DNA/Aptamer
Nucleic acid aptamers are single- or double-stranded DNA or RNA sequences than can bind specifically to molecular targets including but not limited to small molecules, proteins, and organims. Aptamers offer a popular platform for generating specific and high affinity ligands, because large aptamer populations can be randomly generated via chemical synthesis, screened for binding through in vitro selection, and amplified/diversified by polymerase chain reaction Ellington,Gold. Nanomolar dissociation constants can readily be obtained for molecular targets. Nucleic acid aptamers are best suited for molecules such as basic proteins. Nonpolar molecular targets offer a far more difficult target for aptamers, because the nucleic acid phosphate backbone is negatively charged.
One of the most popular methods for obtaining specific and high affinity aptamers to a particular molecular target is systematic evolution of ligands by exponential enrichment (SELEX) Gold. SELEX involves iterative cycles of aptamer selection and amplification, either with or without intentional random point mutagenesis. David Liu's group has also published on another technique for identifying specific and high affinity aptamers through nonhomologous random recombination (NRR) that may offer even better results than SELEX Bittker.
Andy Ellington's lab at the University of Texas at Austin maintains a database of published nucleic acid aptamer sequences at http://aptamer.icmb.utexas.edu/.
Several DNA aptamer parts from the published literature have been entered into the Registry. All DNA aptamer parts are listed here.
| Name | Description | SS or DS | Target | Affinity | Sequence | Length |
|---|---|---|---|---|---|---|
| BBa_J36853 | T50 linkaptamer | . . . gcaatgataggcatatttatacggctcgga | 65 | |||
| BBa_J36854 | T35 linkaptamer | . . . gtatggaaaggattagcaatgataggcata | 50 | |||
| BBa_J36855 | T20 linkaptamer | . . . gtgtggttggaagtagtatggaaaggatta | 35 | |||
| BBa_J36856 | S50 linkaptamer | . . . tatgcctatcattgctaatcctttccatac | 90 | |||
| BBa_J36857 | S35 linkaptamer | . . . tatgcctatcattgctaatcctttccatac | 75 | |||
| BBa_J36858 | S20 linkaptamer | . . . tgtctcacagtttgctaatcctttccatac | 60 | |||
| BBa_J36859 | A15 adaptamer | . . . gtgtggttggaagtaatgtagaatggaaag | 98 | |||
| BBa_K1330000 | Spinach2.1 flanked by tRNALys3 | . . . tccagggttcaagtccctgttcgggcgcca | 168 | |||
| BBa_K1614009 | software generated kanamycin aptamer (candidate 1) | ttctctc | 7 | |||
| BBa_K1614013 | software generated kanamycin aptamer (candidate 2) | cggggat | 7 | |||
| BBa_K1636000 | Lead-II-ions-specific aptamer | gggtgggtgggtgggt | 16 | |||
| BBa_K2027049 | PQQ Aptamer #1 (15ADa9) | . . . ctaccctgatttgtaggatcgaggtaatcc | 100 | |||
| BBa_K2027050 | PQQ Aptamer #2 (15ADb11) | . . . tagggcacgctgtgtggatcgaggtaatcc | 100 | |||
| BBa_K3593000 | ssDNA, aptamer for α-amanitin(Best 1) | . . . ttttggtattgaggaacatgcgtcgcaaac | 80 | |||
| BBa_K3593007 | ssDNA, aptamer for β-amanitin | . . . gccccactgagaggaacatgcgtcgcaaac | 80 | |||
| BBa_K3724001 | IL-6 aptamer | . . . gcagatatgggccagcacagaatgaggccc | 57 | |||
| BBa_K3724005 | Lactoferrin Aptamer | . . . tatcgtaccctttatgctagattgtcctgc | 59 | |||
| BBa_K4213000 | Plant Thiamine Pyrophosphate Riboswitch | . . . tacagccataaaagaagtctttaactcgct | 675 | |||
| BBa_K4391000 | E. coli ATCC 25922 Aptamer | . . . ggggggtcatcgggatacctggtaaggata | 78 | |||
| BBa_K4391001 | Penicillin G Aptamer | . . . gtttttacgcctcagaagacacgcccgaca | 98 | |||
| BBa_K4391002 | Salmonella typhimurium Aptamer | . . . aaagatatgtgcgtctacctcttgactaat | 87 | |||
| BBa_K4391003 | ToxR Aptamer | . . . ctcatgttattttatgttttttgagaagat | 70 | |||
| BBa_K4983000 | selective aptamer sequence for deltamethrin identification and binding | . . . aggacagcgcgggaggttagcacgcggaat | 53 | |||
| BBa_K5334000 | A14#1 aptamer for Bevacizumab | gcggttggtggtagttacgttcgc | 24 | |||
| BBa_K5334001 | CU2#1 aptamer for Bevacizumab | gcgtttggtggtagttacgttcgc | 24 | |||
| BBa_K5334002 | CU2#2 aptamer for Bevacizumab | gcgcttggtggtagttacgttcgc | 24 | |||
| BBa_K5334003 | CU2#3 aptamer for Bevacizumab | gcgattggtggtagttacgttcgc | 24 | |||
| BBa_K5334004 | CU2#4 aptamer for Bevacizumab | gcgggtggtggtagttacgttcgc | 24 | |||
| BBa_K5334005 | CU2#5 aptamer for Bevacizumab | gcggctggtggtagttacgttcgc | 24 | |||
| BBa_K5334006 | CU2#6 aptamer for Bevacizumab | gcggatggtggtagttacgttcgc | 24 | |||
| BBa_K5334007 | CU2#7 aptamer for Bevacizumab | gcggtgggtggtagttacgttcgc | 24 | |||
| BBa_K5334008 | CU2#8 aptamer for Bevacizumab | gcggtcggtggtagttacgttcgc | 24 | |||
| BBa_K5334009 | CU2#9 aptamer for Bevacizumab | gcggtaggtggtagttacgttcgc | 24 | |||
| BBa_K5334010 | CU2#10 aptamer for Bevacizumab | gcggttggtgggagttacgttcgc | 24 | |||
| BBa_K5334011 | CU2#11 aptamer for Bevacizumab | gcggttggtggcagttacgttcgc | 24 | |||
| BBa_K5334012 | CU2#12 aptamer for Bevacizumab | gcggttggtggaagttacgttcgc | 24 | |||
| BBa_K5334013 | CU2#13 aptamer for Bevacizumab | gcggttggtggtagttaggttcgc | 24 | |||
| BBa_K5334014 | CU2#14 aptamer for Bevacizumab | gcggttggtggtagttatgttcgc | 24 | |||
| BBa_K5334015 | CU2#15 aptamer for Bevacizumab | gcggttggtggtagttaagttcgc | 24 | |||
| BBa_K5334016 | CU2#16 aptamer for Bevacizumab | gcggttggtggtagttaccttcgc | 24 | |||
| BBa_K5334017 | CU2#17 aptamer for Bevacizumab | gcggttggtggtagttactttcgc | 24 | |||
| BBa_K5334018 | CU2#18 aptamer for Bevacizumab | gcggttggtggtagttacattcgc | 24 | |||
| BBa_K5334019 | CU2#19 aptamer for Bevacizumab | gcggttggtggtagttacggtcgc | 24 | |||
| BBa_K5334020 | CU2#20 aptamer for Bevacizumab | gcggttggtggtagttacgctcgc | 24 | |||
| BBa_K5334021 | CU2#21 aptamer for Bevacizumab | gcggttggtggtagttacgatcgc | 24 | |||
| BBa_K5334022 | CU2#22 aptamer for Bevacizumab | gcggttggtggtagttacgtgcgc | 24 | |||
| BBa_K5334023 | CU2#23 aptamer for Bevacizumab | gcggttggtggtagttacgtccgc | 24 | |||
| BBa_K5334024 | CU2#24 aptamer for Bevacizumab | gcggttggtggtagttacgtacgc | 24 |
References
<biblio>
- Ellington pmid=1697402
- Gold pmid=2200121
- Bock pmid=1741036
- Bittker pmid=12219078
</biblio>