Difference between revisions of "DNA/Assembly"
(Replacing redirecting link with direct link)
 
(20 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
[[DNA|< Back to DNA parts]]
 
[[DNA|< Back to DNA parts]]
 +
 +
 +
<center>
 +
[[DNA/Assembly#BioBrick cloning sites|'''BioBrick cloning sites''']] &bull; [[DNA/Assembly#Other cloning sites|'''Other cloning sites''']] &bull; [[DNA/Assembly#BioBrick restriction enzyme sites|'''BioBrick restriction enzyme sites''']] &bull; [[DNA/Assembly#BioBrick scars|'''BioBrick scars''']] &bull; [[DNA/Assembly#BioScaffold sites|'''BioScaffold sites''']] &bull;
 +
 +
[[DNA/Assembly#BioBrick-compatible restriction enzyme sites|'''BioBrick-compatible restriction enzyme sites''']] &bull; [[DNA/Assembly#BioBrick-compatible scars|'''BioBrick-compatible scars''']] &bull; [[DNA/Assembly#Other restriction enzyme sites|'''Other restriction enzyme sites''']] &bull; [[DNA/Assembly#Other scars|'''Other scars''']] &bull; [[DNA/Assembly#Single nucleotides|'''Single nucleotides''']]
 +
</center>
  
 
<html>
 
<html>
Line 11: Line 18:
 
==BioBrick cloning sites==
 
==BioBrick cloning sites==
  
−
{|
+
{{:Cloning_sites/Overview}}
−
|[[Image:BioBrickprefix.png|75px|center]]
+
−
|To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site.  The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site.
+
−
|-
+
−
|[[Image:BioBricksuffix.png|75px|center]]
+
−
|Note that in most BioBrick plasmid backbones, the BioBrick prefix and suffix sequences are not adjacent to one another.  Instead, the BioBrick prefix and suffix flank what is a called a '''default plasmid insert''' or '''default insert''' for short.  There are several different default inserts available in the Registry.  See [[Plasmids/Construction#Default plasmid inserts|default plasmid inserts]] for more information.  Also, note that the BioBrick cloning site is a component of the plasmid backbone, not the part itself. 
+
−
|}
+
  
 
<parttable>biobrick_cloning_site_DNA</parttable>
 
<parttable>biobrick_cloning_site_DNA</parttable>
Line 33: Line 34:
 
==BioBrick restriction enzyme sites==
 
==BioBrick restriction enzyme sites==
  
−
The BioBrick standard for physical composition includes the EcoRI, NotI, XbaI, SpeI, and PstI restriction sites.  Parts encoding each of the BioBrick restriction enzyme sites are listed here.
+
{|
 +
| [[Image:BioBricksites.png|75px|center]]
 +
|The BioBrick standard for physical composition includes the EcoRI, NotI, XbaI, SpeI, and PstI restriction sites.  Parts encoding each of the BioBrick restriction enzyme sites are listed here.
 +
|}
  
 
<parttable>biobrick_restriction_site_DNA</parttable>
 
<parttable>biobrick_restriction_site_DNA</parttable>
Line 40: Line 44:
  
 
==BioBrick scars==
 
==BioBrick scars==
−
When a BioBrick part digested with EcoRI and SpeI is assembled with a BioBrick parts digested with XbaI and PstI, the partial SpeI and XbaI sites combined to form a mixed site or scar that cannot be cut by either SpeI or XbaI.  A part encoding the BioBrick scar sequence is listed here.
+
 
 +
{|
 +
| [[Image:BioBrickmixedsite.png|75px|center]]
 +
|When a BioBrick part digested with EcoRI and SpeI is assembled with a BioBrick parts digested with XbaI and PstI, the partial SpeI and XbaI sites combined to form a mixed site or scar that cannot be cut by either SpeI or XbaI.  A part encoding the BioBrick scar sequence is listed here.
 +
|}
  
 
<parttable>biobrick_scar_DNA</parttable>
 
<parttable>biobrick_scar_DNA</parttable>
  
 
<!-- To include a part in this table, include the categories "//DNA/scar" and "//standard/biobrick" under the Hard Information tab of the part. -->
 
<!-- To include a part in this table, include the categories "//DNA/scar" and "//standard/biobrick" under the Hard Information tab of the part. -->
 +
 +
==BioScaffold sites==
 +
 +
{{:Assembly standard 15/Overview}}
 +
 +
{{:Assembly standard 15/Credit}}
 +
 +
To learn more about BioScaffold sites, also see [[Help:Assembly_standard_15]].
 +
 +
<parttable>bioscaffold_site_DNA</parttable>
 +
 +
<!-- To include a part in this table, include the categories "//DNA/bioscaffold" under the Hard Information tab of the part. -->
 +
 +
===References===
 +
{{:Assembly standard 15/References}}
 +
  
 
==BioBrick-compatible restriction enzyme sites==
 
==BioBrick-compatible restriction enzyme sites==
−
Some restriction enzymes produce DNA ends that are compatible with the DNA ends produced by the BioBrick restriction enzymes.  These BioBrick compatible restriction enzyme sites are useful for certain applications, such as [[Plasmids/Construction|building BioBrick vectors]].  We list the parts encoding those restriction enzymes sites here.
+
 
 +
{|
 +
| [[Image:BioBrickcompatiblesite.png|75px|center]]
 +
| Some restriction enzymes produce DNA ends that are compatible with the DNA ends produced by the BioBrick restriction enzymes.  These BioBrick compatible restriction enzyme sites are useful for certain applications, such as [[Plasmids/Construction|building BioBrick vectors]].  We list the parts encoding those restriction enzymes sites here.
 +
|}
  
 
<parttable>biobrick_compatible_restriction_site_DNA</parttable>
 
<parttable>biobrick_compatible_restriction_site_DNA</parttable>
Line 54: Line 82:
  
 
==BioBrick-compatible scars==
 
==BioBrick-compatible scars==
−
When a DNA fragment digested with a BioBrick enzyme is assembled with a second DNA fragment digested with a BioBrick-compatible enzyme, the ligated DNA forms a mixed site or scar.  Parts encoding the possible scars from BioBrick-compatible sites are listed here.
+
 
 +
{|
 +
|[[Image:BioBrickcompatiblemixedsite.png|75px|center]]
 +
|When a DNA fragment digested with a BioBrick enzyme is assembled with a second DNA fragment digested with a BioBrick-compatible enzyme, the ligated DNA forms a mixed site or scar.  Parts encoding the possible scars from BioBrick-compatible sites are listed here.
 +
|}
  
 
<parttable>biobrick_compatible_scar_DNA</parttable>
 
<parttable>biobrick_compatible_scar_DNA</parttable>
Line 61: Line 93:
  
 
==Other restriction enzyme sites==
 
==Other restriction enzyme sites==
−
Parts encoding miscellaneous restriction enzyme sites, including those used in other physical composition standards, are listed here.
+
Parts encoding miscellaneous restriction enzyme sites, including those used in other physical composition standards, are listed here.  Rich Roberts, who won the Nobel Prize in Physiology or Medicine in 1993 for his work on restriction enzymes, maintains a restriction enzyme database at http://rebase.neb.com.
  
 
<parttable>restriction_site_DNA</parttable>
 
<parttable>restriction_site_DNA</parttable>
Line 74: Line 106:
 
<!-- To include a part in this table, include the categories "//DNA/scar" under the Hard Information tab of the part. -->
 
<!-- To include a part in this table, include the categories "//DNA/scar" under the Hard Information tab of the part. -->
  
−
==Primer binding sites==
+
==Single nucleotides==
 +
 
 
{|
 
{|
−
|[[Image:ForwardPrimerBindingSite.png|50px|center]]
+
|[[Image:Singlenucleotides.png|75px|center]]
−
|rowspan="2"|Primer binding sites are DNA sequences specifically designed for oligo annealing.  For example, most BioBrick plasmid backbones include binding sites for the VF2 and VR primers.
+
|When specifying composite BioBrick parts, it can be helpful to sometimes specify a single nucleotide within the composite part.  Thus, parts encoding each nucleotide alone are listed for convenience.
−
|-
+
−
|[[Image:ReversePrimerBindingSite.png|50px|center]]
+
 
|}
 
|}
−
 
−
<parttable>primer_binding_site_DNA</parttable>
 
−
 
−
<!-- To include a part in this table, include the categories "//DNA/primerbindingsite" under the Hard Information tab of the part. -->
 
−
 
−
==Spacer==
 
−
Sometimes it is helpful to physically separate parts on the DNA.  In such cases, spacer BioBrick parts that contain (hopefully) innocuous sequences are used.
 
−
 
−
<parttable>spacer_DNA</parttable>
 
−
 
−
<!-- To include a part in this table, include the categories "//DNA/spacer" under the Hard Information tab of the part. -->
 
−
 
−
==Single nucleotides==
 
−
When specifying composite BioBrick parts, it can be helpful to sometimes specify a single nucleotide within the composite part.  Thus, parts encoding each nucleotide alone are listed for convenience.
 
  
 
<parttable>nucleotide_DNA</parttable>
 
<parttable>nucleotide_DNA</parttable>
  
 
<!-- To include a part in this table, include the categories "//DNA/nucleotide" under the Hard Information tab of the part. -->
 
<!-- To include a part in this table, include the categories "//DNA/nucleotide" under the Hard Information tab of the part. -->
 +
 +
__NOTOC__ __NOEDITSECTION__

Latest revision as of 19:19, 28 June 2017

< Back to DNA parts


BioBrick cloning sites • Other cloning sites • BioBrick restriction enzyme sites • BioBrick scars • BioScaffold sites •

BioBrick-compatible restriction enzyme sites • BioBrick-compatible scars • Other restriction enzyme sites • Other scars • Single nucleotides

BioBrick cloning sites

BioBrickprefix.png
 To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site. The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site.
BioBricksuffix.png
 In most BioBrick plasmid backbones, including those constructed from the BioBrick base vector, the BioBrick prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information.


There are no parts for this table


Other cloning sites

Some plasmid backbones available in the Registry adhere to other standards for physical composition or simply have multiple cloning sites typical of most molecular biology vectors. Parts encoding non-BioBrick cloning sites are listed here.


More...
NameDescriptionSequenceLength
BBa_G00000BioBrick cloning site prefixgaattcgcggccgcttctagag22
BBa_G00001BioBrick cloning site suffixtactagtagcggccgctgcag21
BBa_I13450Removes BioBrick End . . . agagtaataaactgtgataatcaatgcatg74
BBa_I13452Adds another BioBrick site . . . agattagtcacacgcgatccattgcagtgg52
BBa_I13455Insertion site plus RNAse E cut site . . . taggtcttcgaatccgatccattgcagtgg78
BBa_I13456Insertion site plus RNAse E . . . taggtcttcgaatccgatccattgcagtgg55
BBa_I13457Improved insertion site with two RNAse E cut sites . . . tctctcgagagattagtacctttggagatc111
BBa_I732007BglII + BamHIgaagatcttccggatccgg19
BBa_J56011MCSIIttaattaaggaaggaaactagt22


BioBrick restriction enzyme sites

BioBricksites.png
 The BioBrick standard for physical composition includes the EcoRI, NotI, XbaI, SpeI, and PstI restriction sites. Parts encoding each of the BioBrick restriction enzyme sites are listed here.


There are no parts for this table


BioBrick scars

BioBrickmixedsite.png
 When a BioBrick part digested with EcoRI and SpeI is assembled with a BioBrick parts digested with XbaI and PstI, the partial SpeI and XbaI sites combined to form a mixed site or scar that cannot be cut by either SpeI or XbaI. A part encoding the BioBrick scar sequence is listed here.


There are no parts for this table


BioScaffold sites

Bioscaffold sites are BioBrick parts that contain restriction enzyme recognition sites that enable full or partial removal of the Bioscaffold site from a composite BioBrick part. Bioscaffold parts address some of the limitations of BioBrick standard assembly by enabling protein fusions, cloning of part libraries within a composite BioBrick part, and removal of BioBrick scars.

JulieNorvillePhoto.jpg
 Julie Norville, as a graduate student in Tom Knight and Angie Belcher's lab at MIT, developed a new set of DNA parts called Bioscaffold sites. Bioscaffold sites can be assembled as regular BioBrick parts, but enable you to remove BioBrick scars, create protein fusions, and insert part libraries within composite parts.

To learn more about BioScaffold sites, also see Help:Assembly_standard_15.


More...
NameDescriptionSequenceLength
BBa_J70010A BioScaffold Part (Uses PpiI), for offset see Part Design page . . . taattaattaaacctggtgaacgtggtctc53
BBa_J70012A BioScaffold Part (Uses PsrI), Protein Head Remover see Part Design page . . . gcgccggcgcgccagctggtgaacaccagg52
BBa_J70030A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page . . . taattaattaaaccaggtgaacgtggtctc48
BBa_J70032A Composite BioScaffold Part (PpiI and PsrI) for Protein Fusions (see Design Page) . . . gcgccggcgcgccagctggtgaacaccagg138
BBa_J70034A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page) . . . gagtcccgggagctggaactcccacctgca45
BBa_J70036A BioScaffold Part (Uses AarI) for Library Insert Preparation (see Part Design page) . . . tcccgggagctggaactcccacctgcatat51
BBa_J70040A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) . . . gggtcccgggagcaccaggtcccacctgca45
BBa_J70050Left Library Insert Preparation Part (To use with J70052, and J70040)cacctgcatat11
BBa_J70052Right Library Insert Preparation Part (To use with J70050, and J70040)atagcaggtg10
BBa_K259002BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ctagctcctcagtggcagcggtgaggaggc88
BBa_K259004BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . tatgtaagtagtaacaagtagcgtggggca81
BBa_K259008BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ggtatgtaagtagtacaagtagcgtggggc79
BBa_K259009BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . atgtaagtagtaacaagtagcgtggggcag82
BBa_K606026tetO Array . . . tctatcactgatagggacccccaactctgt3628


References

  1. [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15 BioBricks Foundation RFC 15] by Julie Norville, Angie Belcher and Tom Knight


BioBrick-compatible restriction enzyme sites

BioBrickcompatiblesite.png
 Some restriction enzymes produce DNA ends that are compatible with the DNA ends produced by the BioBrick restriction enzymes. These BioBrick compatible restriction enzyme sites are useful for certain applications, such as building BioBrick vectors. We list the parts encoding those restriction enzymes sites here.


There are no parts for this table


BioBrick-compatible scars

BioBrickcompatiblemixedsite.png
 When a DNA fragment digested with a BioBrick enzyme is assembled with a second DNA fragment digested with a BioBrick-compatible enzyme, the ligated DNA forms a mixed site or scar. Parts encoding the possible scars from BioBrick-compatible sites are listed here.


There are no parts for this table


Other restriction enzyme sites

Parts encoding miscellaneous restriction enzyme sites, including those used in other physical composition standards, are listed here. Rich Roberts, who won the Nobel Prize in Physiology or Medicine in 1993 for his work on restriction enzymes, maintains a restriction enzyme database at http://rebase.neb.com.


More...
NameDescriptionSequenceLength
BBa_B0045NheI restriction enzyme site (XbaI, SpeI compatible overhang)gctagc6
BBa_B0046NsiI restriction enzyme site (PstI compatible overhang)atgcat6
BBa_B0047MfeI restriction enzyme site (EcoRI compatible overhang)caattg6
BBa_B0048AvrII restriction enzyme site (XbaI, SpeI compatible overhang)cctagg6
BBa_B0102SapI restriction enzyme site (offset cutter)gctcttct8
BBa_B0103SapI restriction enzyme site, reversed (offset cutter)atgtgaagagctg13
BBa_I11071KpnI restriction enzyme site with extra flanking nucleotidesatcggtaccgca12
BBa_I11072AclI restriction enzyme site with extra nucleotidesgcaaacgttcga12
BBa_I11073PvuI restriction enzyme site with extra flanking nucleotidesacacgatcggta12
BBa_I11074XmaI restriction enzyme site with extra flanking nucleotidesattcccgggtca12
BBa_I11075BmtI restriction enzyme site with extra flanking nucleotidescttgctagc9
BBa_I11076HindIII restriction enzyme site with extra flanking nucleotidestacaagcttct11
BBa_I11077SalI restriction enzyme site with extra flanking nucleotidesatcgtcgacgca12
BBa_I11078SacII restriction enzyme site with extra flanking nucleotidesgcaccgcggcga12
BBa_I11079MluI restriction enzyme site with flanking nucleotidesacaacgcgtgta12
BBa_I11080ApaI restriction site with extra flanking nucleotidescgtgggccctca12
BBa_I11081BamHI restriction site with extra flanking nucleotidescaaggatcc9
BBa_I11082XbaI restriction site with extra flanking nucleotidesggatctagacc11
BBa_K150008BamHI restriction enzyme siteggatcc6
BBa_K175002I-PpoI homing endonuclease sitectctcttaaggtagc15
BBa_K175027I-SceI restriction siteagttacgctagggataacagggtaatatag30
BBa_K259002BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ctagctcctcagtggcagcggtgaggaggc88
BBa_K259004BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . tatgtaagtagtaacaagtagcgtggggca81
BBa_K259008BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ggtatgtaagtagtacaagtagcgtggggc79
BBa_K259009BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . atgtaagtagtaacaagtagcgtggggcag82
BBa_K4816001napA primer forwardcagtcacatatgatgaccatctcgcggc28
BBa_K792013BamHI restriction site (standalone)ggatcc6
BBa_M31950HpaI restriction enzyme sitegtt3
BBa_M31952AatII restriction enzyme sitegacgtc6
BBa_M31953Acc65I restriction enzyme siteggtacc6
BBa_M31955ApaI restriction enzyme sitegggccc6
BBa_M31956AfeI restriction enzyme siteagcgct6
BBa_M31958AseI restriction enzyme siteattaat6
BBa_M31961BbvCI restriction enzyme sitecctcagc7
BBa_M31962BccI restriction enzyme siteccatc5
BBa_M31964BciVI restriction enzyme sitegtatcc6
BBa_M31965BclI restriction enzyme sitetgatca6
BBa_M31967BfaI restriction enzyme sitectag4
BBa_M31968BfuAI restriction enzyme siteacctgc6
BBa_M31982NotI restriction enzyme sitegcggccgc8
BBa_M31983EcoRI restriction enzyme sitegaattc6
BBa_M31984PspOMI restriction enzyme sitegggccc6
BBa_M31985BglII restriction enzyme siteagatct6
BBa_M31986EagI restriction enzyme sitecggccg6
BBa_M31987BclI restriction enzyme sitetgatca6
BBa_M31988MluI restriction enzyme siteacgcgt6
BBa_M31989BssHII restriction enzyme sitegcgcgc6
BBa_M31990AscI restriction enzyme siteggcgcgcc8
BBa_M31991XbaI restriction enzyme sitetctaga6
BBa_M31992SpeI restriction enzyme siteactagt6
BBa_M31995BsrGI restriction enzyme sitetgtaca6
BBa_M31996BsiWI restriction enzyme sitecgtacg6
BBa_M31997Acc65I restriction enzyme siteggtacc6


Other scars

Other possible mixed sites or scars are listed here.


More...
NameDescriptionSequenceLength
BBa_B0104AvrII/XbaI mixed sitecctaga6
BBa_B0105RFC 25 Scar Sequenceaccggc6
BBa_G0000SpeI/XbaI scar for RBS-CDS junctionstactag6
BBa_G0001XbaI/SpeI mixed site, reversectctagta8
BBa_G0002SpeI/XbaI mixed sitetactagag8
BBa_G0003NheI/XbaI mixed sitegctagag7
BBa_G0004SpeI/NheI mixed sitetactagc7
BBa_G0005NheI/SpeI mixed sitegctagta7
BBa_G0006XbaI/NheI mixed sitectctagc7
BBa_K106015AarI "A" site scar sequenceatgctcgagggagct15
BBa_K106016AarI "B" site scar sequenceggtagttcccta12
BBa_K106017AarI "D" site scar sequencetgcgggatcctgagtaaataagcggccgc29
BBa_K112999BBb1 scar sequenceggatct6
BBa_K1319106RFC 25 Translation Start Scar Sequencetactagatggccggc15
BBa_K1319107RFC 25 Translation Stop Scar Sequenceaccggttaatactagag17
BBa_K245009RFC 37 Scar Sequencetccggc6


Single nucleotides

Singlenucleotides.png
 When specifying composite BioBrick parts, it can be helpful to sometimes specify a single nucleotide within the composite part. Thus, parts encoding each nucleotide alone are listed for convenience.


More...
NameDescriptionSequenceLength
BBa_G0009The nucleotide Aa1
BBa_G0010The nucleotide Cc1
BBa_G0011The nucleotide Gg1
BBa_G0012The nucleotide Tt1
BBa_K1402010Lac Promoter . . . ccactagaaataattttgtttaactttaag79
BBa_K361001Message gene template . . . caagatagactaatagtcggatccctcgag438
BBa_K4105001DNAzyme . . . ttaggcccagtcctggcgccctctgtttga100
BBa_K4105002a region of mif23 gene . . . aatccgggtcaggaccgcgggagacaaact88
BBa_K649204lox2272 . . . cttcgtataggatactttatacgaagttat34
BBa_M34014Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana . . . ttttctttttgtttttaaataaatatttag2646