DNA/Assembly
Contents
BioBrick cloning sites
 |
To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site. The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site. |
 |
Note that in most BioBrick plasmid backbones, the BioBrick prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information. Also, note that the BioBrick cloning site is a component of the plasmid backbone, not the part itself. |
There are no parts for this table
Other cloning sites
Some plasmid backbones available in the Registry adhere to other standards for physical composition or simply have multiple cloning sites typical of most molecular biology vectors. Parts encoding non-BioBrick cloning sites are listed here.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G00000 | BioBrick cloning site prefix | gaattcgcggccgcttctagag | 22 |
| BBa_G00001 | BioBrick cloning site suffix | tactagtagcggccgctgcag | 21 |
| BBa_I13450 | Removes BioBrick End | . . . agagtaataaactgtgataatcaatgcatg | 74 |
| BBa_I13452 | Adds another BioBrick site | . . . agattagtcacacgcgatccattgcagtgg | 52 |
| BBa_I13455 | Insertion site plus RNAse E cut site | . . . taggtcttcgaatccgatccattgcagtgg | 78 |
| BBa_I13456 | Insertion site plus RNAse E | . . . taggtcttcgaatccgatccattgcagtgg | 55 |
| BBa_I13457 | Improved insertion site with two RNAse E cut sites | . . . tctctcgagagattagtacctttggagatc | 111 |
| BBa_I732007 | BglII + BamHI | gaagatcttccggatccgg | 19 |
| BBa_J56011 | MCSII | ttaattaaggaaggaaactagt | 22 |
BioBrick restriction enzyme sites
The BioBrick standard for physical composition includes the EcoRI, NotI, XbaI, SpeI, and PstI restriction sites. Parts encoding each of the BioBrick restriction enzyme sites are listed here.
There are no parts for this table
BioBrick scars
When a BioBrick part digested with EcoRI and SpeI is assembled with a BioBrick parts digested with XbaI and PstI, the partial SpeI and XbaI sites combined to form a mixed site or scar that cannot be cut by either SpeI or XbaI. A part encoding the BioBrick scar sequence is listed here.
There are no parts for this table
BioBrick-compatible restriction enzyme sites
Some restriction enzymes produce DNA ends that are compatible with the DNA ends produced by the BioBrick restriction enzymes. These BioBrick compatible restriction enzyme sites are useful for certain applications, such as building BioBrick vectors. We list the parts encoding those restriction enzymes sites here.
There are no parts for this table
BioBrick-compatible scars
When a DNA fragment digested with a BioBrick enzyme is assembled with a second DNA fragment digested with a BioBrick-compatible enzyme, the ligated DNA forms a mixed site or scar. Parts encoding the possible scars from BioBrick-compatible sites are listed here.
There are no parts for this table
Other restriction enzyme sites
Parts encoding miscellaneous restriction enzyme sites, including those used in other physical composition standards, are listed here.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0045 | NheI restriction enzyme site (XbaI, SpeI compatible overhang) | gctagc | 6 |
| BBa_B0046 | NsiI restriction enzyme site (PstI compatible overhang) | atgcat | 6 |
| BBa_B0047 | MfeI restriction enzyme site (EcoRI compatible overhang) | caattg | 6 |
| BBa_B0048 | AvrII restriction enzyme site (XbaI, SpeI compatible overhang) | cctagg | 6 |
| BBa_B0102 | SapI restriction enzyme site (offset cutter) | gctcttct | 8 |
| BBa_B0103 | SapI restriction enzyme site, reversed (offset cutter) | atgtgaagagctg | 13 |
| BBa_I11071 | KpnI restriction enzyme site with extra flanking nucleotides | atcggtaccgca | 12 |
| BBa_I11072 | AclI restriction enzyme site with extra nucleotides | gcaaacgttcga | 12 |
| BBa_I11073 | PvuI restriction enzyme site with extra flanking nucleotides | acacgatcggta | 12 |
| BBa_I11074 | XmaI restriction enzyme site with extra flanking nucleotides | attcccgggtca | 12 |
| BBa_I11075 | BmtI restriction enzyme site with extra flanking nucleotides | cttgctagc | 9 |
| BBa_I11076 | HindIII restriction enzyme site with extra flanking nucleotides | tacaagcttct | 11 |
| BBa_I11077 | SalI restriction enzyme site with extra flanking nucleotides | atcgtcgacgca | 12 |
| BBa_I11078 | SacII restriction enzyme site with extra flanking nucleotides | gcaccgcggcga | 12 |
| BBa_I11079 | MluI restriction enzyme site with flanking nucleotides | acaacgcgtgta | 12 |
| BBa_I11080 | ApaI restriction site with extra flanking nucleotides | cgtgggccctca | 12 |
| BBa_I11081 | BamHI restriction site with extra flanking nucleotides | caaggatcc | 9 |
| BBa_I11082 | XbaI restriction site with extra flanking nucleotides | ggatctagacc | 11 |
| BBa_K150008 | BamHI restriction enzyme site | ggatcc | 6 |
| BBa_K175002 | I-PpoI homing endonuclease site | ctctcttaaggtagc | 15 |
| BBa_K175027 | I-SceI restriction site | agttacgctagggataacagggtaatatag | 30 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K4816001 | napA primer forward | cagtcacatatgatgaccatctcgcggc | 28 |
| BBa_K792013 | BamHI restriction site (standalone) | ggatcc | 6 |
| BBa_M31950 | HpaI restriction enzyme site | gtt | 3 |
| BBa_M31952 | AatII restriction enzyme site | gacgtc | 6 |
| BBa_M31953 | Acc65I restriction enzyme site | ggtacc | 6 |
| BBa_M31955 | ApaI restriction enzyme site | gggccc | 6 |
| BBa_M31956 | AfeI restriction enzyme site | agcgct | 6 |
| BBa_M31958 | AseI restriction enzyme site | attaat | 6 |
| BBa_M31961 | BbvCI restriction enzyme site | cctcagc | 7 |
| BBa_M31962 | BccI restriction enzyme site | ccatc | 5 |
| BBa_M31964 | BciVI restriction enzyme site | gtatcc | 6 |
| BBa_M31965 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31967 | BfaI restriction enzyme site | ctag | 4 |
| BBa_M31968 | BfuAI restriction enzyme site | acctgc | 6 |
| BBa_M31982 | NotI restriction enzyme site | gcggccgc | 8 |
| BBa_M31983 | EcoRI restriction enzyme site | gaattc | 6 |
| BBa_M31984 | PspOMI restriction enzyme site | gggccc | 6 |
| BBa_M31985 | BglII restriction enzyme site | agatct | 6 |
| BBa_M31986 | EagI restriction enzyme site | cggccg | 6 |
| BBa_M31987 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31988 | MluI restriction enzyme site | acgcgt | 6 |
| BBa_M31989 | BssHII restriction enzyme site | gcgcgc | 6 |
| BBa_M31990 | AscI restriction enzyme site | ggcgcgcc | 8 |
| BBa_M31991 | XbaI restriction enzyme site | tctaga | 6 |
| BBa_M31992 | SpeI restriction enzyme site | actagt | 6 |
| BBa_M31995 | BsrGI restriction enzyme site | tgtaca | 6 |
| BBa_M31996 | BsiWI restriction enzyme site | cgtacg | 6 |
| BBa_M31997 | Acc65I restriction enzyme site | ggtacc | 6 |
Other scars
Other possible mixed sites or scars are listed here.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0104 | AvrII/XbaI mixed site | cctaga | 6 |
| BBa_B0105 | RFC 25 Scar Sequence | accggc | 6 |
| BBa_G0000 | SpeI/XbaI scar for RBS-CDS junctions | tactag | 6 |
| BBa_G0001 | XbaI/SpeI mixed site, reverse | ctctagta | 8 |
| BBa_G0002 | SpeI/XbaI mixed site | tactagag | 8 |
| BBa_G0003 | NheI/XbaI mixed site | gctagag | 7 |
| BBa_G0004 | SpeI/NheI mixed site | tactagc | 7 |
| BBa_G0005 | NheI/SpeI mixed site | gctagta | 7 |
| BBa_G0006 | XbaI/NheI mixed site | ctctagc | 7 |
| BBa_K106015 | AarI "A" site scar sequence | atgctcgagggagct | 15 |
| BBa_K106016 | AarI "B" site scar sequence | ggtagttcccta | 12 |
| BBa_K106017 | AarI "D" site scar sequence | tgcgggatcctgagtaaataagcggccgc | 29 |
| BBa_K112999 | BBb1 scar sequence | ggatct | 6 |
| BBa_K1319106 | RFC 25 Translation Start Scar Sequence | tactagatggccggc | 15 |
| BBa_K1319107 | RFC 25 Translation Stop Scar Sequence | accggttaatactagag | 17 |
| BBa_K245009 | RFC 37 Scar Sequence | tccggc | 6 |
Single nucleotides
When specifying composite BioBrick parts, it can be helpful to sometimes specify a single nucleotide within the composite part. Thus, parts encoding each nucleotide alone are listed for convenience.
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G0009 | The nucleotide A | a | 1 |
| BBa_G0010 | The nucleotide C | c | 1 |
| BBa_G0011 | The nucleotide G | g | 1 |
| BBa_G0012 | The nucleotide T | t | 1 |
| BBa_K1402010 | Lac Promoter | . . . ccactagaaataattttgtttaactttaag | 79 |
| BBa_K361001 | Message gene template | . . . caagatagactaatagtcggatccctcgag | 438 |
| BBa_K4105001 | DNAzyme | . . . ttaggcccagtcctggcgccctctgtttga | 100 |
| BBa_K4105002 | a region of mif23 gene | . . . aatccgggtcaggaccgcgggagacaaact | 88 |
| BBa_K649204 | lox2272 | . . . cttcgtataggatactttatacgaagttat | 34 |
| BBa_M34014 | Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana | . . . ttttctttttgtttttaaataaatatttag | 2646 |