Collections/Uppsala Chromoproteins
Chromoproteins are often responsible for coloration in corals or sea anemones. The expressed pigment can be seen by the naked eye and without any external tool, making them very useful as reporter proteins.
The [http://2011.igem.org/Team:Uppsala-Sweden 2011 Uppsala iGEM team] centered their iGEM project around a library of reporter proteins with a focus on chromproteins. The [http://2012.igem.org/Team:Uppsala_University 2012] and [http://2013.igem.org/Team:Uppsala 2013 teams], while having very different projects, continued the previous year's work alongside their projects. This has resulted in a large collection of chromoproteins, most of which have sequence confirmed samples, and can be found in the yearly distribution kits.
The following table contains their chromoprotein collection, focusing on the CDS and RBS+CDS parts.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K1033250 | mCherry fusion protein codon optimised for Lactobacillus reuteri | Reporter | Anders Edlund | 711 | . . . actggaggaatggatgaactttacaaataa | |
| BBa_K1033901 | meffBlue, blue chromoprotein (incl RBS) | Reporter | Erik Gullberg | 708 | 1 | . . . atcgcacgcaagccggtggtcgcctaataa |
| BBa_K1033902 | meffBlue, blue chromoprotein | Coding | Erik Gullberg | 669 | 1 | . . . atcgcacgcaagccggtggtcgcctaataa |
| BBa_K1033905 | tsPurple, purple chromoprotein (incl RBS) | Reporter | Erik Gullberg | 708 | 2 | . . . agcgatgtgccggaaaaagcgacgtaataa |
| BBa_K1033906 | tsPurple, purple chromoprotein | Coding | Sabri Jamal | 690 | 17 | . . . agcgatgtgccggaaaaagcgacgtaataa |
| BBa_K1033909 | fwYellow, yellow chromoprotein (incl RBS) | Reporter | Erik Gullberg | 732 | 2 | . . . gcagttgacctggagacgtaccgttaataa |
| BBa_K1033910 | fwYellow, yellow chromoprotein | Coding | Sabri Jamal | 714 | 11 | . . . gcagttgacctggagacgtaccgttaataa |
| BBa_K1033913 | scOrange, orange chromoprotein (incl. RBS) | Reporter | Erik Gullberg | 717 | . . . gctccgagcaaactgggtcaccattaataa | |
| BBa_K1033915 | amajLime, yellow-green chromoprotein (incl RBS) | Reporter | Erik Gullberg | 711 | 1 | . . . cacatcacctcggtcgtgccgttctaataa |
| BBa_K1033916 | amajLime, yellow-green chromoprotein | Coding | Sabri Jamal | 693 | 10 | . . . cacatcacctcggtcgtgccgttctaataa |
| BBa_K1033918 | gfasPurple, purple chromoprotein (incl RBS) | Reporter | Erik Gullberg | 687 | . . . atcgcgcgcaaatcggtggttgcctaataa | |
| BBa_K1033919 | gfasPurple, purple chromoprotein | Coding | Sabri Jamal | 669 | 5 | . . . atcgcgcgcaaatcggtggttgcctaataa |
| BBa_K1033922 | meffRed, red chromoprotein (incl RBS) | Reporter | Erik Gullberg | 726 | 3 | . . . atcgcttaccgcagcaccctgtcttaataa |
| BBa_K1033925 | spisPink, pink chromoprotein (incl RBS) | Reporter | Erik Lundin | 697 | 9 | . . . gctgttgcccgtgtgctggaagtgtaataa |
| BBa_K1033927 | asPink, pink chromoprotein (incl RBS) | Reporter | Erik Lundin | 720 | 7 | . . . gcaccgagcaagctgggtcataattaataa |
| BBa_K1033929 | aeBlue, blue chromoprotein (incl RBS) | Reporter | Erik Lundin | 717 | 8 | . . . gcaccgagtaaattagggcatcactaataa |
| BBa_K1033930 | amilCP, blue/purple chromoprotein (incl RBS) | Reporter | Erik Lundin | 687 | 9 | . . . attgcacgcaaacctgtggtcgcctaataa |
| BBa_K1033931 | amilGFP, yellow chromoprotein (incl RBS) | Reporter | Erik Lundin | 717 | 10 | . . . catgttaaccctttgaaggttaaataataa |
| BBa_K1033932 | spisPink, pink chromoprotein | Coding | Erik Lundin | 678 | 5 | . . . gctgttgcccgtgtgctggaagtgtaataa |
| BBa_K1033933 | asPink, pink chromoprotein | Coding | Erik Lundin | 702 | 6 | . . . gcaccgagcaagctgggtcataattaataa |
| BBa_K1073023 | Chromoprotein eforRed with RBS | Intermediate | iGEM Team Braunschweig 2013 | 700 | 2 | . . . catttctcaccgctgccgaaggctctccca |
| BBa_K2455005 | CPP-mTag BFP | Coding | Jon Fugl | 786 | . . . ttcttacatcatcaccatcaccattaataa | |
| BBa_K5527001 | amilCP purple, Purple chromoprotein | Coding | Otto Isaksson | 669 | -1 | . . . attgcacgcaaacctgtggtcgcctaataa |
| BBa_K5527002 | amilCP yellow, Yellow chromoprotein | Coding | Otto Isaksson | 669 | -1 | . . . attgcacgcaaacctgtggtcgcctaataa |
| BBa_K5527003 | amilCP light purple, Light purple chromoprotein | Coding | Otto Isaksson | 669 | -1 | . . . attgcacgcaaacctgtggtcgcctaataa |
| BBa_K592009 | amilCP, blue chromoprotein | Coding | Lei Sun | 669 | 99 | . . . attgcacgcaaacctgtggtcgcctaataa |
| BBa_K592010 | amilGFP, yellow chromoprotein | Coding | Lei Sun | 699 | 27 | . . . catgttaaccctttgaaggttaaataataa |
| BBa_K592011 | cjBlue, green chromoprotein | Coding | Antonio Ascue Avalos | 702 | 14 | . . . tgcccgagcaaacttggtcataattaataa |
| BBa_K592012 | eforRed, red chromoprotein | Coding | Lei Sun | 681 | 22 | . . . catttctcaccgctgccgaaggctctccca |
| BBa_K592023 | B0032-BFP | Reporter | Lei Sun | 724 | 6 | . . . agcaagctgggtcataaactgaattaataa |
| BBa_K592024 | B0034-BFP | Reporter | Lei Sun | 723 | 3 | . . . agcaagctgggtcataaactgaattaataa |
| BBa_K592025 | B0034-amilCP | Reporter | Lei Sun | 687 | 14 | . . . attgcacgcaaacctgtggtcgcctaataa |
| BBa_K592100 | Blue Fluorescent Protein (mTagBFP) | Coding | Erik Gullberg | 705 | 41 | . . . agcaagctgggtcataaactgaattaataa |
| BBa_K592101 | Yellow Fluorescent Protein (YFP) | Coding | Erik Lundin | 720 | 5 | . . . catggcatggatgaactatacaaataataa |
| BBa_K864100 | Super Yellow Fluorescent Protein 2 (SYFP2) | Coding | Erik Gullberg | 723 | 8 | . . . ctgggtatggatgagctgtataaataataa |
| BBa_K864101 | B0032-SYFP2 | Composite | Arvid Hedén Gynnå | 742 | 2 | . . . ctgggtatggatgagctgtataaataataa |
| BBa_K864102 | B0034-SYFP2 | Composite | Arvid Hedén Gynnå | 741 | . . . ctgggtatggatgagctgtataaataataa | |
| BBa_K864401 | aeBlue blue chromoprotein | Coding | Erik Lundin | 699 | 8 | . . . gcaccgagtaaattagggcatcactaataa |