Difference between revisions of "Terminators/test"
(2 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
Test page for creating new terminator catalog pages | Test page for creating new terminator catalog pages | ||
+ | <html> | ||
+ | <style type="text/css"> | ||
+ | |||
+ | table { | ||
+ | color: #333; | ||
+ | font-family: Helvetica, Arial, sans-serif; | ||
+ | width: 640px; | ||
+ | border-collapse: | ||
+ | collapse; border-spacing: 0; | ||
+ | } | ||
+ | |||
+ | td, th { | ||
+ | border: 1px solid transparent; /* No more visible border */ | ||
+ | height: 30px; | ||
+ | transition: all 0.3s; /* Simple transition for hover effect */ | ||
+ | } | ||
+ | |||
+ | th { | ||
+ | background: #333; color: #FFF; /* Darken header a bit */ | ||
+ | font-weight: bold; | ||
+ | } | ||
+ | |||
+ | td { | ||
+ | background: #FAFAFA; | ||
+ | text-align: center; | ||
+ | } | ||
+ | |||
+ | /* Cells in even rows (2,4,6...) are one color */ | ||
+ | tr:nth-child(even) td { background: #F1F1F1; } | ||
+ | |||
+ | /* Cells in odd rows (1,3,5...) are another (excludes header cells) */ | ||
+ | tr:nth-child(odd) td { background: #FEFEFE; } | ||
+ | |||
+ | tr td:hover { background: #666; color: #FFF; } /* Hover cell effect! */ - See more at: http://cssmenumaker.com/blog/stylish-css-tables-tutorial#sthash.hi0gO0x2.dpuf | ||
+ | </style> | ||
+ | |||
+ | <div class="type2"> | ||
+ | <table> | ||
+ | <tr> | ||
+ | <th>One</th> | ||
+ | <th>Two</th> | ||
+ | <th>Three</th> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Apples</td> | ||
+ | <td>Carrots</td> | ||
+ | <td>Steak</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Oranges</td> | ||
+ | <td>Potato</td> | ||
+ | <td>Pork</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>Pears</td> | ||
+ | <td>Peas</td> | ||
+ | <td>Chicken</td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | </div> | ||
+ | </html> | ||
+ | |||
+ | |||
[[Terminators|< Back to Terminators]] | [[Terminators|< Back to Terminators]] |
Latest revision as of 22:34, 27 February 2013
Test page for creating new terminator catalog pages
One | Two | Three |
---|---|---|
Apples | Carrots | Steak |
Oranges | Potato | Pork |
Pears | Peas | Chicken |
Forward terminators | Bidirectional terminators | Reverse terminators | Yeast terminators | Eukaryotic terminators | Help! |
Contents
E. coli terminators
There are several E. coli transcriptional terminators available via the Registry. The most commonly used type of terminator is a forward terminator. When placed downstream of a genetic part that is usually transcribed, a forward transcriptional terminator will cause transcription to abort. However, in general, most transcriptional terminators will not terminate transcription with 100% efficiency. Some RNA polymerases will continue transcribing "through" a transcriptional terminator.
There are also bidirectional transcriptional terminators. Such terminators will usually cause transcription to terminate on both the forward and reverse strand. Again, however, the efficiency of transcriptional termination is not 100% and will often differ in the forward and reverse direction.
Finally, there are also reverse transcriptional terminators that terminate transcription on the reverse strand only.
Forward terminators
Name | Description | Direction | Efficiency Fwd. Rev. | Chassis | Length | |
---|---|---|---|---|---|---|
BBa_B0010 | T1 from E. coli rrnB | Forward | 80 | |||
BBa_B0012 | TE from coliphageT7 | Forward | 0.309[CC] | -0.368[CC] | 41 | |
BBa_B0013 | TE from coliphage T7 (+/-) | Forward | 0.6[CC] | -1.06[CC] | 47 | |
BBa_B0015 | double terminator (B0010-B0012) | Forward | 0.984[CC] 0.97[JK] | 0.295[CC] 0.62[JK] | E.coli | 129 |
BBa_B0017 | double terminator (B0010-B0010) | Forward | 168 | |||
BBa_B0053 | Terminator (His) | Forward | 72 | |||
BBa_B0055 | -- No description -- | 78 | ||||
BBa_B1002 | Terminator (artificial, small, %T~=85%) | Forward | 0.98[CH] | 34 | ||
BBa_B1003 | Terminator (artificial, small, %T~=80) | Forward | 0.83[CH] | 34 | ||
BBa_B1004 | Terminator (artificial, small, %T~=55) | Forward | 0.93[CH] | 34 | ||
BBa_B1005 | Terminator (artificial, small, %T~=25% | Forward | 0.86[CH] | 34 | ||
BBa_B1006 | Terminator (artificial, large, %T~>90) | Forward | 0.99[CH] | 39 | ||
BBa_B1010 | Terninator (artificial, large, %T~<10) | Forward | 0.95[CH] | 40 | ||
BBa_I11013 | Modification of biobricks part BBa_B0015 | 129 | ||||
BBa_I51003 | -- No description -- | 110 | ||||
BBa_J61048 | [rnpB-T1] Terminator | Forward | 0.98[JCA] | 113 | ||
BBa_K1392970 | Terminator+Tetr Promoter+T4 Endolysin | 623 | ||||
BBa_K1486001 | Arabinose promoter + CpxR | Forward | Escherichia coli | 1924 | ||
BBa_K1486005 | Arabinose promoter + sfGFP-CpxR [Cterm] | Forward | Escherichia coli | 2668 | ||
BBa_K1486009 | CxpR & Split IFP1.4 [Nterm + Nterm] | Forward | Escherichia coli | 3726 | ||
BBa_K780000 | Terminator for Bacillus subtilis | 54 | ||||
BBa_K864501 | T22, P22 late terminator | Forward | 42 | |||
BBa_K864600 | T0 (21 imm) transcriptional terminator | Forward | 0.97 | 52 | ||
BBa_K864601 | Lambda t1 transcriptional terminator | Forward | 0.97 | 53 |
Bidirectional terminators
Name | Description | Direction | Efficiency Fwd. Rev. | Chassis | Length | |
---|---|---|---|---|---|---|
BBa_B0011 | LuxICDABEG (+/-) | Bidirectional | 0.419[CC]/0.95[JK] | 0.636[CC]/0.86[JK] | 46 | |
BBa_B0014 | double terminator (B0012-B0011) | Bidirectional | 0.604[CC]/0.96[JK] | 0.86[JK] | 95 | |
BBa_B0021 | LuxICDABEG (+/-), reversed | Bidirectional | 0.636[CC]/0.86[JK] | 0.419[CC]/0.95[JK] | 46 | |
BBa_B0024 | double terminator (B0012-B0011), reversed | Bidirectional | 0.86[JK] | 0.604[CC]/0.96[JK] | 95 | |
BBa_B0050 | Terminator (pBR322, +/-) | Bidirectional | 33 | |||
BBa_B0051 | Terminator (yciA/tonA, +/-) | Bidirectional | 35 | |||
BBa_B1001 | Terminator (artifical, small, %T~=90) | Bidirectional | 0.81[CH] | 34 | ||
BBa_B1007 | Terminator (artificial, large, %T~=80) | Bidirectional | 0.83[CH] | 40 | ||
BBa_B1008 | Terminator (artificial, large, %T~=70) | Bidirectional | 40 | |||
BBa_B1009 | Terminator (artificial, large, %T~=40%) | Bidirectional | 40 | |||
BBa_K187025 | terminator in pAB, BioBytes plasmid | 60 | ||||
BBa_K259006 | GFP-Terminator | Bidirectional | 0.604[CC]/0.96[JK] | 0.86[JK] | 823 |
Reverse terminators
Name | Description | Direction | Efficiency Fwd. Rev. | Chassis | Length | |
---|---|---|---|---|---|---|
BBa_B0020 | Terminator (Reverse B0010) | Reverse | 82 | |||
BBa_B0022 | TE from coliphageT7, reversed | Reverse | -0.368[CC] | 0.309[CC] | 41 | |
BBa_B0023 | TE from coliphage T7, reversed | Reverse | -1.06[CC] | 0.6[CC] | 47 | |
BBa_B0025 | double terminator (B0015), reversed | Reverse | 0.295[CC]/0.62[JK] | 0.984[CC]/0.97[JK] | 129 | |
BBa_B0052 | Terminator (rrnC) | Forward | 41 | |||
BBa_B0060 | Terminator (Reverse B0050) | Bidirectional | 33 | |||
BBa_B0061 | Terminator (Reverse B0051) | Bidirectional | 35 | |||
BBa_B0063 | Terminator (Reverse B0053) | Reverse | 72 |
Yeast terminators
Here are all the yeast terminators available. As you can see, there are only a couple available, so please design, construct, and characterize new ones and submit them to the Registry!
Name | Description | Direction | Efficiency Fwd. Rev. | Chassis | Length | |
---|---|---|---|---|---|---|
BBa_J63002 | ADH1 terminator from S. cerevisiae | Forward | 225 | |||
BBa_K110012 | STE2 terminator | Forward | 123 | |||
BBa_K1462070 | cyc1 | 250 | ||||
BBa_K1486025 | ADH1 Terminator | Forward | Saccharomyces Cerevisiae | 188 | ||
BBa_K2314608 | Tmini is a very short terminator in yeast. It's only 68bp in length but has a good performance. | 68 | ||||
BBa_K2637012 | ADH1 Terminator | S. cerevisiae | 335 | |||
BBa_K2637014 | TEF1 Terminator | S. cerevisiae | 476 | |||
BBa_K2637016 | PGK1 Terminator | S. cerevisiae | 285 | |||
BBa_K2637017 | CYC1 terminator | 261 | ||||
BBa_K3768004 | CPS1 Terminator for S. cerevisiae | 191 | ||||
BBa_K392003 | yeast ADH1 terminator | 129 | ||||
BBa_K4947020 | Yeast terminator with I-SceI restriction site | 50 | ||||
BBa_K801011 | TEF1 yeast terminator | 507 | ||||
BBa_K801012 | ADH1 yeast terminator | 349 | ||||
BBa_Y1015 | CycE1 | 252 |
Eukaryotic terminators
Here are all the eukaryotic, including yeast, terminators available. As you can see, there are only a handful available, so please design, construct, and characterize new ones and submit them to the Registry!
Name | Description | Direction | Efficiency Fwd. Rev. | Chassis | Length | |
---|---|---|---|---|---|---|
BBa_J52016 | eukaryotic -- derived from SV40 early poly A signal sequence | Forward | 238 | |||
BBa_J63002 | ADH1 terminator from S. cerevisiae | Forward | 225 | |||
BBa_K110012 | STE2 terminator | Forward | 123 | |||
BBa_K1159307 | 35S Terminator of Cauliflower Mosaic Virus (CaMV) | 217 | ||||
BBa_K1462070 | cyc1 | 250 | ||||
BBa_K1484215 | nopaline synthase terminator | 293 | ||||
BBa_K1486025 | ADH1 Terminator | Forward | Saccharomyces Cerevisiae | 188 | ||
BBa_K2314608 | Tmini is a very short terminator in yeast. It's only 68bp in length but has a good performance. | 68 | ||||
BBa_K2637012 | ADH1 Terminator | S. cerevisiae | 335 | |||
BBa_K2637014 | TEF1 Terminator | S. cerevisiae | 476 | |||
BBa_K2637016 | PGK1 Terminator | S. cerevisiae | 285 | |||
BBa_K3758200 | psbA 3-UTR (Nicotiana tabacum) | 93 | ||||
BBa_K392003 | yeast ADH1 terminator | 129 | ||||
BBa_K404108 | hGH terminator | 481 | ||||
BBa_K404116 | hGH_[AAV2]-right-ITR | 632 | ||||
BBa_K4213000 | Plant Thiamine Pyrophosphate Riboswitch | 675 | ||||
BBa_K4235020 | SV40 poly(A) signal | Spodoptera Frugiperda | 135 | |||
BBa_K4947020 | Yeast terminator with I-SceI restriction site | 50 | ||||
BBa_K678012 | SV40 poly A, terminator for mammalian cells | 139 | ||||
BBa_K678018 | hGH poly A, terminator for mammalian cells | 635 | ||||
BBa_K678019 | BGH poly A, mammalian terminator | 233 | ||||
BBa_K678036 | trpC terminator for Aspergillus nidulans | 759 | ||||
BBa_K678037 | T1-motni, terminator for Aspergillus niger | 1006 | ||||
BBa_K678038 | T2-motni, terminator for Aspergillus niger | 990 | ||||
BBa_K678039 | T3-motni, terminator for Aspergillus niger | 889 | ||||
BBa_K801011 | TEF1 yeast terminator | 507 | ||||
BBa_K801012 | ADH1 yeast terminator | 349 | ||||
BBa_Y1015 | CycE1 | 252 |
Single terminators
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_B0010 | T1 from E. coli rrnB | Terminator | Randy Rettberg | 80 | 1064 | . . . tttatctgttgtttgtcggtgaacgctctc |
BBa_B0011 | LuxICDABEG (+/-) | Terminator | Reshma Shetty | 46 | 94 | . . . cagattattaatccggcttttttattattt |
BBa_B0012 | TE from coliphageT7 | Terminator | Reshma Shetty | 41 | 1021 | . . . caccttcgggtgggcctttctgcgtttata |
BBa_B0013 | TE from coliphage T7 (+/-) | Terminator | Reshma Shetty | 47 | 19 | . . . caccttcgggtgggcctttttgcgtttata |
BBa_B0016 | Terminator (T7 RNAP specific, T_Phi) | Terminator | Sri Kosuri | 48 | 69 | . . . gcctctaaacgggtcttgaggggttttttg |
BBa_B0020 | Terminator (Reverse B0010) | Terminator | Caitlin Conboy | 82 | 2 | . . . ctgagcctttcgttttatttgatgcctggt |
BBa_B0021 | LuxICDABEG (+/-), reversed | Terminator | Caitlin Conboy | 46 | 9 | . . . ggattaataatctggctttttatattctct |
BBa_B0022 | TE from coliphageT7, reversed | Terminator | Caitlin Conboy | 41 | 1 | . . . aaaggcccacccgaaggtgagccagtgtga |
BBa_B0023 | TE from coliphage T7, reversed | Terminator | Caitlin Conboy | 47 | 2 | . . . ccacccgaaggtgagccagtttgatttttt |
BBa_B0050 | Terminator (pBR322, +/-) | Terminator | Caitlin Conboy | 33 | 1 | . . . aaaaggatctcaagaagatcctttgatttt |
BBa_B0051 | Terminator (yciA/tonA, +/-) | Terminator | Caitlin Conboy | 35 | . . . caaaagcctccgaccggaggcttttgactt | |
BBa_B0052 | Terminator (rrnC) | Terminator | Caitlin Conboy | 41 | 1 | . . . ttagcgaaagctaaggattttttttatctg |
BBa_B0053 | Terminator (His) | Terminator | Caitlin Conboy | 72 | 52 | . . . tctttaaaaccgaaaagattacttcgcgtt |
BBa_B0054 | Transcriptional terminator | Terminator | Reshma Shetty | 69 | 25 | . . . actaaaacttcccttggggttatcattggg |
BBa_B0055 | -- No description -- | Terminator | Reshma Shetty | 78 | 23 | . . . aggtgagccagtgagttgattgctacgtaa |
BBa_B0060 | Terminator (Reverse B0050) | Terminator | Caitlin Conboy | 33 | . . . atcaaaggatcttcttgagatccttttttt | |
BBa_B0061 | Terminator (Reverse B0051) | Terminator | Caitlin Conboy | 35 | . . . aaaagcctccggtcggaggcttttgacttt | |
BBa_B0062 | Terminator (Reverse B0052) | Terminator | Caitlin Conboy | 41 | 28 | . . . aatccttagctttcgctaaggatgatttct |
BBa_B0063 | Terminator (Reverse B0053) | Terminator | Caitlin Conboy | 72 | . . . tggtgacaccttgcccgtttttttgccgga | |
BBa_B1001 | Terminator (artifical, small, %T~=90) | Terminator | Haiyao Huang | 34 | 20 | . . . aaaaaccccgcttcggcggggttttttttt |
BBa_B1002 | Terminator (artificial, small, %T~=85%) | Terminator | Haiyao Huang | 34 | 63 | . . . aaaaaccccgcttcggcggggttttttcgc |
BBa_B1003 | Terminator (artificial, small, %T~=80) | Terminator | Haiyao Huang | 34 | 9 | . . . aaaaaccccgcttcggcggggtttttccgc |
BBa_B1004 | Terminator (artificial, small, %T~=55) | Terminator | Haiyao Huang | 34 | 6 | . . . gaaaaccccgcttcggcggggttttgccgc |
BBa_B1005 | Terminator (artificial, small, %T~=25% | Terminator | Haiyao Huang | 34 | 6 | . . . gcaaaccccgcttcggcggggtttcgccgc |
BBa_B1006 | Terminator (artificial, large, %T~>90) | Terminator | Haiyao Huang | 39 | 221 | . . . ccccgcccctgacagggcggggtttttttt |
BBa_B1007 | Terminator (artificial, large, %T~=80) | Terminator | Haiyao Huang | 40 | 9 | . . . cccgcccctgacagggcggggttttttcgc |
BBa_B1008 | Terminator (artificial, large, %T~=70) | Terminator | Haiyao Huang | 40 | 2 | . . . cccgcccctgacagggcggggtttttccgc |
BBa_B1009 | Terminator (artificial, large, %T~=40%) | Terminator | Haiyao Huang | 40 | 3 | . . . cccgcccctgacagggcggggttttgccgc |
BBa_B1010 | Terninator (artificial, large, %T~<10) | Terminator | Haiyao Huang | 40 | 10 | . . . cccgcccctgacagggcggggtttcgccgc |
BBa_C0440 | Terminator (bgl) | Terminator | T. Senthil | 124 | 2 | . . . ttttttttggagttttgccgcaaagcggta |
BBa_I51003 | -- No description -- | Terminator | Drew Endy | 110 | . . . catgctgactgactgactgatcggcgatcg | |
BBa_J18913 | T7 terminator (incl. STOP) | Terminator | Raik Gruenberg | 135 | 26 | . . . ttttgctgaaaggaggaactatatccggat |
BBa_J52016 | eukaryotic -- derived from SV40 early poly A signal sequence | Terminator | Monika Ciglic | 238 | 4 | . . . agacaatagcaggcatgctggggatatgca |
BBa_J61048 | [rnpB-T1] Terminator | Terminator | John Anderson | 113 | 59 | . . . gactgtccacgacgctatacccaaaagaaa |
BBa_J63002 | ADH1 terminator from S. cerevisiae | Terminator | Caroline Ajo-Franklin | 225 | 67 | . . . atgccgagcaaatgcctgcaaatcgctccc |
BBa_K110012 | STE2 terminator | Terminator | James DiCarlo | 123 | . . . ataaaaaaaaatggtatctttcttatttga | |
BBa_K187025 | terminator in pAB, BioBytes plasmid | Terminator | Julia Pon | 60 | . . . ctgacagggcggggttttttttctgcagtg | |
BBa_K3568009 | rrnB T1 and T2 transcriptional terminators | Terminator | MENG XU | 158 | -1 | . . . cgaaaggctcagtcgaaagactgggccttt |
BBa_K392003 | yeast ADH1 terminator | Terminator | Tadashi Nakamura, Shuhei Yasumoto, Takahiro Saka, Saya Kakuda | 129 | 26 | . . . ctattactagagcccgccgccaccatggag |
BBa_K404108 | hGH terminator | Terminator | Freiburg Bioware 2010 | 481 | 22 | . . . cgtgaaccactgctcccttccctgtccttt |
BBa_K404116 | hGH_[AAV2]-right-ITR | Project | Freiburg Bioware 2010 | 632 | . . . agtgagcgagcgagcgcgcagctgcctgca | |
BBa_K4841006 | L3S2P21 T | Terminator | Dai Yuchen | 61 | -1 | . . . gaggcctcttttctggaatttggtaccgag |
BBa_K629005 | trkD, a functional Kup (formerly TrkD) system took up Cs+ with a moderate rate and affinity | Coding | Zilong WANG, Yi ZHENG | 1869 | 1 | . . . atcgaactgggtactcaggtcgaaatctaa |
BBa_K678012 | SV40 poly A, terminator for mammalian cells | Terminator | DTU-Denmark-2 | 139 | 4 | . . . caaactcatcaatgtatcttatcatgtctg |
BBa_K678018 | hGH poly A, terminator for mammalian cells | Terminator | DTU-Denmark-2 | 635 | 2 | . . . gcgttgggtccactcagtagatgcctgttg |
BBa_K678019 | BGH poly A, mammalian terminator | Terminator | DTU-Denmark-2 | 233 | 12 | . . . ggcatgctggggatgcggtgggctctatgg |
BBa_K678036 | trpC terminator for Aspergillus nidulans | Terminator | DTU-Denmark-2 | 759 | 7 | . . . tagaagtcctcgtgtactgtgtaagcgccc |
BBa_K678037 | T1-motni, terminator for Aspergillus niger | Terminator | DTU-Denmark-2 | 1006 | 2 | . . . actttcgagtatattggcatcagacgtcgc |
BBa_K678038 | T2-motni, terminator for Aspergillus niger | Terminator | DTU-Denmark-2 | 990 | 1 | . . . taaccggttttaaagttatccggggtcatg |
BBa_K678039 | T3-motni, terminator for Aspergillus niger | Terminator | DTU-Denmark-2 | 889 | 1 | . . . tgtagaagaggtaggtaggtaggaattaca |
BBa_K731722 | T1 terminator from E. coli rrnB | Terminator | Anna Depetris, Giacomo Giacomelli | 79 | 3 | . . . ttttatctgttgtttgtcggtgaacgctct |
BBa_K780000 | Terminator for Bacillus subtilis | Terminator | Nikodem Latocha | 54 | . . . ctgaaatagctgcgcttttttgtgtcataa | |
BBa_K801011 | TEF1 yeast terminator | Terminator | Georg Schützinger | 507 | 3 | . . . caaatactttgagcggcgctatctgtaatg |
BBa_K801012 | ADH1 yeast terminator | Terminator | Georg Schützinger | 349 | 55 | . . . accggccggtcgaaattcccctaccctatg |
BBa_K809005 | Terminator of Yeast mitochondrial gene COX3 | Terminator | Xiaopeng Xu | 49 | 5 | . . . ccgcgaagcgggaactaataataatataat |
BBa_K809006 | Terminator of Yeast mitochondrial gene Q0255 | Terminator | Xiaopeng Xu | 65 | 1 | . . . cggaacccccgagaggagttattatattta |
BBa_K864501 | T22, P22 late terminator | Terminator | Erik Gullberg | 42 | . . . gagtttaaccgctcggggctttttgcgttt | |
BBa_K864600 | T0 (21 imm) transcriptional terminator | Terminator | Erik Lundin | 52 | 6 | . . . cacaccgggcgttttttctttgtgagtcca |
BBa_K864601 | Lambda t1 transcriptional terminator | Terminator | Erik Lundin | 53 | 7 | . . . gtgatttttgtcttcttgcgctaatttttt |
BBa_Y1015 | CycE1 | Terminator | Samantha Sutton | 252 | . . . tgggacgctcgaaggctttaatttgcggcc |
_