Difference between revisions of "Terminators/test"

 
Line 3: Line 3:
 
<style type="text/css">
 
<style type="text/css">
  
.type2 table {  
+
table {  
color: #333; /* Lighten up font color */
+
color: #333;
font-family: Helvetica, Arial, sans-serif; /* Nicer font */
+
font-family: Helvetica, Arial, sans-serif;
 
width: 640px;  
 
width: 640px;  
 
border-collapse:  
 
border-collapse:  
Line 11: Line 11:
 
}
 
}
  
.type2 td, .type2 th { border: 1px solid #CCC; height: 30px; } /* Make cells a bit taller */
+
td, th {  
 +
border: 1px solid transparent; /* No more visible border */
 +
height: 30px;  
 +
transition: all 0.3s;  /* Simple transition for hover effect */
 +
}
  
.type2 th {
+
th {
background: #F3F3F3; /* Light grey background */
+
background: #333; color: #FFF;  /* Darken header a bit */
font-weight: bold; /* Make sure they're bold */
+
font-weight: bold;
 
}
 
}
  
.type2 td {
+
td {
background: #FAFAFA; /* Lighter grey background */
+
background: #FAFAFA;
text-align: center; /* Center our text */
+
text-align: center;
 
}
 
}
 +
 +
/* Cells in even rows (2,4,6...) are one color */
 +
tr:nth-child(even) td { background: #F1F1F1; } 
 +
 +
/* Cells in odd rows (1,3,5...) are another (excludes header cells)  */
 +
tr:nth-child(odd) td { background: #FEFEFE; } 
 +
 +
tr td:hover { background: #666; color: #FFF; } /* Hover cell effect! */ - See more at: http://cssmenumaker.com/blog/stylish-css-tables-tutorial#sthash.hi0gO0x2.dpuf
 
</style>
 
</style>
  

Latest revision as of 22:34, 27 February 2013

Test page for creating new terminator catalog pages

One Two Three
Apples Carrots Steak
Oranges Potato Pork
Pears Peas Chicken


< Back to Terminators

Forward terminators Bidirectional terminators Reverse terminators Yeast terminators Eukaryotic terminators Help!


E. coli terminators

There are several E. coli transcriptional terminators available via the Registry. The most commonly used type of terminator is a forward terminator. When placed downstream of a genetic part that is usually transcribed, a forward transcriptional terminator will cause transcription to abort. However, in general, most transcriptional terminators will not terminate transcription with 100% efficiency. Some RNA polymerases will continue transcribing "through" a transcriptional terminator.

There are also bidirectional transcriptional terminators. Such terminators will usually cause transcription to terminate on both the forward and reverse strand. Again, however, the efficiency of transcriptional termination is not 100% and will often differ in the forward and reverse direction.

Finally, there are also reverse transcriptional terminators that terminate transcription on the reverse strand only.

Forward terminators


More...
NameDescriptionDirectionEfficiency
Fwd. Rev.
ChassisLength
BBa_B0010T1 from E. coli rrnBForward   80
BBa_B0012TE from coliphageT7Forward0.309[CC]-0.368[CC] 41
BBa_B0013TE from coliphage T7 (+/-)Forward0.6[CC]-1.06[CC] 47
BBa_B0015double terminator (B0010-B0012)Forward0.984[CC]
0.97[JK]
0.295[CC]
0.62[JK]
E.coli129
BBa_B0017double terminator (B0010-B0010)Forward   168
BBa_B0053Terminator (His)Forward   72
BBa_B0055 -- No description --   78
BBa_B1002Terminator (artificial, small, %T~=85%)Forward0.98[CH]  34
BBa_B1003Terminator (artificial, small, %T~=80)Forward0.83[CH]  34
BBa_B1004Terminator (artificial, small, %T~=55)Forward0.93[CH]  34
BBa_B1005Terminator (artificial, small, %T~=25%Forward0.86[CH]  34
BBa_B1006Terminator (artificial, large, %T~>90)Forward0.99[CH]  39
BBa_B1010Terninator (artificial, large, %T~<10)Forward0.95[CH]  40
BBa_I11013Modification of biobricks part BBa_B0015   129
BBa_I51003 -- No description --   110
BBa_J61048[rnpB-T1] TerminatorForward0.98[JCA]  113
BBa_K1392970Terminator+Tetr Promoter+T4 Endolysin   623
BBa_K1486001Arabinose promoter + CpxRForward  Escherichia coli1924
BBa_K1486005Arabinose promoter + sfGFP-CpxR [Cterm]Forward  Escherichia coli2668
BBa_K1486009CxpR & Split IFP1.4 [Nterm + Nterm]Forward  Escherichia coli3726
BBa_K780000Terminator for Bacillus subtilis   54
BBa_K864501T22, P22 late terminatorForward   42
BBa_K864600T0 (21 imm) transcriptional terminatorForward0.97  52
BBa_K864601Lambda t1 transcriptional terminatorForward0.97  53


Bidirectional terminators


More...
NameDescriptionDirectionEfficiency
Fwd. Rev.
ChassisLength
BBa_B0011LuxICDABEG (+/-)Bidirectional0.419[CC]/0.95[JK]0.636[CC]/0.86[JK] 46
BBa_B0014double terminator (B0012-B0011)Bidirectional0.604[CC]/0.96[JK]0.86[JK] 95
BBa_B0021LuxICDABEG (+/-), reversedBidirectional0.636[CC]/0.86[JK]0.419[CC]/0.95[JK] 46
BBa_B0024double terminator (B0012-B0011), reversedBidirectional0.86[JK]0.604[CC]/0.96[JK] 95
BBa_B0050Terminator (pBR322, +/-)Bidirectional   33
BBa_B0051Terminator (yciA/tonA, +/-)Bidirectional   35
BBa_B1001Terminator (artifical, small, %T~=90)Bidirectional0.81[CH]  34
BBa_B1007Terminator (artificial, large, %T~=80)Bidirectional0.83[CH]  40
BBa_B1008Terminator (artificial, large,  %T~=70)Bidirectional   40
BBa_B1009Terminator (artificial, large, %T~=40%)Bidirectional   40
BBa_K187025terminator in pAB, BioBytes plasmid   60
BBa_K259006GFP-TerminatorBidirectional0.604[CC]/0.96[JK]0.86[JK] 823


Reverse terminators


More...
NameDescriptionDirectionEfficiency
Fwd. Rev.
ChassisLength
BBa_B0020Terminator (Reverse B0010)Reverse   82
BBa_B0022TE from coliphageT7, reversedReverse-0.368[CC]0.309[CC] 41
BBa_B0023TE from coliphage T7, reversedReverse-1.06[CC]0.6[CC] 47
BBa_B0025double terminator (B0015), reversedReverse0.295[CC]/0.62[JK]0.984[CC]/0.97[JK] 129
BBa_B0052Terminator (rrnC)Forward   41
BBa_B0060Terminator (Reverse B0050)Bidirectional   33
BBa_B0061Terminator (Reverse B0051)Bidirectional   35
BBa_B0063Terminator (Reverse B0053)Reverse   72


Yeast terminators

Here are all the yeast terminators available. As you can see, there are only a couple available, so please design, construct, and characterize new ones and submit them to the Registry!


More...
NameDescriptionDirectionEfficiency
Fwd. Rev.
ChassisLength
BBa_J63002ADH1 terminator from S. cerevisiaeForward   225
BBa_K110012STE2 terminatorForward   123
BBa_K1462070cyc1   250
BBa_K1486025ADH1 TerminatorForward  Saccharomyces Cerevisiae188
BBa_K2314608Tmini is a very short terminator in yeast. It's only 68bp in length but has a good performance.   68
BBa_K2637012ADH1 Terminator  S. cerevisiae335
BBa_K2637014TEF1 Terminator  S. cerevisiae476
BBa_K2637016PGK1 Terminator  S. cerevisiae285
BBa_K2637017CYC1 terminator   261
BBa_K3768004CPS1 Terminator for S. cerevisiae   191
BBa_K392003yeast ADH1 terminator   129
BBa_K4947020Yeast terminator with I-SceI restriction site   50
BBa_K801011TEF1 yeast terminator   507
BBa_K801012ADH1 yeast terminator   349
BBa_Y1015CycE1   252


Eukaryotic terminators

Here are all the eukaryotic, including yeast, terminators available. As you can see, there are only a handful available, so please design, construct, and characterize new ones and submit them to the Registry!


More...
NameDescriptionDirectionEfficiency
Fwd. Rev.
ChassisLength
BBa_J52016eukaryotic -- derived from SV40 early poly A signal sequenceForward   238
BBa_J63002ADH1 terminator from S. cerevisiaeForward   225
BBa_K110012STE2 terminatorForward   123
BBa_K115930735S Terminator of Cauliflower Mosaic Virus (CaMV)   217
BBa_K1462070cyc1   250
BBa_K1484215nopaline synthase terminator   293
BBa_K1486025ADH1 TerminatorForward  Saccharomyces Cerevisiae188
BBa_K2314608Tmini is a very short terminator in yeast. It's only 68bp in length but has a good performance.   68
BBa_K2637012ADH1 Terminator  S. cerevisiae335
BBa_K2637014TEF1 Terminator  S. cerevisiae476
BBa_K2637016PGK1 Terminator  S. cerevisiae285
BBa_K3758200psbA 3-UTR (Nicotiana tabacum)   93
BBa_K392003yeast ADH1 terminator   129
BBa_K404108hGH terminator   481
BBa_K404116hGH_[AAV2]-right-ITR    632
BBa_K4213000Plant Thiamine Pyrophosphate Riboswitch   675
BBa_K4235020SV40 poly(A) signal  Spodoptera Frugiperda135
BBa_K4947020Yeast terminator with I-SceI restriction site   50
BBa_K678012SV40 poly A, terminator for mammalian cells   139
BBa_K678018hGH poly A, terminator for mammalian cells   635
BBa_K678019BGH poly A, mammalian terminator   233
BBa_K678036trpC terminator for Aspergillus nidulans   759
BBa_K678037T1-motni, terminator for Aspergillus niger   1006
BBa_K678038T2-motni, terminator for Aspergillus niger   990
BBa_K678039T3-motni, terminator for Aspergillus niger   889
BBa_K801011TEF1 yeast terminator   507
BBa_K801012ADH1 yeast terminator   349
BBa_Y1015CycE1   252


Single terminators


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_B0010T1 from E. coli rrnBTerminatorRandy Rettberg801064 . . . tttatctgttgtttgtcggtgaacgctctc
BBa_B0011LuxICDABEG (+/-)TerminatorReshma Shetty4694 . . . cagattattaatccggcttttttattattt
BBa_B0012TE from coliphageT7TerminatorReshma Shetty411021 . . . caccttcgggtgggcctttctgcgtttata
BBa_B0013TE from coliphage T7 (+/-)TerminatorReshma Shetty4719 . . . caccttcgggtgggcctttttgcgtttata
BBa_B0016Terminator (T7 RNAP specific, T_Phi)TerminatorSri Kosuri4869 . . . gcctctaaacgggtcttgaggggttttttg
BBa_B0020Terminator (Reverse B0010)TerminatorCaitlin Conboy822 . . . ctgagcctttcgttttatttgatgcctggt
BBa_B0021LuxICDABEG (+/-), reversedTerminatorCaitlin Conboy469 . . . ggattaataatctggctttttatattctct
BBa_B0022TE from coliphageT7, reversedTerminatorCaitlin Conboy411 . . . aaaggcccacccgaaggtgagccagtgtga
BBa_B0023TE from coliphage T7, reversedTerminatorCaitlin Conboy472 . . . ccacccgaaggtgagccagtttgatttttt
BBa_B0050Terminator (pBR322, +/-)TerminatorCaitlin Conboy331 . . . aaaaggatctcaagaagatcctttgatttt
BBa_B0051Terminator (yciA/tonA, +/-)TerminatorCaitlin Conboy35  . . . caaaagcctccgaccggaggcttttgactt
BBa_B0052Terminator (rrnC)TerminatorCaitlin Conboy411 . . . ttagcgaaagctaaggattttttttatctg
BBa_B0053Terminator (His)TerminatorCaitlin Conboy7252 . . . tctttaaaaccgaaaagattacttcgcgtt
BBa_B0054Transcriptional terminatorTerminatorReshma Shetty6925 . . . actaaaacttcccttggggttatcattggg
BBa_B0055 -- No description --TerminatorReshma Shetty7823 . . . aggtgagccagtgagttgattgctacgtaa
BBa_B0060Terminator (Reverse B0050)TerminatorCaitlin Conboy33  . . . atcaaaggatcttcttgagatccttttttt
BBa_B0061Terminator (Reverse B0051)TerminatorCaitlin Conboy35  . . . aaaagcctccggtcggaggcttttgacttt
BBa_B0062Terminator (Reverse B0052)TerminatorCaitlin Conboy4128 . . . aatccttagctttcgctaaggatgatttct
BBa_B0063Terminator (Reverse B0053)TerminatorCaitlin Conboy72  . . . tggtgacaccttgcccgtttttttgccgga
BBa_B1001Terminator (artifical, small, %T~=90)TerminatorHaiyao Huang3420 . . . aaaaaccccgcttcggcggggttttttttt
BBa_B1002Terminator (artificial, small, %T~=85%)TerminatorHaiyao Huang3463 . . . aaaaaccccgcttcggcggggttttttcgc
BBa_B1003Terminator (artificial, small, %T~=80)TerminatorHaiyao Huang349 . . . aaaaaccccgcttcggcggggtttttccgc
BBa_B1004Terminator (artificial, small, %T~=55)TerminatorHaiyao Huang346 . . . gaaaaccccgcttcggcggggttttgccgc
BBa_B1005Terminator (artificial, small, %T~=25%TerminatorHaiyao Huang346 . . . gcaaaccccgcttcggcggggtttcgccgc
BBa_B1006Terminator (artificial, large, %T~>90)TerminatorHaiyao Huang39221 . . . ccccgcccctgacagggcggggtttttttt
BBa_B1007Terminator (artificial, large, %T~=80)TerminatorHaiyao Huang409 . . . cccgcccctgacagggcggggttttttcgc
BBa_B1008Terminator (artificial, large,  %T~=70)TerminatorHaiyao Huang402 . . . cccgcccctgacagggcggggtttttccgc
BBa_B1009Terminator (artificial, large, %T~=40%)TerminatorHaiyao Huang403 . . . cccgcccctgacagggcggggttttgccgc
BBa_B1010Terninator (artificial, large, %T~<10)TerminatorHaiyao Huang4010 . . . cccgcccctgacagggcggggtttcgccgc
BBa_C0440Terminator (bgl)TerminatorT. Senthil1242 . . . ttttttttggagttttgccgcaaagcggta
BBa_I51003 -- No description --TerminatorDrew Endy110  . . . catgctgactgactgactgatcggcgatcg
BBa_J18913T7 terminator (incl. STOP)TerminatorRaik Gruenberg13526 . . . ttttgctgaaaggaggaactatatccggat
BBa_J52016eukaryotic -- derived from SV40 early poly A signal sequenceTerminatorMonika Ciglic2384 . . . agacaatagcaggcatgctggggatatgca
BBa_J61048[rnpB-T1] TerminatorTerminatorJohn Anderson11359 . . . gactgtccacgacgctatacccaaaagaaa
BBa_J63002ADH1 terminator from S. cerevisiaeTerminatorCaroline Ajo-Franklin22567 . . . atgccgagcaaatgcctgcaaatcgctccc
BBa_K110012STE2 terminatorTerminatorJames DiCarlo123  . . . ataaaaaaaaatggtatctttcttatttga
BBa_K187025terminator in pAB, BioBytes plasmidTerminatorJulia Pon60  . . . ctgacagggcggggttttttttctgcagtg
BBa_K3568009rrnB T1 and T2 transcriptional terminatorsTerminatorMENG XU158-1 . . . cgaaaggctcagtcgaaagactgggccttt
BBa_K392003yeast ADH1 terminatorTerminatorTadashi Nakamura, Shuhei Yasumoto, Takahiro Saka, Saya Kakuda 12926 . . . ctattactagagcccgccgccaccatggag
BBa_K404108hGH terminatorTerminatorFreiburg Bioware 201048122 . . . cgtgaaccactgctcccttccctgtccttt
BBa_K404116hGH_[AAV2]-right-ITR ProjectFreiburg Bioware 2010632  . . . agtgagcgagcgagcgcgcagctgcctgca
BBa_K4841006L3S2P21 TTerminatorDai Yuchen61-1 . . . gaggcctcttttctggaatttggtaccgag
BBa_K629005trkD, a functional Kup (formerly TrkD) system took up Cs+ with a moderate rate and affinityCodingZilong WANG, Yi ZHENG18691 . . . atcgaactgggtactcaggtcgaaatctaa
BBa_K678012SV40 poly A, terminator for mammalian cellsTerminatorDTU-Denmark-21394 . . . caaactcatcaatgtatcttatcatgtctg
BBa_K678018hGH poly A, terminator for mammalian cellsTerminatorDTU-Denmark-26352 . . . gcgttgggtccactcagtagatgcctgttg
BBa_K678019BGH poly A, mammalian terminatorTerminatorDTU-Denmark-223312 . . . ggcatgctggggatgcggtgggctctatgg
BBa_K678036trpC terminator for Aspergillus nidulansTerminatorDTU-Denmark-27597 . . . tagaagtcctcgtgtactgtgtaagcgccc
BBa_K678037T1-motni, terminator for Aspergillus nigerTerminatorDTU-Denmark-210062 . . . actttcgagtatattggcatcagacgtcgc
BBa_K678038T2-motni, terminator for Aspergillus nigerTerminatorDTU-Denmark-29901 . . . taaccggttttaaagttatccggggtcatg
BBa_K678039T3-motni, terminator for Aspergillus nigerTerminatorDTU-Denmark-28891 . . . tgtagaagaggtaggtaggtaggaattaca
BBa_K731722T1 terminator from E. coli rrnBTerminatorAnna Depetris, Giacomo Giacomelli793 . . . ttttatctgttgtttgtcggtgaacgctct
BBa_K780000Terminator for Bacillus subtilisTerminatorNikodem Latocha54  . . . ctgaaatagctgcgcttttttgtgtcataa
BBa_K801011TEF1 yeast terminatorTerminatorGeorg Schtzinger5073 . . . caaatactttgagcggcgctatctgtaatg
BBa_K801012ADH1 yeast terminatorTerminatorGeorg Schtzinger34955 . . . accggccggtcgaaattcccctaccctatg
BBa_K809005Terminator of Yeast mitochondrial gene COX3TerminatorXiaopeng Xu495 . . . ccgcgaagcgggaactaataataatataat
BBa_K809006Terminator of Yeast mitochondrial gene Q0255TerminatorXiaopeng Xu651 . . . cggaacccccgagaggagttattatattta
BBa_K864501T22, P22 late terminatorTerminatorErik Gullberg42  . . . gagtttaaccgctcggggctttttgcgttt
BBa_K864600T0 (21 imm) transcriptional terminatorTerminatorErik Lundin526 . . . cacaccgggcgttttttctttgtgagtcca
BBa_K864601Lambda t1 transcriptional terminatorTerminatorErik Lundin537 . . . gtgatttttgtcttcttgcgctaatttttt
BBa_Y1015CycE1TerminatorSamantha Sutton252  . . . tgggacgctcgaaggctttaatttgcggcc


_