K1559002	rearranged CRISPR/Cas9 system without promoter	Coding	Xiuqi (Rex) Xia	5080	6	. . . aatttaaactttttattttaggaggcaaaa
BBa_K1559003	CRISPR/Cas9 system with Anderson high-expression constitutive promoter	Generator	Xiuqi (Rex) Xia	5127		. . . aatttaaactttttattttaggaggcaaaa
BBa_K1559004	CRISPR/Cas9 system with Anderson medium-expression constitutive promoter	Generator	Xiuqi (Rex) Xia	5127		. . . aatttaaactttttattttaggaggcaaaa
BBa_K1559005	CRISPR/Cas9 system with Anderson low-expression constitutive promoter	Generator	Xiuqi (Rex) Xia	5127		. . . aatttaaactttttattttaggaggcaaaa
BBa_K1559006	CRISPR/Cas9 system with pBAD inducible promoter	Generator	Xiuqi (Rex) Xia	5222		. . . aatttaaactttttattttaggaggcaaaa
BBa_K1559007	CRISPR/Cas9 system with pLac inducible promoter	Generator	Xiuqi (Rex) Xia	5147		. . . aatttaaactttttattttaggaggcaaaa
BBa_K1559008	CRISPR/Cas9 system with pRha inducible promoter	Generator	Xiuqi (Rex) Xia	5214		. . . aatttaaactttttattttaggaggcaaaa
BBa_K1774001	Cas9 (optimized for expression in E. coli)	Coding	HKU iGEM 2015	4107	1	. . . attgatctgagtcagctgggaggcgactaa
BBa_K1994015	sgRNA with 5' golden gate adapter and COM protein binding site	RNA	Liam Carroll	176		. . . ggcacgtcatctgacgtgccttttttattt
BBa_K1994016	sgRNA with 5' golden gate adapter and MS2 coat protein binding site	RNA	Liam Carroll	172		. . . ggcacgtcatctgacgtgccttttttattt
BBa_K1994019	Multiple dCas9 binding site sequence	Regulatory	Liam Carroll	239	2	. . . atgattatcgttgttgctagccggcgtgga
BBa_K1982009	Eukaryotic Cryptochrome 2 (CRY2) ( a blue light stimulated photoreceptor)	Coding	Zexu Li	1848		. . . actacaagtttgggaaaaaatggttgcaaa
BBa_K1994044	dCas9 Promoter	Regulatory	Egheosa Ogbomo	48	3	. . . tgaaatcatcaaactcattatggatttaat
BBa_K1982012	VP64 transcription activitor	Protein_Domain	Zexu Li	246		. . . gactacaaggacgacgacgacaaataataa
BBa_K2483002	Lac regulated dCas9 with LacI constitutively expressed	Device	Bryan Nowack	5674		. . . attgatttgagtcagctaggaggtgactaa
BBa_K2483004	regulated dCas9 with sgRNAs and IAA enzymes fused to MS2 and PP7	Composite	Bryan Nowack	10136		. . . ggcacgtcatctgacgtgccttttttattt
BBa_K2558006	gRNA targeting PhIF promotor	RNA	Tianze Huang	96	3	. . . caacttgaaaaagtggcaccgagtcggtgc
BBa_K2558007	gRNA targeting lux pR and RiboJ	RNA	Tianze Huang	96	2	. . . caacttgaaaaagtggcaccgagtcggtgc
BBa_K3201000	nCpf1 (RNA-guided DNA nickase)	Coding	Anastasios Galanis	3921		. . . tggctggcctacatccaggagctgcgcaac
BBa_K3454000	MCR-1_crRNA_A_Synthesis	Other	Mingxuan Chi	63	-1	. . . acatctattgaccgcgaccgccaatcttac
BBa_K3454001	MCR-1_crRNA_B_Synthesis	Other	Mingxuan Chi	63	-1	. . . acatctactgacacttatggcacggtctat
BBa_K5490000	23-nt sequence binds CasRx to cleave WNV genome modifiable target 1.	RNA	IOANNIS VASILEIOS ELAFROPOULOS	33	-1	. . . acaacagatgatttcgtgcaccagcttcca
BBa_K5490003	23-nt sequence binds CasRx to cleave WNV genome; modifiable target 3	RNA	IOANNIS VASILEIOS ELAFROPOULOS	43	-1	. . . gtacgtaatacccccaaagccgtacaagag

British Columbia 2013

CRISPR used by UBC

Abstract: The past decade has seen the emergence of robust bioprocessing strains engineered to synthesize discrete molecular products. The next-generation of strains could be “programmable,” with on demand generation of molecules within a bioreactor e.g. a yogurt fermentation capable of making any combination of flavouring, nutrients or pharmaceuticals. While merging all this potential into single hosts seems efficient, it would also bring added risk in the case of a process failure due to bacteriophage infection. Here, we not only rationally design widespread immunity to phage infection, but also hack this immunity system to yield programmable biosynthesis at the community level. We demonstrate this by building both broadly and specifically neutralizing CRISPR systems that were paired with biosynthetic capabilities for vanillin, caffeine and cinnamaldehyde production. Eventually, a fermentative process could exist that is vaccinated to phage infection but susceptible to targeted phage addition that results in a programmable probiotic – or ultrabiotic.

Chiba 2013

CRISPRi used by the Chiba team

Abstract: In nature, there exist a variety of magnetotactic bacteria. Recently, it was reported that non-magnetotactic cells such as yeast can be magnetized to some extent. We set the goal to transform E. coli into those that are attracted by magnets. By magnetizing E. coli, the cell harvesting process will be much simpler and more economical than the conventional processes such as centrifugation and filtration. To this end, we are conducting three itemized projects. (1) modification of iron transportation network to import as much Fe ions as possible in E. coli, (2) sequestering/ storing iron into human ferritin, and (3) converting cytosolic space from reducing to oxidizing in order to elevate Fe(II)/ Fe(III) ratio within. Because all such manipulations significantly impact the physiology of the host cell, we are establishing the BioBrick platform that enables the temporal knockdown of multiple genes using recently control technology such as CRISPRi.

Duke 2013

Abstract: Synthetic gene circuits have the potential to revolutionize gene therapies and bio-industrial methods by allowing predictable, customized control of gene expression. Bistable switches and oscillators, key building blocks of more complex gene networks, have been constructed using naturally occurring and well-characterized regulatory elements. In order to expand the versatility and variety of these circuits, we designed and constructed gene networks using artificial transcription factors (ATFs). The ATFs are of two classes: inhibitory TAL proteins and a catalytically inactive dCas9 protein with small guide RNA elements, each orthogonal to the yeast genome. Using mathematical modeling, we determined the parameters expected to create bistability and oscillation, using tandem binding site kinetics to achieve cooperativity. Based on these results, we assembled a library of plasmids containing ATFs, binding sites, regulatory elements, and fluorescent reporters. We then integrated these genes into the genome of Saccharomyces cerevisiae and are currently characterizing them using flow cytometry.

CRISPR References:

Qi L.S, Larson M.H, Gilbert L.A, Doudna J.A, Weissman J.S, Arkin A.P, Lim W.A: Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 2013, 152:1173-1183.
DiCarlo J, Norville J, Mali P, Rios X, Aach J, Church M: Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Research 2013. 41(7), 4336-4343.

Freiburg 2013

Freiburg CRISPR page

Abstract: Our Team developed a universal toolkit, termed uniCAS, that enables customizable gene regulation in mammalian cells. Therefore, we engineered the recently discovered and highly promising CRISPR/Cas9 system. The regulation is based on the RNA-guided Cas9 protein, which allows targeting of specific DNA sequences. Our toolkit comprises not only a standardized Cas9 protein, but also different effector domains for efficient gene activation or repression. We further engineered a modular RNA plasmid for easy implementation of RNA guide sequences. As an additional feature, we established an innovative screening method for assessing the functionality of our uniCAS fusion proteins. Single genes and even whole genetic networks can be modified using our uniCAS toolkit. We think that our toolbox of standardized parts of the CRISPR/Cas9 system offers broad application in research fields such as tissue engineering, stem cell reprogramming and fundamental research.

Freiburg CRISPR References:

Ishino, Y., et al. (1987). Nucleotide Sequence of the iap Gene in Escherichia coli. Journal of Bacteriology 169, 5429-5433.
Barrangou, R., et al. (2007). CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 1709-1712.
Marraffini, L., and Sontheimer, E. (2008). CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322, 1843-1845.
Jansen, R., et al. (2002). Identification of genes that are associated with DNA repeats in prokaryotes. Molecular Microbiology 43, 1565-1575.
Makarova, K., et al. (2011). Evolution and classification of the CRISPR-Cas systems. Nat Rev Microbiol 9, 467-477.
Jinek, M., et al. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821.
Cong, L., et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.
Mali, P., et al. (2013). RNA-guided human genome engineering via Cas9. Science 339, 823-826.
Yamanaka, S., et al. (2012). Induced Pluripotent Stem Cells: Past, Present and Future. Cell Stem Cell 10, 678-684.
Kaneshiro, K., et al. (2007). An integrated map of p53-binding sites and histone modification in the human ENCONDE regions. Genomics, 177-188.

MIT 2013

MIT CRISPR page

Abstract: Coordinating behavior across cell populations to form synthetic tissues requires spacial communication between individual cells. While there has been some success engineering single signals, sending multiple signaling elements spanning spatial scales for multicellular coordination remains a significant hurdle. Here, we describe a method for mammalian cell-cell communication utilizing engineered exosomes containing miRNA or protein signals. First, we demonstrate selectively packaging signaling miRNAs (miR-451 and miR-503) and synthetic fusion proteins (GFP, Cas9, and Cre recombinase each individually fused to the oligomerizing membrane targeting domain Acyl-TyA) into exosomes within cells engineered with sender genetic circuits. Next, we demonstrate that these miRNA and protein signals can modulate gene expression within cells engineered with receiver genetic circuits. Finally, we present preliminary cell-cell signaling results on populations of cocultured sender and receiver cells. Our method may enable multiplexed communication among populations of various cell types and the creation of sophisticated synthetic tissues.

MIT CRISPR references:

Bacchus, William et al. Synthetic two-way communication between mammalian cells. Nat. Biotechnol. 30, 991–996 (2012)
Lancaster, Madeline et al. Cerebral organoids model human brain development and microcephaly. Nature 501, 373–379 (2013)
Barrangou, Rodolphe et al. CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes. Science 314, 1709-1712 (2007)
Shen, B et al. Protein targeting to exosomes/microvesicles by plasma membrane anchors. J Biol Chem. (2011)

NJU NJUT China 2013

Abstract: Most bacteria and archaea can resist invading DNA and/or RNA elements via the clusters of regularly interspaced short palindromic repeats (CRISPRs). It is believed that the integrated CRISPR sequences have the ability to form a genetic memory which prevents the host from being infected. The memory exist as a DNA library in genome, artificially modified to set its target. The CRISPRs and Cas (CRISPR-associated) interact and form this prokaryotic adaptive immune system. Cas9, as a core of CRISPR system, can play a role of targeted-attacking gene "missiles". Therefore, we build a sort of plasmids, loading CRISPR system, to realize the "killing" of harmful genes and/or organisms.

CRISPR and Cas9 references:

Zhang J, Rouillon C, Kerou M, et al. Structure and mechanism of the CMR complex for CRISPR-mediated antiviral immunity[J]. Molecular cell, 2012, 45(3): 303-313.
Brouns S J J, Jore M M, Lundgren M, et al. Small CRISPR RNAs guide antiviral defense in prokaryotes[J]. Science, 2008, 321(5891): 960-964.
Díez-Villaseñor C, Almendros C, García-Martínez J, et al. Diversity of CRISPR loci in Escherichia coli[J]. Microbiology, 2010, 156(5): 1351-1361.
Marraffini L A, Sontheimer E J. CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA[J]. science, 2008, 322(5909): 1843-1845.
Shen B, Zhang J, Wu H, et al. Generation of gene-modified mice via Cas9/RNA-mediated gene targeting[J]. Cell research, 2013.
Westra E R, Swarts D C, Staals R H J, et al. The CRISPRs, they are a-Changin': how prokaryotes generate adaptive immunity[J]. Annual review of genetics, 2012, 46: 311-339.
Cong L, Ran F A, Cox D, et al. Multiplex genome engineering using CRISPR/Cas systems[J]. Science, 2013, 339(6121): 819-823.
Karginov F V, Hannon G J. The CRISPR system: small RNA-guided defense in bacteria and archaea[J]. Molecular cell, 2010, 37(1): 7-19.
Mali P, Yang L, Esvelt K M, et al. RNA-guided human genome engineering via Cas9[J]. Science, 2013, 339(6121): 823-826.
Barrangou R, Horvath P. CRISPR: new horizons in phage resistance and strain identification[J]. Annual review of food science and technology, 2012, 3: 143-162.
Hale C R, Majumdar S, Elmore J, et al. Essential features and rational design of CRISPR RNAs that function with the Cas RAMP module complex to cleave RNAs[J]. Molecular cell, 2012, 45(3): 292-302.
Semenova E, Jore M M, Datsenko K A, et al. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence[J]. Proceedings of the National Academy of Sciences, 2011, 108(25): 10098-10103.

Paris Bettencourt 2013

Abstract: We are testing new weapons for the global war against Mycobacterium tuberculosis (MTb), a pathogen that infects nearly 2 billion people. Our 4 synergistic projects aim to help in the prevention, diagnosis, and treatment of tuberculosis. 1) We are reproducing an essential MTb metabolic pathway in E. coli, where it can be easily and safely targeted in a drug screen. 2) We are building a phage-based biosensor to allow the rapid diagnosis specifically drug-resistant MTb strains. 3) We are constructing a mycobacteriophage to detect and counterselect drug-resistant Mtb in the environment. 4) We are programming E. coli to follow MTb into human macrophages and saturate it with bacteriolytic enzymes. We want to vanquish tuberculosis and build a TB-free world.

Penn State 2013

Penn State plan Cas9 project information

Abstract: Plants as Plants: Natural Factories provides a green approach to the manufacturing of valuable chemicals and materials. Through synthetic biology, we are able to control the expression of genes that regulate the production of desired secondary metabolites. Via the manipulation of established metabolic pathways, we hope to produce vanillin and butanol. The prospect of being able to synthetically produce a biofuel provides vast possibilities for the scope of synthetic biology and green energy. Additionally through the manipulation of the cellulose synthase genes, we hope to increase the biomass of plants by a hybrid plant cell wall. As shown through these projects, the use of plants provides various green energy possibilities. However, due to the limited use of plants within synthetic biology there are various regulation issues. Thus we have additionally worked on characterizing a range of plant promoters as well as introducing the Cas9 CRISPR system into plants.

SJTU BioX Shanghai 2013

SJTU-BioX-Shanghai CRISPR page

Abstract: Few researches have been done to regulate gene expression levels in genomic scale so far. This year we aim to combine two systems together in order to provide a universal and convenient tool which can be used to regulate different genomic genes simultaneously and independently in a quantitative way. Our project involves the newly developed gene regulating tool CRISPRi and three light-controlled expression systems induced by red, green, and blue light respectively. Simply by changing the regulating parts in CRISPRi system towards mRFP, luciferase, and three enzymes, we hope to prove our system can be used qualitatively, quantitatively and practically step by step. We have also designed a box and written a software as our experiment measurements. Simply by typing in several parameters, different gene expression levels can be controlled. This system can also be improved to predict the maximized producing efficiency after some simple tests in future.

SJTU-BioX-Shanghai CRISPR references:

QI, LEI S., LARSON, MATTHEW H., GILBERT, LUKE A., DOUDNA, JENNIFER A., WEISSMAN, JONATHAN S., ARKIN, ADAM P. & LIM, WENDELL A. 2013. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell, 152, 1173-1183
LEVSKAYA, A., CHEVALIER, A. A., TABOR, J. J., SIMPSON, Z. B., LAVERY, L. A., LEVY, M., DAVIDSON, E. A., SCOURAS, A., ELLINGTON, A. D., MARCOTTE, E. M. & VOIGT, C. A. 2005. Synthetic biology: engineering Escherichia coli to see light. Nature, 438, 441-2.
FU, Y., FODEN, J. A., KHAYTER, C., MAEDER, M. L., REYON, D., JOUNG, J. K. & SANDER, J. D. 2013. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology, 31, 822-826.
CARROLL, D. 2013. Staying on target with CRISPR-Cas. Nature Biotechnology, 31, 807-809.

Stanford Brown 2013

Stanford-Brown CRISPR page

Abstract: Communication is a dynamic requirement for life as we know it. We are using cellular and molecular messaging of different magnitudes to improve the broadcasting and reception of information. Starting on the atomic level, our BioWires project has created silver-incorporating DNA to act as nanowires, which could improve the cost and effectiveness of electronic products. Our CRISPR project is creating a system for DNA messages and resistances to be passed from cell to cell, in effect, creating transmissible probiotics and changing the way that cells communicate. We are also building a chromogenic biosensor to detect sucrose secretion that will be launched on a satellite (EuCROPIS) into low-Earth orbit. Finally, our De-Extinction project involves decoding messages from the past to better understand early life on Earth.

Stanford-Brown CRISPR references:

Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., & Marraffini, L. A. (2013). Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic Acids Research.
Deltcheva, E., Chylinski, K., Sharma, C. M., Gonzales, K., Chao, Y., Pirzada, Z. A., ... & Charpentier, E. (2011). CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature, 471(7340), 602-607.
Jiang, W., Bikard, D., Cox, D., Zhang, F., & Marraffini, L. A. (2013). RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nature biotechnology, 31(3), 233-239.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816-821.
Liu, H., & Naismith, J. H. (2008). An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC biotechnology, 8(1), 91.
Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., ... & Church, G. M. (2013). RNA-guided human genome engineering via Cas9. Science, 339(6121), 823-826.
Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., & Lim, W. A. (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell, 152(5), 1173-1183.
Quan, J., & Tian, J. (2009). Circular polymerase extension cloning of complex gene libraries and pathways. PloS one, 4(7), e6441.
Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., & Jaenisch, R. (2013). One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell.

UCSF 2013

UCSF CRISPR page

Abstract: In microbial communities, bacterial populations are commonly controlled using indiscriminate, broad range antibiotics. There are few ways to target specific strains effectively without disrupting the entire microbiome and local environment. The goal of our project is to take advantage of a natural horizontal gene transfer mechanism in bacteria to precisely affect gene expression in selected strains. We combine bacterial conjugation with CRISPRi, an RNAi-like repression system developed from bacteria, to regulate gene expression in targeted strains within a complex microbial community. One possible application is to selectively repress pathogenic genes in a microbiome, leaving the community makeup unaffected. In addition, we use CRISPRi to lay the groundwork for transferring large circuits that enable complex functionality and decision-making in cells.

WHU China 2013

WHU-China CRISPR page

Abstract: Cas9 is an RNA-guided dsDNA nuclease utilized by bacteria immune system. The genetically engineered Cas9 has recently been shown to have the ability to repress or activate desired gene expression. In practical research and industrial application, we usually face the problem to express a gene at different levels, not only “on” or “off ”, so a more flexible regulation method is needed. To achieve multi-stage regulation of target genes, we further develop several dCas9 devices in which dCas9 alone or fused with omega subunit of RNAP is directed by various guide RNAs to different regions of designed double promoters. Therefore, promoters with disparate strength can be either activated or repressed respectively and multi-stage gene expression can be achieved. Also, based on such novel technology platform, we are developing diverse applications such as a guide RNA-mediated oscillator.

WHU-China CRISPR references:

Qi, L.S., et al., Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell, 2013. 152(5): p. 1173-83.
Jinek, M., et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 2012. 337(6096): p. 816-21.
Bikard, D., et al., Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic Acids Res, 2013. 41(15): p. 7429-7437.
Heidrich, N. and J. Vogel, CRISPRs extending their reach: prokaryotic RNAi protein Cas9 recruited for gene regulation. EMBO J, 2013. 32(13): p. 1802-4.
Li, M., et al., A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli. Microb Cell Fact, 2012. 11: p. 19.

@@ Line 1: / Line 1: @@
+{{Catalog/MainLinks}}
 {{Project/ProjectCSS}}
 <html>

Difference between revisions of "Collections/CRISPR"

Revision as of 14:53, 17 June 2015

Introduction to CRISPR and Cas9

CRISPR and Cas9 parts in the Registry