DNA/Aptamer

< Back to DNA parts

Nucleic acid aptamers are single- or double-stranded DNA or RNA sequences than can bind specifically to molecular targets including but not limited to small molecules, proteins, and organims. Aptamers offer a popular platform for generating specific and high affinity ligands, because large aptamer populations can be randomly generated via chemical synthesis, screened for binding through in vitro selection, and amplified/diversified by polymerase chain reaction Ellington,Gold. Nanomolar dissociation constants can readily be obtained for molecular targets. Nucleic acid aptamers are best suited for molecules such as basic proteins. Nonpolar molecular targets offer a far more difficult target for aptamers, because the nucleic acid phosphate backbone is negatively charged.

One of the most popular methods for obtaining specific and high affinity aptamers to a particular molecular target is systematic evolution of ligands by exponential enrichment (SELEX) Gold. SELEX involves iterative cycles of aptamer selection and amplification, either with or without intentional random point mutagenesis. David Liu's group has also published on another technique for identifying specific and high affinity aptamers through nonhomologous random recombination (NRR) that may offer even better results than SELEX Bittker.

Andy Ellington's lab at the University of Texas at Austin maintains a database of published nucleic acid aptamer sequences at http://aptamer.icmb.utexas.edu/.

Several DNA aptamer parts from the published literature have been entered into the Registry. All DNA aptamer parts are listed here.


More...
NameDescriptionSS or DSTargetAffinitySequenceLength
BBa_J36853T50 linkaptamer   . . . gcaatgataggcatatttatacggctcgga65
BBa_J36854T35 linkaptamer   . . . gtatggaaaggattagcaatgataggcata50
BBa_J36855T20 linkaptamer   . . . gtgtggttggaagtagtatggaaaggatta35
BBa_J36856S50 linkaptamer   . . . tatgcctatcattgctaatcctttccatac90
BBa_J36857S35 linkaptamer   . . . tatgcctatcattgctaatcctttccatac75
BBa_J36858S20 linkaptamer   . . . tgtctcacagtttgctaatcctttccatac60
BBa_J36859A15 adaptamer   . . . gtgtggttggaagtaatgtagaatggaaag98
BBa_K1330000Spinach2.1 flanked by tRNALys3   . . . tccagggttcaagtccctgttcgggcgcca168
BBa_K1614009software generated kanamycin aptamer (candidate 1)  ttctctc7
BBa_K1614013software generated kanamycin aptamer (candidate 2)  cggggat7
BBa_K1636000Lead-II-ions-specific aptamer  gggtgggtgggtgggt16
BBa_K2027049PQQ Aptamer #1 (15ADa9)   . . . ctaccctgatttgtaggatcgaggtaatcc100
BBa_K2027050PQQ Aptamer #2 (15ADb11)   . . . tagggcacgctgtgtggatcgaggtaatcc100
BBa_K3593000ssDNA, aptamer for α-amanitin(Best 1)   . . . ttttggtattgaggaacatgcgtcgcaaac80
BBa_K3593007ssDNA, aptamer for β-amanitin   . . . gccccactgagaggaacatgcgtcgcaaac80
BBa_K3724001IL-6 aptamer   . . . gcagatatgggccagcacagaatgaggccc57
BBa_K3724005Lactoferrin Aptamer   . . . tatcgtaccctttatgctagattgtcctgc59
BBa_K4213000Plant Thiamine Pyrophosphate Riboswitch   . . . tacagccataaaagaagtctttaactcgct675
BBa_K4391000E. coli ATCC 25922 Aptamer   . . . ggggggtcatcgggatacctggtaaggata78
BBa_K4391001Penicillin G Aptamer   . . . gtttttacgcctcagaagacacgcccgaca98
BBa_K4391002Salmonella typhimurium Aptamer   . . . aaagatatgtgcgtctacctcttgactaat87
BBa_K4391003ToxR Aptamer   . . . ctcatgttattttatgttttttgagaagat70
BBa_K4983000selective aptamer sequence for deltamethrin identification and binding   . . . aggacagcgcgggaggttagcacgcggaat53


References

<biblio>

  1. Ellington pmid=1697402
  2. Gold pmid=2200121
  3. Bock pmid=1741036
  4. Bittker pmid=12219078

</biblio>