DNA/Assembly
Sequencing parts • Amplifying parts • Amplifying plasmid backbones • GFP/YFP/CFP primers • Common primers
BioBrick cloning sites
 |
To adhere to the BioBrick® standard for physical composition of genetic parts, plasmid backbones must include a BioBrick® cloning site. The cloning site includes a BioBrick® prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick® suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site. |
 |
In most BioBrick® plasmid backbones, including those constructed from the BioBrick® base vector, the BioBrick® prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick® prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information. |
There are no parts for this table
Other cloning sites
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G00000 | BioBrick cloning site prefix | gaattcgcggccgcttctagag | 22 |
| BBa_G00001 | BioBrick cloning site suffix | tactagtagcggccgctgcag | 21 |
| BBa_I13450 | Removes BioBrick End | . . . agagtaataaactgtgataatcaatgcatg | 74 |
| BBa_I13452 | Adds another BioBrick site | . . . agattagtcacacgcgatccattgcagtgg | 52 |
| BBa_I13455 | Insertion site plus RNAse E cut site | . . . taggtcttcgaatccgatccattgcagtgg | 78 |
| BBa_I13456 | Insertion site plus RNAse E | . . . taggtcttcgaatccgatccattgcagtgg | 55 |
| BBa_I13457 | Improved insertion site with two RNAse E cut sites | . . . tctctcgagagattagtacctttggagatc | 111 |
| BBa_I732007 | BglII + BamHI | gaagatcttccggatccgg | 19 |
| BBa_J56011 | MCSII | ttaattaaggaaggaaactagt | 22 |
BioBrick restriction enzyme sites
There are no parts for this table
Other restriction enzyme sites
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0045 | NheI restriction enzyme site (XbaI, SpeI compatible overhang) | gctagc | 6 |
| BBa_B0046 | NsiI restriction enzyme site (PstI compatible overhang) | atgcat | 6 |
| BBa_B0047 | MfeI restriction enzyme site (EcoRI compatible overhang) | caattg | 6 |
| BBa_B0048 | AvrII restriction enzyme site (XbaI, SpeI compatible overhang) | cctagg | 6 |
| BBa_B0102 | SapI restriction enzyme site (offset cutter) | gctcttct | 8 |
| BBa_B0103 | SapI restriction enzyme site, reversed (offset cutter) | atgtgaagagctg | 13 |
| BBa_I11071 | KpnI restriction enzyme site with extra flanking nucleotides | atcggtaccgca | 12 |
| BBa_I11072 | AclI restriction enzyme site with extra nucleotides | gcaaacgttcga | 12 |
| BBa_I11073 | PvuI restriction enzyme site with extra flanking nucleotides | acacgatcggta | 12 |
| BBa_I11074 | XmaI restriction enzyme site with extra flanking nucleotides | attcccgggtca | 12 |
| BBa_I11075 | BmtI restriction enzyme site with extra flanking nucleotides | cttgctagc | 9 |
| BBa_I11076 | HindIII restriction enzyme site with extra flanking nucleotides | tacaagcttct | 11 |
| BBa_I11077 | SalI restriction enzyme site with extra flanking nucleotides | atcgtcgacgca | 12 |
| BBa_I11078 | SacII restriction enzyme site with extra flanking nucleotides | gcaccgcggcga | 12 |
| BBa_I11079 | MluI restriction enzyme site with flanking nucleotides | acaacgcgtgta | 12 |
| BBa_I11080 | ApaI restriction site with extra flanking nucleotides | cgtgggccctca | 12 |
| BBa_I11081 | BamHI restriction site with extra flanking nucleotides | caaggatcc | 9 |
| BBa_I11082 | XbaI restriction site with extra flanking nucleotides | ggatctagacc | 11 |
| BBa_K150008 | BamHI restriction enzyme site | ggatcc | 6 |
| BBa_K175002 | I-PpoI homing endonuclease site | ctctcttaaggtagc | 15 |
| BBa_K175027 | I-SceI restriction site | agttacgctagggataacagggtaatatag | 30 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K4816001 | napA primer forward | cagtcacatatgatgaccatctcgcggc | 28 |
| BBa_K792013 | BamHI restriction site (standalone) | ggatcc | 6 |
| BBa_M31950 | HpaI restriction enzyme site | gtt | 3 |
| BBa_M31952 | AatII restriction enzyme site | gacgtc | 6 |
| BBa_M31953 | Acc65I restriction enzyme site | ggtacc | 6 |
| BBa_M31955 | ApaI restriction enzyme site | gggccc | 6 |
| BBa_M31956 | AfeI restriction enzyme site | agcgct | 6 |
| BBa_M31958 | AseI restriction enzyme site | attaat | 6 |
| BBa_M31961 | BbvCI restriction enzyme site | cctcagc | 7 |
| BBa_M31962 | BccI restriction enzyme site | ccatc | 5 |
| BBa_M31964 | BciVI restriction enzyme site | gtatcc | 6 |
| BBa_M31965 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31967 | BfaI restriction enzyme site | ctag | 4 |
| BBa_M31968 | BfuAI restriction enzyme site | acctgc | 6 |
| BBa_M31982 | NotI restriction enzyme site | gcggccgc | 8 |
| BBa_M31983 | EcoRI restriction enzyme site | gaattc | 6 |
| BBa_M31984 | PspOMI restriction enzyme site | gggccc | 6 |
| BBa_M31985 | BglII restriction enzyme site | agatct | 6 |
| BBa_M31986 | EagI restriction enzyme site | cggccg | 6 |
| BBa_M31987 | BclI restriction enzyme site | tgatca | 6 |
| BBa_M31988 | MluI restriction enzyme site | acgcgt | 6 |
| BBa_M31989 | BssHII restriction enzyme site | gcgcgc | 6 |
| BBa_M31990 | AscI restriction enzyme site | ggcgcgcc | 8 |
| BBa_M31991 | XbaI restriction enzyme site | tctaga | 6 |
| BBa_M31992 | SpeI restriction enzyme site | actagt | 6 |
| BBa_M31995 | BsrGI restriction enzyme site | tgtaca | 6 |
| BBa_M31996 | BsiWI restriction enzyme site | cgtacg | 6 |
| BBa_M31997 | Acc65I restriction enzyme site | ggtacc | 6 |
BioBrick scars
There are no parts for this table
Other scars
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0104 | AvrII/XbaI mixed site | cctaga | 6 |
| BBa_B0105 | RFC 25 Scar Sequence | accggc | 6 |
| BBa_G0000 | SpeI/XbaI scar for RBS-CDS junctions | tactag | 6 |
| BBa_G0001 | XbaI/SpeI mixed site, reverse | ctctagta | 8 |
| BBa_G0002 | SpeI/XbaI mixed site | tactagag | 8 |
| BBa_G0003 | NheI/XbaI mixed site | gctagag | 7 |
| BBa_G0004 | SpeI/NheI mixed site | tactagc | 7 |
| BBa_G0005 | NheI/SpeI mixed site | gctagta | 7 |
| BBa_G0006 | XbaI/NheI mixed site | ctctagc | 7 |
| BBa_K106015 | AarI "A" site scar sequence | atgctcgagggagct | 15 |
| BBa_K106016 | AarI "B" site scar sequence | ggtagttcccta | 12 |
| BBa_K106017 | AarI "D" site scar sequence | tgcgggatcctgagtaaataagcggccgc | 29 |
| BBa_K112999 | BBb1 scar sequence | ggatct | 6 |
| BBa_K1319106 | RFC 25 Translation Start Scar Sequence | tactagatggccggc | 15 |
| BBa_K1319107 | RFC 25 Translation Stop Scar Sequence | accggttaatactagag | 17 |
| BBa_K245009 | RFC 37 Scar Sequence | tccggc | 6 |
Primer binding sites
 |
A common operation with BioBrick® plasmids is to verify the length or sequence of the cloned BioBrick® part. To verify the length of the BioBrick® part, most people use [http://openwetware.org/wiki/Colony_PCR colony PCR] to amplify the BioBrick® part and check the length using [http://openwetware.org/wiki/Agarose_gel_electrophoresis agarose gel electrophoresis]. To [http://openwetware.org/wiki/Sequencing_DNA sequence the part], most people use a core facility at their institution or send samples to commercial DNA sequencing services. Regardless, both length and sequence verification require the use of primers (short synthetic DNA fragments usually ~20 nucleotides in length). For convenience, most BioBrick® plasmid backbones, including those constructed from the BioBrick® base vector, include standard primer annealing sites for the VF2 and VR primers. The VF2 and VR primers flank the BioBrick cloning site but are sufficiently distant from the cloning site to ensure high quality sequencing reads. Or alternatively, you can also use the BioBrick-f and BioBrick-r primers which anneal to the BioBrick® prefix and BioBrick® suffix sequences, respectively. |
 |
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G00000 | BioBrick cloning site prefix | gaattcgcggccgcttctagag | 22 |
| BBa_G00001 | BioBrick cloning site suffix | tactagtagcggccgctgcag | 21 |
| BBa_G00100 | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa | 20 |
| BBa_G00102 | Reverse BioBrick primer annealing site (VR binding site) | gctcactcaaaggcggtaat | 20 |
| BBa_K3464000 | Forward Primer for the detection of ancestral allele of the rs4149056 | tctgggtcatacatgtggatatatgt | 26 |
| BBa_K3464001 | Forward Primer for the detection of alternative allele of the rs4149056 | tctgggtcatacatgtggatatatgc | 26 |
| BBa_K3464002 | Reverse Primer for the detection of the rs4149056 | agcaaaggactattgaaagagtgaat | 26 |
| BBa_K4816001 | napA primer forward | cagtcacatatgatgaccatctcgcggc | 28 |
Spacer
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_B0040 | Spacer.1 (generic) | . . . cttacctcttaagaggtcactgacctaaca | 70 |
| BBa_K2483005 | sgRNA target site couples facing each other with 6 bp spacer | . . . cgtctgtaatcgccctttgtacgtgaacgg | 850 |
| BBa_K2483006 | sgRNA target site couples facing each other with 18 bp spacer | . . . ttgaccgcggtcttcctccacattcctgtc | 955 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K3831010 | Spacer_0 | . . . cttactctgttgaaaacgaatagataggtt | 40 |
| BBa_K3831011 | Spacer_1 | tgctcgtagtttacc | 15 |
| BBa_K3831012 | Spacer_5 | . . . agaatagtcaatcttcggaaatcccaggtg | 40 |
| BBa_K3831015 | Spacer_7 | taataaaaggtcccg | 15 |
| BBa_K3831023 | Spacer 03 | aaggaacggttattt | 15 |
| BBa_K3831026 | Spacer 02 | agattactactgata | 15 |
| BBa_K3831027 | Spacer 06 | ccgattctgagacgg | 15 |
| BBa_K3831028 | Spacer 04 | . . . aatacaggacccgaatcgtttcagttgcct | 40 |
| BBa_K3831038 | Spacer_SP1 | . . . ttaccacggatacagacagtgataatctta | 40 |
Single nucleotides
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G0009 | The nucleotide A | a | 1 |
| BBa_G0010 | The nucleotide C | c | 1 |
| BBa_G0011 | The nucleotide G | g | 1 |
| BBa_G0012 | The nucleotide T | t | 1 |
| BBa_K1402010 | Lac Promoter | . . . ccactagaaataattttgtttaactttaag | 79 |
| BBa_K361001 | Message gene template | . . . caagatagactaatagtcggatccctcgag | 438 |
| BBa_K4105001 | DNAzyme | . . . ttaggcccagtcctggcgccctctgtttga | 100 |
| BBa_K4105002 | a region of mif23 gene | . . . aatccgggtcaggaccgcgggagacaaact | 88 |
| BBa_K649204 | lox2272 | . . . cttcgtataggatactttatacgaagttat | 34 |
| BBa_M34014 | Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana | . . . ttttctttttgtttttaaataaatatttag | 2646 |
DNA origami parts
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_J35000 | Rothemund DNA origami part | tcctcttttgaggaacaagttttcttgt | 28 |
| BBa_J35001 | fork hairpin | . . . ccgcagttttctgcctcgttttcgaggggc | 32 |
| BBa_J35002 | dumbbell hairpin | gcctcttttgaggcgcaagttttcttgc | 28 |
| BBa_J35003 | 3-fingers arm | . . . gcctcgttttcgagggagttttctccgggc | 44 |
| BBa_J35004 | 4-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 63 |
| BBa_J35005 | 5-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 76 |
| BBa_J35006 | 6-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 89 |
| BBa_J35007 | 7-fingers arm | . . . gagttttctcctctggttttccagtcggcg | 102 |
| BBa_J35120 | B-Z DNA switcher | tggacactaagctattcatc | 20 |
| BBa_K1479005 | -- No description -- | aattccggaattccgg | 16 |