Collections/Metal
iGEM Teams and Labs have completed a variety of biosensors and bioremediation projects that involve metal-binding and metal-sensing. Metals that iGEM teams have worked with include: nickel, mercury, lead, arsenic, copper, amongst others.
The collection below includes DNA parts that are responsible for both metal binding and metal sensing.
Previous iGEM Metal Projects
The following table contains iGEM teams that have worked with a variety of metals, along with links to their project wiki and Registry parts. This is not an exhaustive list.
| Team | Year | Parts | Project | As | Au | Cd | Co | Cr | Cu | Fe | Pb | Hg | Ni | Zn |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Bielefeld-CeBiTec | 2015 | Parts | Cell-free Sticks - It works on paper | na | na | na | na | Yes | Yes | na | Yes | Yes | Yes | na |
| Gaston_Day_School | 2015 | Parts | ~ | na | na | Yes | na | na | na | na | na | na | na | na |
| LZU-China | 2015 | Parts | Micro Holmes: A Novel device for Monitoring Heavy Metal Ions | na | na | na | na | Yes | Yes | na | na | na | na | na |
| Nanjing-China | 2015 | Parts | Metallosniper: innovative total solution for heavy metals | na | Yes | na | na | na | na | na | Yes | na | na | na |
| SCUT | 2015 | Parts | Super Cadmium Ion Killer: Engineering E.coli to adsorb cadmium ion during the sewage treatment process | na | na | Yes | na | na | na | na | na | na | na | na |
| UMBC-Maryland | 2015 | Parts | Copper Bioremediation Using Genetically Engineered E. Coli | na | na | na | na | na | Yes | na | na | na | na | na |
| UMBC-Maryland | 2015 | Parts | Copper Bioremediation Using Genetically Engineered E. Coli | na | na | na | na | na | Yes | na | na | na | na | na |
| Berlin | 2014 | Parts | A remote control for E. coli | na | na | na | na | na | na | Yes | na | na | na | na |
| BIOSINT Mexico | 2014 | Parts | Green Demon | na | na | na | na | na | na | na | na | Yes | na | na |
| Cornell | 2014 | Parts | Lead it go: Heavy metal sequestration from regional contaminated waters using genetically engineered E.coli | na | na | na | na | na | na | na | Yes | Yes | Yes | na |
| HUST-China | 2014 | Parts | Warlord E.CaoMengde - a tale of 3 pollutants treatment | na | na | na | na | na | Yes | na | na | na | na | na |
| INSA-Lyon | 2014 | Parts | CurLy’on | na | na | na | Yes | na | na | na | na | na | Yes | na |
| Minnesota | 2014 | Parts | Mntallica: Engineering Bacteria for Mercury and Heavy Metal Bioremediation | na | na | na | na | na | na | na | na | Yes | na | na |
| Nagahama | 2014 | Parts | One E.coli has one function theory | na | na | Yes | na | na | na | na | na | na | na | na |
| NEFU China | 2014 | Parts | Nanocrystal E.coli Flocculation Union | na | na | Yes | na | na | na | na | na | na | na | Yes |
| Penn | 2014 | Parts | Cadmium recovery by a recombinant Magnetospirillum magneticum AMB-1 | na | na | Yes | na | na | na | na | na | na | na | na |
| UFAM Brazil | 2014 | Parts | Mercury Bacter | na | na | na | na | na | na | na | na | Yes | na | na |
| York | 2014 | Parts | EcoCADMUS (E. coli CAdmium DecontaMination Universal System) | na | na | Yes | na | na | na | na | na | na | na | na |
| Edinburgh | 2013 | Parts | WastED | na | na | na | na | na | na | Yes | na | na | na | na |
| Gaston Day School | 2013 | Parts | Fluorescent Detection of Cadmium in Water Supplies | na | na | Yes | na | na | na | na | na | na | na | na |
| Gaston Day School | 2012 | Parts | Detection of Heavy Metal Contaminants in Water | Yes | na | Yes | na | na | na | na | Yes | na | na | na |
Metal Binding Proteins
This set includes coding regions (CDS, Translational Units, Protein Domains) for proteins that bind various metal ions.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K190019 | fMT | Translational_Unit | Nienke Kuipers | 222 | 3 | . . . aaggacgactgctgcggctgcggcaagtaa |
| BBa_K205004 | MerT - Membranous Mercury transporter | Coding | Katelin Haynes | 351 | . . . tttccctacgtcatgccatttttctattaa | |
| BBa_K346001 | RBS (B0034) + MerR (mercury-responsive transcription factor) | Translational_Unit | Ao Liu & Ying Sheng | 453 | 15 | . . . gcaggcctggcaaggtcagctatgccttag |
| BBa_K519010 | SmtA | Coding | Kotone Miyake | 171 | 5 | . . . ggccacaccggctgtaactgccacggctaa |
| BBa_K1420001 | merA, mercuric reductase from Serratia marcescens | Coding | Stephen C. Heinsch | 1686 | . . . gtcaaacaattgtcctgctgcgcaggatga | |
| BBa_K1509000 | Coding for the trans-acting regulator SmtB | Coding | Tong Li | 369 | . . . ctctccgtcctgcagcactggttttgtcat | |
| BBa_K1393001 | OprF(Ala196)+CBP | Coding | Jiajun Tan | 609 | 3 | . . . gaaccggtttccccgcatcatggcggctgg |
| BBa_K1342003 | SmtA Part | Coding | Naoki Saito,Daiki Haraguchi,Yoshiharu Otaki,Ryuhei Minei | 171 | . . . ggccacaccggctgtaactgccacggctaa | |
| BBa_K1438001 | Bacterioferritin (BFR) M52H heme-deletion | Coding | Johann Bauerfeind | 477 | 5 | . . . ctgcaagcacagattcgcgaagaaggttaa |
| BBa_K1438002 | Hu_Ferritin | Coding | Johann Bauerfeind | 1077 | . . . tttgagcgcctgaccctgaaacatgattaa | |
| BBa_K1420002 | merB, Organomercurial Lyase from Serratia marcescens | Coding | Stephen C. Heinsch | 639 | 2 | . . . ttgcagaccatgtcatctaggacaccgtga |
| BBa_K1420003 | MerP, mercuric transport protein periplasmic component | Coding | Stephen C. Heinsch | 276 | . . . gcgggctatccgtccagcgtcaagaagtga | |
| BBa_K1420005 | merT, mercuric transport protein | Coding | Stephen C. Heinsch | 351 | . . . tttccctacgtcatgccatttttctattaa | |
| BBa_K1505000 | RBS+mntH | Translational_Unit | Renyao Wei | 1324 | . . . tgggattggtcgaagtgcatgcgtggtcgt | |
| BBa_K1505002 | RBS+mntH+mCerulean | Translational_Unit | Jane Shmushkis, Amey Vrudhula | 2034 | . . . actctcggcatggacgagctgtacaagtaa | |
| BBa_K1701000 | GolB | Coding | Wei Wei | 195 | . . . aaggccggtttcccgccgcgcgagaggtaa | |
| BBa_K1694006 | Gold Binding Polypeptide | Coding | CHIH-HSUAN HSU | 132 | 1 | . . . gccaccagtggtaccattcagagctaataa |
| BBa_I721002 | Lead Binding Protein | Coding | Jeffrey Hofmann | 399 | 13 | . . . attctcaacagcttggccgagcccgcctga |
| BBa_K231000 | Metal binding peptide | Coding | Daniel R Tarjan | 51 | . . . ggtcattgttgtggttgtggtaaaggtcat | |
| BBa_K346003 | RBS(B0032)+MBP(mercury metal binding peptide engineered from MerR) | Translational_Unit | Huyang Tengxin | 342 | 1 | . . . gcacgaaaggggaatgtttcctgcccgtaa |
| BBa_K643000 | CDS7 cadmium sulfate binding peptide coding sequence | Coding | Sung won Lim | 71 | . . . cgccacggcgcggaacatgcggatatttaa | |
| BBa_K643002 | J140 metal binding peptide | Coding | Rikki Frenkel, Justin Fabrikant | 53 | . . . gcggaatcttctcgtcgtctgtaaggatcc | |
| BBa_K1122666 | Ferric uptake repressor | Coding | Hugo Villanueva | 450 | 2 | . . . caccgctgtaacggaaaagaaactgaatag |
| BBa_K1122702 | Ferric ion-binding protein (FbpA) | Coding | Harry Thornton | 999 | . . . ctgcttgagcaagccggtatgaaataataa | |
| BBa_K1122703 | Ferric ion-binding protein (FbpA) without a signal peptide | Coding | Harry Thornton | 936 | . . . ctgcttgagcaagccggtatgaaataataa | |
| BBa_K1438000 | Bacterioferritin (BFR) | Coding | Johann Bauerfeind | 513 | . . . ctgcaagcacagattcgcgaagaaggttaa | |
| BBa_K1393000 | OprF(Val188)+GS linker+CBP | Coding | Jiajun Tan | 600 | . . . ggaggttcatccccgcatcatggcggctgg | |
| BBa_K1471000 | MerE. | Coding | Juan No Hernndez Salazar | 180 | 3 | . . . aactttacccggacaacatcagcttctccc |
| BBa_K1471001 | MerB. | Coding | Jaime Antonio del Castillo Nuez | 639 | 3 | . . . ttgcagacgatgagttccagaactccgtaa |
| BBa_K1420004 | merR family transcriptional regulator, regulatory protein for mer operon | Coding | Stephen C. Heinsch | 435 | 2 | . . . aatagtcagattctccaaatttttttccat |
| BBa_K1505001 | RBS+smtA+mCherry | Translational_Unit | Renyao Wei | 977 | . . . tacaagtaataacagaagcatatgtagaag | |
| BBa_K1438035 | PPMT | Coding | Sascha Kaufmann | |||
| BBa_K1701001 | PbrR | Coding | Wei Wei | 438 | 1 | . . . cgggggaccaccgcccatccaagcgactaa |
| BBa_K1980000 | TAT Copper Storage Protein 1 | Coding | Sam Garforth | 474 | 1 | . . . gcggcccatcatcaccaccatcactaataa |
| BBa_K1980001 | TAT Copper Storage Protein 1 sfGFP | Coding | Sam Garforth | 1203 | 1 | . . . tacaaacatcatcaccaccatcactaataa |
| BBa_K1980002 | MymT | Coding | Sam Garforth | 183 | 3 | . . . gtgaaacatcatcaccaccatcactaataa |
| BBa_K1980003 | MymT sfGFP | Coding | Sam Garforth | 912 | 1 | . . . tacaaacatcatcaccaccatcactaataa |
| BBa_K2127001 | Inducible High Expression His-Tagged Photosystem II CP47 subunit | Coding | Nafaa Haddou | 2071 | . . . acactggctcaccttcgggtgggcctttct | |
| BBa_K2127002 | CP47 His-tagged with Lac Promoter | Coding | Dawson Zeng | 1886 | . . . acactggctcaccttcgggtgggcctttct | |
| BBa_K4035003 | Dimerization of the copper metallothionein 1 : CUP1-(GGGGS)4-CUP1 | Coding | Anissa Hammi | 420 | -1 | . . . gagacgaagaagtcgtgctgcagtggcaag |
| BBa_K4035004 | Dimerization of the copper metallothionein 1 : CUP1-(AP)7-CUP1 | Coding | Anissa Hammi | 402 | -1 | . . . gagacaaagaagtcatgctgctccggcaag |
| BBa_K4035005 | Dimerization of the copper metallothionein 1 : CUP1-(EAAAK)3-CUP1 | Coding | Anissa Hammi | 405 | -1 | . . . gagacgaagaagagctgctgctcaggcaag |
| BBa_K4035006 | Dimerization of the copper metallothionein 1 : CUP1-(EAAAK)4-CUP1 | Coding | Anissa Hammi | 420 | -1 | . . . gagacaaagaagtcctgctgcagcggaaag |
| BBa_K4035007 | Dimerization of the copper metallothionein 1 : CUP1-GGGGSEAAAKGGGGS-CUP1 | Coding | Anissa Hammi | 405 | -1 | . . . gagacaaagaagtcctgctgctcggggaag |
| BBa_K4035008 | Dimerization of the copper metallothionein 1 : CUP1-GGGGS(EAAAK)2GGGGS-CUP1 | Coding | Anissa Hammi | 420 | -1 | . . . gagaccaagaagtcctgctgctcgggcaag |
| BBa_K4744000 | coding region for Lanmodulin without stop codon | Coding | Paul Cordero, Christian Kuehne | 336 | -1 | . . . gccggttcggccctggtcaatctgatccgc |
| BBa_K4744444 | "most common standard tag" ("MC") -> sequence coding for lanthanoid binding peptide | Coding | Thalia von Nethen, Arno Schnizler | 51 | -1 | . . . ggctggtatgaaggcgatgaactgctggcg |
| BBa_K4744777 | mostcomm-Strep-17-LCI | Coding | Julian Luka, Thalia von Nethen, Arno Schnizler | 219 | -1 | . . . gtgggtatttatgaagtgtgggatcgcaaa |
| BBa_K160001 | Fe-Receptor | Coding | RAUL CUERO | 2244 | . . . gtcgttgcaaccgcaaccttccgtttctaa | |
| BBa_K190020 | MymT | Translational_Unit | Nienke Kuipers | 180 | . . . tgcggcgacgaattggccccggtcaagtag | |
| BBa_K190021 | SmtA | Translational_Unit | Nienke Kuipers | 189 | 2 | . . . ggccacaccggctgtaactgccacggctaa |
| BBa_K1438003 | PPMT_GS_ATPCS | Coding | Johann Bauerfeind | 1704 | . . . gaggatgatctcgctgctcctgcctattaa | |
| BBa_K1550004 | BmtA (Lead/Zinc-binding metallothionein from Oscillatoria brevis, codon optimized for E. coli) | Coding | Jesse Goldenberg | 165 | 2 | . . . tgcggtcacaccggttgcgaatgccacaaa |
| BBa_K2127004 | CP-47-HIS TAG | Coding | Mirat Sojitra | 1548 | 2 | . . . gcccaccatcaccatcaccatgtgtagtag |
| BBa_K4035001 | CUP1 fused to Aga2 and tagged with a V5 epitope | Coding | Anissa Hammi | 612 | -1 | . . . aaccccctattagggctggatagtacctaa |
| BBa_K4035002 | Dimerization of the copper metallothionein 1 : CUP1-(GGGGS)3-CUP1 | Coding | Anissa Hammi | 405 | -1 | . . . gagacaaagaagagttgctgctccgggaag |
Metal Binding Composite Parts
This set includes composite parts that bind various metal ions.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K346004 | RBS(B0034)_MBP(lead metal binding peptide egineered from PbrR)+Terminator(B0015) | Composite | Junyi Jiao | 479 | 8 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1460001 | pT7 + RBS + GST (glutathione-S-transferase)-CRS5 (metallothionein) + Ter | Composite | Eric Holmes | 1028 | 4 | . . . cccgcccctgacagggcggggttttttttt |
| BBa_K1460002 | RBS + GST (glutathione-S-transferase)-CRS5 (metallothionein) + Ter | Composite | Eric Holmes | 970 | 7 | . . . cccgcccctgacagggcggggttttttttt |
| BBa_K1460003 | Anderson Promoter + NixA + Ter | Composite | Eric Holmes | 1029 | 1 | . . . cccgcccctgacagggcggggttttttttt |
| BBa_K1460004 | Anderson Promoter + MerT + MerP + ter | Composite | Eric Holmes | 741 | 1 | . . . cccgcccctgacagggcggggttttttttt |
| BBa_K1404002 | Ptac-NiCoTB, improves nickel and cobalt internalization | Generator | Alexandre Duprey | 1306 | 1 | . . . cagattattaatccggcttttttattattt |
| BBa_K1355001 | Regulation and transport of mercury ions | Generator | Maria Clara Tavares Astolfi, Luna Barroco de Lacerda | 1189 | 3 | . . . gccggctatccgtccagcgtcaagcagtga |
| BBa_K1355000 | Strong RBS + merA (mercuric ion reductase)+ terminator (BBa_ B0015) | Composite | Maria Clara Tavares Astolfi, Luna Barroco de Lacerda | 1778 | 2 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K519011 | SmtA-Double Term. | Composite | Kotone Miyake | 308 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1526007 | LacRS + MntH | Composite | Cau Westmann | 2676 | . . . tggtgggtacggcgttggggctctaatact | |
| BBa_K1980004 | pCusC promoter | Regulatory | Sam Garforth | 98 | 1 | . . . agagcctggcgagtaaagttggcggcataa |
| BBa_K1980010 | pCopA TAT Csp1 sfGFP with divergent CueR | Other | Sam Garforth | 1783 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K1980011 | pCopA MymT with divergent expressed CueR | Device | Sam Garforth | 763 | . . . gtgaaacatcatcaccaccatcactaataa | |
| BBa_K1980012 | pCopA MymT sfGFP with divergent CueR | Device | Sam Garforth | 1492 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K2759003 | Bacterioferritin (BFR) with sfGFP conjugation | Conjugation | Mehmet Ali Hoşkan | 1203 | . . . acgcatggtatggatgaactgtacaaataa | |
| BBa_K4035009 | Expression of the CUP1-(GGGGS)3-CUP1 dimer on the extracellular membrane of S. cerevisiae | Composite | Anissa Hammi | 1257 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
| BBa_K4035010 | Expression of the CUP1-(GGGGS)4-CUP1 dimer on the extracellular membrane of S. cerevisiae | Composite | Anissa Hammi | 1272 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
| BBa_K4035011 | Expression of the CUP1-(AP)7-CUP1 dimer on the extracellular membrane of S. cerevisiae | Composite | Anissa Hammi | 1254 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
| BBa_K4035012 | Expression of the CUP1-(EAAAK)3-CUP1 dimer on the extracellular membrane of S. cerevisiae | Composite | Anissa Hammi | 1257 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
| BBa_K4035013 | Expression of the CUP1-(EAAAK)4-CUP1 dimer on the extracellular membrane of S. cerevisiae | Composite | Anissa Hammi | 1272 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
| BBa_K4035014 | Expression of the CUP1-GGGGSEAAAKGGGGS-CUP1 dimer on the extracellular membrane of S. cerevisiae | Composite | Anissa Hammi | 1279 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
| BBa_K4035015 | Expression of the CUP1-GGGGS(EAAAK)2GGGGS-CUP1 dimer at the outter membrane of S. cerevisiae | Composite | Anissa Hammi | 1272 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
| BBa_K5111002 | ComR CDS in a composite part | Composite | Angus Lusty | 785 | -1 | . . . tttatctgttgtttgtcggtgaacgctctc |
| BBa_K1460005 | Anderson Promoter + RBS + CBP4 | Composite | Eric Holmes | 2189 | 1 | . . . gagccagattttactgctgaagataattaa |
| BBa_K1460006 | Anderson Promoter + nixA + Ter + pT7 + GST-CRS5 + Ter | Composite | Eric Holmes | 2065 | . . . cccgcccctgacagggcggggttttttttt | |
| BBa_K1460007 | Anderson Promoter + merT + merP + Ter + pT7 + GST-CRS5 + Ter | Composite | Eric Holmes | 1777 | . . . cccgcccctgacagggcggggttttttttt | |
| BBa_K1460008 | Anderson Promoter + CBP4 + pT7 + GST-CRS5 + Ter | Composite | Eric Holmes | 3225 | . . . cccgcccctgacagggcggggttttttttt | |
| BBa_K2737003 | constitutive promoter with fur box between -35 and -10 region | Regulatory | Xinyu Teng | 78 | 1 | . . . ccggaagagagtcaattcagggtggtgaat |
| BBa_K2737004 | constitutive promoter with fur box downstream -10 region | Regulatory | Xinyu Teng | 78 | 1 | . . . atcattatcagtcaattcagggtggtgaat |
| BBa_K2737005 | constitutive promoter with fur box upstream -35 region | Regulatory | Xinyu Teng | 84 | 1 | . . . ccggaagagagtcaattcagggtggtgaat |
| BBa_K4035000 | Expression of CUP1 on the extracellular membrane of S. cerevisiae | Composite | Anissa Hammi | 1038 | -1 | . . . ccgaacccgctcctgggcctcgattccacg |
Metal Sensitive Promoters/Regulatory
This set includes promoters that are sensitive to various metals. The promoters are typically regulated by a receptor protein that binds to the metal ion or complex.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I721001 | Lead Promoter | . . . gaaaaccttgtcaatgaagagcgatctatg | 94 | 4214 | It's complicated | ||
| BBa_I731004 | FecA promoter | . . . ttctcgttcgactcatagctgaacacaaca | 90 | 814 | Not in stock | ||
| BBa_I760005 | Cu-sensitive promoter | atgacaaaattgtcat | 16 | 12396 | Not in stock | ||
| BBa_I765000 | Fe promoter | . . . accaatgctgggaacggccagggcacctaa | 1044 | 1233 | It's complicated | ||
| BBa_J3902 | PrFe (PI + PII rus operon) | . . . tagatatgcctgaaagcgcataccgctatg | 272 | 1250 | It's complicated | ||
| BBa_K1122069 | Ferric uptake repressor box | tgataatcattatca | 15 | 1508 | Not in stock | ||
| BBa_K1163101 | pAceB promoter region | . . . gttttcggatccatgacgaggagctgcacg | 300 | 2652 | Not in stock | ||
| BBa_K1163107 | Fes promoter region | . . . atggcccggaatggcagcgtctgaatgacg | 298 | 1891 | Not in stock | ||
| BBa_K1163110 | YncE promoter region | . . . aaaaatatcggttcatcaaagggagtcgtc | 300 | 1894 | Not in stock | ||
| BBa_K1342005 | zinTp (Cd2+ sensing promoter) (Fw:Lac promoter(-) ver.) | . . . attacacatcatatacattaactctggagg | 81 | 1962 | In stock | ||
| BBa_K1509001 | A bi-directional promoter affected by SmtB protein | . . . gttattcagatattcaaaggagttgctgtc | 100 | 7742 | In stock | ||
| BBa_K1724000 | Pcada | . . . tgactctgtagttgctacagggtgtgcaat | 31 | 5302 | In stock | ||
| BBa_K174016 | Promoterless ArsR binding site | agtaatcaaaataaattgatttattt | 26 | 1602 | Not in stock | ||
| BBa_K174017 | CadA promoter with CzrA binding site | . . . aagctaagaggaggaactactatggctagc | 171 | 1761 | Not in stock | ||
| BBa_K1980006 | pCopA with divergent expressed CueR | . . . taacctttatcatactagaaagaggagaaa | 574 | 6235 | It's complicated | ||
| BBa_K346002 | PmerT promoter (mercury-responsive) | . . . gtacggaagtaaggttacgctatccaatcc | 57 | 13158 | In stock | ||
| BBa_K346054 | PpbrA promoter | . . . ctagagggtgttaaatcggcaacgcgagaa | 56 | 1461 | It's complicated | ||
| BBa_K540001 | rcn, cobalt-sensitive promoter | . . . atcatgaccgaatttacaactcttcttcag | 426 | 6785 | In stock | ||
| BBa_K896008 | zinTp (Cd2+ sensing promoter) | . . . attacacatcatatacattaactctggagg | 81 | 2350 | In stock |
Metal Sensitive Composite Parts
This set includes composite parts that are sensitive to various metals. These composite parts generally contain a metal sensitive promoter.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1460009 | Prcn + amilCP | Composite | Eric Holmes | 1101 | . . . attgcacgcaaacctgtggtcgcctaataa | |
| BBa_K1460010 | PmerT + amilCP | Composite | Eric Holmes | 732 | . . . attgcacgcaaacctgtggtcgcctaataa | |
| BBa_K1749000 | Cd sensitive promoter with Phi delta activator, PO promoter, and GFP | Composite | Anne Byford | 1440 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1755301 | copper promoter + RBS + ribB + terminator | Measurement | Haotian Wang | 840 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1755302 | copper promoter + RBS + ribB + terminator | Measurement | Haotian Wang | 888 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1755303 | cobalt sensor | Measurement | Haotian Wang | 1243 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1755305 | Hg Sensor | Measurement | Haotian Wang | 841 | . . . cagattattaatccggcttttttattattt | |
| BBa_K1758312 | Chromium responsive promoter with UTR+RBS and sfGFP | Generator | Team Bielefeld-CeBiTec 2015 | 1073 | 2 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1758313 | Chromium repressor under control of constitutive promoter and strong RBS,chromium responsive promote | Composite | Team Bielefeld-CeBiTec 2015 | 2081 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758314 | Chromium responsive promoter under T7-promoter with UTR-sfGFP | Composite | Team Bielefeld-CeBiTec 2015 | 1104 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758321 | mRFP under control of copper responsive promoter | Generator | Team Bielefeld-CeBiTec 2015 | 770 | 1 | . . . gaaggccgccactcaacgggtgcctgataa |
| BBa_K1758322 | Copper activator under control constitutive promoter and strong RBS and Copper responsive promoter w | Composite | Team Bielefeld-CeBiTec 2015 | 1247 | . . . gaaggccgccactcaacgggtgcctgataa | |
| BBa_K1758323 | UTR-sfGFP under control of Copper responsive promoter | Generator | Team Bielefeld-CeBiTec 2015 | 992 | 4 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1758325 | Copper responsive promoter with T7-promoter and UTR-sfGFP | Composite | Team Bielefeld-CeBiTec 2015 | 1023 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758331 | Lead responsive promoter with mRFP | Generator | Team Bielefeld-CeBiTec 2015 | 755 | 1 | . . . gaaggccgccactcaacgggtgcctgataa |
| BBa_K1758332 | Lead responsive promoter with UTR-sfGFP | Generator | Team Bielefeld-CeBiTec 2015 | 977 | 2 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1758333 | Lead repressor under control of constitutive promoter and strong RBS and lead responsive promoter wi | Composite | Team Bielefeld-CeBiTec 2015 | 1484 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758334 | Lead responsive promoter with T7-promoter and UTR-sfGFP | Composite | Team Bielefeld-CeBiTec 2015 | 1008 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758335 | UTR-sfGFP controlled by T7-promoter and lead responsive promoter | Composite | Team Bielefeld-CeBiTec 2015 | 786 | . . . gaaggccgccactcaacgggtgcctgataa | |
| BBa_K1758342 | Mercury responsive promoter with UTR-sfGFP | Generator | Team Bielefeld-CeBiTec 2015 | 966 | 1 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1758343 | MerR activator under constitutive promoter and induceble merT promoter with 5 UTR -sfGFP | Composite | Team Bielefeld-CeBiTec 2015 | 1470 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758344 | Mercury responsive promoter with T7-promoter and UTR-sfGFP | Composite | Team Bielefeld-CeBiTec 2015 | 989 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758351 | Nickel responsive promoter with RFP | Generator | Team Bielefeld-CeBiTec 2015 | 791 | . . . gaaggccgccactcaacgggtgcctgataa | |
| BBa_K1758352 | Nickel responsive promoter with UTR-sfGFP | Generator | Team Bielefeld-CeBiTec 2015 | 1013 | 2 | . . . caccttcgggtgggcctttctgcgtttata |
| BBa_K1758353 | Nickel repressor under control of constitutive promoter and strong RBS and Nickel responsive promote | Generator | Team Bielefeld-CeBiTec 2015 | 1353 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1758354 | Nickel responsive promoter with T7-promoter and UTR-sfGFP | Composite | Team Bielefeld-CeBiTec 2015 | 1042 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K1980005 | pCopA sfGFP | Reporter | Sam Garforth | 810 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K1980007 | pCusC mKate2 | Reporter | Sam Garforth | 824 | . . . cttccgtcgaaattaggacatcgttgataa | |
| BBa_K1980008 | pCopA CueR sfGFP/ feedback pCopA sfGFP | Reporter | Sam Garforth | 1252 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K1980009 | pCusC CusR RFP | Reporter | Sam Garforth | 1554 | . . . catcgtcatcatcaccaccatcactaataa | |
| BBa_K1980010 | pCopA TAT Csp1 sfGFP with divergent CueR | Other | Sam Garforth | 1783 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K1980011 | pCopA MymT with divergent expressed CueR | Device | Sam Garforth | 763 | . . . gtgaaacatcatcaccaccatcactaataa | |
| BBa_K1980012 | pCopA MymT sfGFP with divergent CueR | Device | Sam Garforth | 1492 | . . . tacaaacatcatcaccaccatcactaataa | |
| BBa_K4654011 | Li+-II_Riboswitch | RNA | Ronja Friedhoff, Felix Jarecki | 94 | -1 | . . . cagatgcccgtcgataaccgggcgtcacgg |
| BBa_K4654017 | T7-Promoter_Spacer1_Li+-II_Riboswitch_Spacer2_5'nhaA | Composite | Ronja Friedhoff, Felix Jarecki | 949 | -1 | . . . actcacgggatggacgaattatacaaataa |
| BBa_K4654018 | T7-Promoter_Spacer1-Li-+II_Riboswitch-Spacer2-5'nhaA_nanoLuc | Composite | Ronja Friedhoff, Felix Jarecki | 748 | -1 | . . . tggcggctgtgcgaacgcattctggcgtaa |
| BBa_K4654019 | T7-Promoter_Spacer1-Li-+II_Riboswitch-Spacer2-5'nhaA_mScarlet-I3 | Composite | Ronja Friedhoff, Felix Jarecki | 922 | -1 | . . . cactcaaccggggggtcgggaggttcttaa |
| BBa_K4654020 | T7-Promoter_Spacer1-Li-+II_Riboswitch-Spacer2-5'nhaA_lacZ | Composite | Ronja Friedhoff, Felix Jarecki | 3307 | -1 | . . . cattaccagttggtctggtgtcaaaaataa |
| BBa_K824008 | Cadmium Promoter with GFP Reporter | Composite | Steven Allen | 1068 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K824009 | Arsenic Promoter with GFP Reporter (Arsenic Detector) | Composite | Steven Allen | 1381 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K824012 | Lead Promoter with GFP Reporter (Lead Detector) | Composite | Steven Allen | 957 | . . . caccttcgggtgggcctttctgcgtttata |