Difference between revisions of "Terminators/test"

Revision as of 22:37, 21 February 2013

Test page for creating new terminator catalog pages


Forward terminators	Bidirectional terminators	Reverse terminators	Yeast terminators	Eukaryotic terminators	Help!

E. coli terminators

There are several E. coli transcriptional terminators available via the Registry. The most commonly used type of terminator is a forward terminator. When placed downstream of a genetic part that is usually transcribed, a forward transcriptional terminator will cause transcription to abort. However, in general, most transcriptional terminators will not terminate transcription with 100% efficiency. Some RNA polymerases will continue transcribing "through" a transcriptional terminator.

There are also bidirectional transcriptional terminators. Such terminators will usually cause transcription to terminate on both the forward and reverse strand. Again, however, the efficiency of transcriptional termination is not 100% and will often differ in the forward and reverse direction.

Finally, there are also reverse transcriptional terminators that terminate transcription on the reverse strand only.

Forward terminators

*More...*
Name	Description	Direction	Efficiency Fwd. Rev.		Chassis	Length
BBa_B0010	T1 from E. coli rrnB	Forward				80
BBa_B0012	TE from coliphageT7	Forward	0.309[CC]	-0.368[CC]		41
BBa_B0013	TE from coliphage T7 (+/-)	Forward	0.6[CC]	-1.06[CC]		47
BBa_B0015	double terminator (B0010-B0012)	Forward	0.984[CC] 0.97[JK]	0.295[CC] 0.62[JK]	E.coli	129
BBa_B0017	double terminator (B0010-B0010)	Forward				168
BBa_B0053	Terminator (His)	Forward				72
BBa_B0055	-- No description --					78
BBa_B1002	Terminator (artificial, small, %T~=85%)	Forward	0.98[CH]			34
BBa_B1003	Terminator (artificial, small, %T~=80)	Forward	0.83[CH]			34
BBa_B1004	Terminator (artificial, small, %T~=55)	Forward	0.93[CH]			34
BBa_B1005	Terminator (artificial, small, %T~=25%	Forward	0.86[CH]			34
BBa_B1006	Terminator (artificial, large, %T~>90)	Forward	0.99[CH]			39
BBa_B1010	Terninator (artificial, large, %T~<10)	Forward	0.95[CH]			40
BBa_I11013	Modification of biobricks part BBa_B0015					129
BBa_I51003	-- No description --					110
BBa_J61048	[rnpB-T1] Terminator	Forward	0.98[JCA]			113
BBa_K1392970	Terminator+Tetr Promoter+T4 Endolysin					623
BBa_K1486001	Arabinose promoter + CpxR	Forward			Escherichia coli	1924
BBa_K1486005	Arabinose promoter + sfGFP-CpxR [Cterm]	Forward			Escherichia coli	2668
BBa_K1486009	CxpR & Split IFP1.4 [Nterm + Nterm]	Forward			Escherichia coli	3726
BBa_K780000	Terminator for Bacillus subtilis					54
BBa_K864501	T22, P22 late terminator	Forward				42
BBa_K864600	T0 (21 imm) transcriptional terminator	Forward	0.97			52
BBa_K864601	Lambda t1 transcriptional terminator	Forward	0.97			53

Bidirectional terminators

*More...*
Name	Description	Direction	Efficiency Fwd. Rev.		Length
BBa_B0011	LuxICDABEG (+/-)	Bidirectional	0.419[CC]/0.95[JK]	0.636[CC]/0.86[JK]	46
BBa_B0014	double terminator (B0012-B0011)	Bidirectional	0.604[CC]/0.96[JK]	0.86[JK]	95
BBa_B0021	LuxICDABEG (+/-), reversed	Bidirectional	0.636[CC]/0.86[JK]	0.419[CC]/0.95[JK]	46
BBa_B0024	double terminator (B0012-B0011), reversed	Bidirectional	0.86[JK]	0.604[CC]/0.96[JK]	95
BBa_B0050	Terminator (pBR322, +/-)	Bidirectional			33
BBa_B0051	Terminator (yciA/tonA, +/-)	Bidirectional			35
BBa_B1001	Terminator (artifical, small, %T~=90)	Bidirectional	0.81[CH]		34
BBa_B1007	Terminator (artificial, large, %T~=80)	Bidirectional	0.83[CH]		40
BBa_B1008	Terminator (artificial, large, %T~=70)	Bidirectional			40
BBa_B1009	Terminator (artificial, large, %T~=40%)	Bidirectional			40
BBa_K187025	terminator in pAB, BioBytes plasmid				60
BBa_K259006	GFP-Terminator	Bidirectional	0.604[CC]/0.96[JK]	0.86[JK]	823

Reverse terminators

*More...*
Name	Description	Direction	Efficiency Fwd. Rev.		Length
BBa_B0020	Terminator (Reverse B0010)	Reverse			82
BBa_B0022	TE from coliphageT7, reversed	Reverse	-0.368[CC]	0.309[CC]	41
BBa_B0023	TE from coliphage T7, reversed	Reverse	-1.06[CC]	0.6[CC]	47
BBa_B0025	double terminator (B0015), reversed	Reverse	0.295[CC]/0.62[JK]	0.984[CC]/0.97[JK]	129
BBa_B0052	Terminator (rrnC)	Forward			41
BBa_B0060	Terminator (Reverse B0050)	Bidirectional			33
BBa_B0061	Terminator (Reverse B0051)	Bidirectional			35
BBa_B0063	Terminator (Reverse B0053)	Reverse			72

Yeast terminators

Here are all the yeast terminators available. As you can see, there are only a couple available, so please design, construct, and characterize new ones and submit them to the Registry!

*More...*
Name	Description	Direction	Chassis	Length
BBa_J63002	ADH1 terminator from S. cerevisiae	Forward		225
BBa_K110012	STE2 terminator	Forward		123
BBa_K1462070	cyc1			250
BBa_K1486025	ADH1 Terminator	Forward	Saccharomyces Cerevisiae	188
BBa_K2314608	Tmini is a very short terminator in yeast. It's only 68bp in length but has a good performance.			68
BBa_K2637012	ADH1 Terminator		S. cerevisiae	335
BBa_K2637014	TEF1 Terminator		S. cerevisiae	476
BBa_K2637016	PGK1 Terminator		S. cerevisiae	285
BBa_K2637017	CYC1 terminator			261
BBa_K3768004	CPS1 Terminator for S. cerevisiae			191
BBa_K392003	yeast ADH1 terminator			129
BBa_K4947020	Yeast terminator with I-SceI restriction site			50
BBa_K801011	TEF1 yeast terminator			507
BBa_K801012	ADH1 yeast terminator			349
BBa_Y1015	CycE1			252

Eukaryotic terminators

Here are all the eukaryotic, including yeast, terminators available. As you can see, there are only a handful available, so please design, construct, and characterize new ones and submit them to the Registry!

*More...*
Name	Description	Direction	Chassis	Length
BBa_J52016	eukaryotic -- derived from SV40 early poly A signal sequence	Forward		238
BBa_J63002	ADH1 terminator from S. cerevisiae	Forward		225
BBa_K110012	STE2 terminator	Forward		123
BBa_K1159307	35S Terminator of Cauliflower Mosaic Virus (CaMV)			217
BBa_K1462070	cyc1			250
BBa_K1484215	nopaline synthase terminator			293
BBa_K1486025	ADH1 Terminator	Forward	Saccharomyces Cerevisiae	188
BBa_K2314608	Tmini is a very short terminator in yeast. It's only 68bp in length but has a good performance.			68
BBa_K2637012	ADH1 Terminator		S. cerevisiae	335
BBa_K2637014	TEF1 Terminator		S. cerevisiae	476
BBa_K2637016	PGK1 Terminator		S. cerevisiae	285
BBa_K3758200	psbA 3-UTR (Nicotiana tabacum)			93
BBa_K392003	yeast ADH1 terminator			129
BBa_K404108	hGH terminator			481
BBa_K404116	hGH_[AAV2]-right-ITR			632
BBa_K4213000	Plant Thiamine Pyrophosphate Riboswitch			675
BBa_K4235020	SV40 poly(A) signal		Spodoptera Frugiperda	135
BBa_K4947020	Yeast terminator with I-SceI restriction site			50
BBa_K678012	SV40 poly A, terminator for mammalian cells			139
BBa_K678018	hGH poly A, terminator for mammalian cells			635
BBa_K678019	BGH poly A, mammalian terminator			233
BBa_K678036	trpC terminator for Aspergillus nidulans			759
BBa_K678037	T1-motni, terminator for Aspergillus niger			1006
BBa_K678038	T2-motni, terminator for Aspergillus niger			990
BBa_K678039	T3-motni, terminator for Aspergillus niger			889
BBa_K801011	TEF1 yeast terminator			507
BBa_K801012	ADH1 yeast terminator			349
BBa_Y1015	CycE1			252

Single terminators

*More...*
Name	Description	Type	Created by	length	uses	seq
BBa_B0010	T1 from E. coli rrnB	Terminator	Randy Rettberg	80	1064	. . . tttatctgttgtttgtcggtgaacgctctc
BBa_B0011	LuxICDABEG (+/-)	Terminator	Reshma Shetty	46	94	. . . cagattattaatccggcttttttattattt
BBa_B0012	TE from coliphageT7	Terminator	Reshma Shetty	41	1021	. . . caccttcgggtgggcctttctgcgtttata
BBa_B0013	TE from coliphage T7 (+/-)	Terminator	Reshma Shetty	47	19	. . . caccttcgggtgggcctttttgcgtttata
BBa_B0016	Terminator (T7 RNAP specific, T_Phi)	Terminator	Sri Kosuri	48	69	. . . gcctctaaacgggtcttgaggggttttttg
BBa_B0020	Terminator (Reverse B0010)	Terminator	Caitlin Conboy	82	2	. . . ctgagcctttcgttttatttgatgcctggt
BBa_B0021	LuxICDABEG (+/-), reversed	Terminator	Caitlin Conboy	46	9	. . . ggattaataatctggctttttatattctct
BBa_B0022	TE from coliphageT7, reversed	Terminator	Caitlin Conboy	41	1	. . . aaaggcccacccgaaggtgagccagtgtga
BBa_B0023	TE from coliphage T7, reversed	Terminator	Caitlin Conboy	47	2	. . . ccacccgaaggtgagccagtttgatttttt
BBa_B0050	Terminator (pBR322, +/-)	Terminator	Caitlin Conboy	33	1	. . . aaaaggatctcaagaagatcctttgatttt
BBa_B0051	Terminator (yciA/tonA, +/-)	Terminator	Caitlin Conboy	35		. . . caaaagcctccgaccggaggcttttgactt
BBa_B0052	Terminator (rrnC)	Terminator	Caitlin Conboy	41	1	. . . ttagcgaaagctaaggattttttttatctg
BBa_B0053	Terminator (His)	Terminator	Caitlin Conboy	72	52	. . . tctttaaaaccgaaaagattacttcgcgtt
BBa_B0054	Transcriptional terminator	Terminator	Reshma Shetty	69	25	. . . actaaaacttcccttggggttatcattggg
BBa_B0055	-- No description --	Terminator	Reshma Shetty	78	23	. . . aggtgagccagtgagttgattgctacgtaa
BBa_B0060	Terminator (Reverse B0050)	Terminator	Caitlin Conboy	33		. . . atcaaaggatcttcttgagatccttttttt
BBa_B0061	Terminator (Reverse B0051)	Terminator	Caitlin Conboy	35		. . . aaaagcctccggtcggaggcttttgacttt
BBa_B0062	Terminator (Reverse B0052)	Terminator	Caitlin Conboy	41	28	. . . aatccttagctttcgctaaggatgatttct
BBa_B0063	Terminator (Reverse B0053)	Terminator	Caitlin Conboy	72		. . . tggtgacaccttgcccgtttttttgccgga
BBa_B1001	Terminator (artifical, small, %T~=90)	Terminator	Haiyao Huang	34	20	. . . aaaaaccccgcttcggcggggttttttttt
BBa_B1002	Terminator (artificial, small, %T~=85%)	Terminator	Haiyao Huang	34	63	. . . aaaaaccccgcttcggcggggttttttcgc
BBa_B1003	Terminator (artificial, small, %T~=80)	Terminator	Haiyao Huang	34	9	. . . aaaaaccccgcttcggcggggtttttccgc
BBa_B1004	Terminator (artificial, small, %T~=55)	Terminator	Haiyao Huang	34	6	. . . gaaaaccccgcttcggcggggttttgccgc
BBa_B1005	Terminator (artificial, small, %T~=25%	Terminator	Haiyao Huang	34	6	. . . gcaaaccccgcttcggcggggtttcgccgc
BBa_B1006	Terminator (artificial, large, %T~>90)	Terminator	Haiyao Huang	39	221	. . . ccccgcccctgacagggcggggtttttttt
BBa_B1007	Terminator (artificial, large, %T~=80)	Terminator	Haiyao Huang	40	9	. . . cccgcccctgacagggcggggttttttcgc
BBa_B1008	Terminator (artificial, large, %T~=70)	Terminator	Haiyao Huang	40	2	. . . cccgcccctgacagggcggggtttttccgc
BBa_B1009	Terminator (artificial, large, %T~=40%)	Terminator	Haiyao Huang	40	3	. . . cccgcccctgacagggcggggttttgccgc
BBa_B1010	Terninator (artificial, large, %T~<10)	Terminator	Haiyao Huang	40	10	. . . cccgcccctgacagggcggggtttcgccgc
BBa_C0440	Terminator (bgl)	Terminator	T. Senthil	124	2	. . . ttttttttggagttttgccgcaaagcggta
BBa_I51003	-- No description --	Terminator	Drew Endy	110		. . . catgctgactgactgactgatcggcgatcg
BBa_J18913	T7 terminator (incl. STOP)	Terminator	Raik Gruenberg	135	26	. . . ttttgctgaaaggaggaactatatccggat
BBa_J52016	eukaryotic -- derived from SV40 early poly A signal sequence	Terminator	Monika Ciglic	238	4	. . . agacaatagcaggcatgctggggatatgca
BBa_J61048	[rnpB-T1] Terminator	Terminator	John Anderson	113	59	. . . gactgtccacgacgctatacccaaaagaaa
BBa_J63002	ADH1 terminator from S. cerevisiae	Terminator	Caroline Ajo-Franklin	225	67	. . . atgccgagcaaatgcctgcaaatcgctccc
BBa_K110012	STE2 terminator	Terminator	James DiCarlo	123		. . . ataaaaaaaaatggtatctttcttatttga
BBa_K187025	terminator in pAB, BioBytes plasmid	Terminator	Julia Pon	60		. . . ctgacagggcggggttttttttctgcagtg
BBa_K3568009	rrnB T1 and T2 transcriptional terminators	Terminator	MENG XU	158	-1	. . . cgaaaggctcagtcgaaagactgggccttt
BBa_K392003	yeast ADH1 terminator	Terminator	Tadashi Nakamura, Shuhei Yasumoto, Takahiro Saka, Saya Kakuda	129	26	. . . ctattactagagcccgccgccaccatggag
BBa_K404108	hGH terminator	Terminator	Freiburg Bioware 2010	481	22	. . . cgtgaaccactgctcccttccctgtccttt
BBa_K404116	hGH_[AAV2]-right-ITR	Project	Freiburg Bioware 2010	632		. . . agtgagcgagcgagcgcgcagctgcctgca
BBa_K4841006	L3S2P21 T	Terminator	Dai Yuchen	61	-1	. . . gaggcctcttttctggaatttggtaccgag
BBa_K629005	trkD, a functional Kup (formerly TrkD) system took up Cs+ with a moderate rate and affinity	Coding	Zilong WANG, Yi ZHENG	1869	1	. . . atcgaactgggtactcaggtcgaaatctaa
BBa_K678012	SV40 poly A, terminator for mammalian cells	Terminator	DTU-Denmark-2	139	4	. . . caaactcatcaatgtatcttatcatgtctg
BBa_K678018	hGH poly A, terminator for mammalian cells	Terminator	DTU-Denmark-2	635	2	. . . gcgttgggtccactcagtagatgcctgttg
BBa_K678019	BGH poly A, mammalian terminator	Terminator	DTU-Denmark-2	233	12	. . . ggcatgctggggatgcggtgggctctatgg
BBa_K678036	trpC terminator for Aspergillus nidulans	Terminator	DTU-Denmark-2	759	7	. . . tagaagtcctcgtgtactgtgtaagcgccc
BBa_K678037	T1-motni, terminator for Aspergillus niger	Terminator	DTU-Denmark-2	1006	2	. . . actttcgagtatattggcatcagacgtcgc
BBa_K678038	T2-motni, terminator for Aspergillus niger	Terminator	DTU-Denmark-2	990	1	. . . taaccggttttaaagttatccggggtcatg
BBa_K678039	T3-motni, terminator for Aspergillus niger	Terminator	DTU-Denmark-2	889	1	. . . tgtagaagaggtaggtaggtaggaattaca
BBa_K731722	T1 terminator from E. coli rrnB	Terminator	Anna Depetris, Giacomo Giacomelli	79	3	. . . ttttatctgttgtttgtcggtgaacgctct
BBa_K780000	Terminator for Bacillus subtilis	Terminator	Nikodem Latocha	54		. . . ctgaaatagctgcgcttttttgtgtcataa
BBa_K801011	TEF1 yeast terminator	Terminator	Georg Sch�tzinger	507	3	. . . caaatactttgagcggcgctatctgtaatg
BBa_K801012	ADH1 yeast terminator	Terminator	Georg Sch�tzinger	349	55	. . . accggccggtcgaaattcccctaccctatg
BBa_K809005	Terminator of Yeast mitochondrial gene COX3	Terminator	Xiaopeng Xu	49	5	. . . ccgcgaagcgggaactaataataatataat
BBa_K809006	Terminator of Yeast mitochondrial gene Q0255	Terminator	Xiaopeng Xu	65	1	. . . cggaacccccgagaggagttattatattta
BBa_K864501	T22, P22 late terminator	Terminator	Erik Gullberg	42		. . . gagtttaaccgctcggggctttttgcgttt
BBa_K864600	T0 (21 imm) transcriptional terminator	Terminator	Erik Lundin	52	6	. . . cacaccgggcgttttttctttgtgagtcca
BBa_K864601	Lambda t1 transcriptional terminator	Terminator	Erik Lundin	53	7	. . . gtgatttttgtcttcttgcgctaatttttt
BBa_Y1015	CycE1	Terminator	Samantha Sutton	252		. . . tgggacgctcgaaggctttaatttgcggcc

_

@@ Line 1: / Line 1: @@
 Test page for creating new terminator catalog pages
+<html>
+<ul class="menu">
+  <li><a href="/home" class="active"><span>Home</span></a></li>
+  <li><a href="/services"><span>Services</span></a></li>
+  <li><a href="/about"><span>About</span></a></li>
+  <li><a href="www.igem.org"><span>igem</span></a></li>
+</ul>
+</html>
 [[Terminators|< Back to Terminators]]