Collections/Uppsala Chromoproteins

Chromoproteins are often responsible for coloration in corals or sea anemones. The expressed pigment can be seen by the naked eye and without any external tool, making them very useful as reporter proteins.

AmilCP amilGFP RFP.jpg Pellets BYR.jpg A16 UU.jpg


The [http://2011.igem.org/Team:Uppsala-Sweden 2011 Uppsala iGEM team] centered their iGEM project around a library of reporter proteins with a focus on chromproteins. The [http://2012.igem.org/Team:Uppsala_University 2012] and [http://2013.igem.org/Team:Uppsala 2013 teams], while having very different projects, continued the previous year's work alongside their projects. This has resulted in a large collection of chromoproteins, most of which have sequence confirmed samples, and can be found in the yearly distribution kits.


The following table contains their chromoprotein collection, focusing on the CDS and RBS+CDS parts.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1033250mCherry fusion protein codon optimised for Lactobacillus reuteriReporterAnders Edlund711  . . . actggaggaatggatgaactttacaaataa
BBa_K1033901meffBlue, blue chromoprotein (incl RBS)ReporterErik Gullberg7081 . . . atcgcacgcaagccggtggtcgcctaataa
BBa_K1033902meffBlue, blue chromoproteinCodingErik Gullberg6691 . . . atcgcacgcaagccggtggtcgcctaataa
BBa_K1033905tsPurple, purple chromoprotein (incl RBS)ReporterErik Gullberg7082 . . . agcgatgtgccggaaaaagcgacgtaataa
BBa_K1033906tsPurple, purple chromoproteinCodingSabri Jamal 69017 . . . agcgatgtgccggaaaaagcgacgtaataa
BBa_K1033909fwYellow, yellow chromoprotein (incl RBS)ReporterErik Gullberg7322 . . . gcagttgacctggagacgtaccgttaataa
BBa_K1033910fwYellow, yellow chromoproteinCodingSabri Jamal71411 . . . gcagttgacctggagacgtaccgttaataa
BBa_K1033913scOrange, orange chromoprotein (incl. RBS)ReporterErik Gullberg717  . . . gctccgagcaaactgggtcaccattaataa
BBa_K1033915amajLime, yellow-green chromoprotein (incl RBS)ReporterErik Gullberg7111 . . . cacatcacctcggtcgtgccgttctaataa
BBa_K1033916amajLime, yellow-green chromoproteinCodingSabri Jamal 69310 . . . cacatcacctcggtcgtgccgttctaataa
BBa_K1033918gfasPurple, purple chromoprotein (incl RBS)ReporterErik Gullberg687  . . . atcgcgcgcaaatcggtggttgcctaataa
BBa_K1033919gfasPurple, purple chromoproteinCodingSabri Jamal 6695 . . . atcgcgcgcaaatcggtggttgcctaataa
BBa_K1033922meffRed, red chromoprotein (incl RBS)ReporterErik Gullberg7263 . . . atcgcttaccgcagcaccctgtcttaataa
BBa_K1033925spisPink, pink chromoprotein (incl RBS)ReporterErik Lundin6979 . . . gctgttgcccgtgtgctggaagtgtaataa
BBa_K1033927asPink, pink chromoprotein (incl RBS)ReporterErik Lundin7207 . . . gcaccgagcaagctgggtcataattaataa
BBa_K1033929aeBlue, blue chromoprotein (incl RBS)ReporterErik Lundin7178 . . . gcaccgagtaaattagggcatcactaataa
BBa_K1033930amilCP, blue/purple chromoprotein (incl RBS)ReporterErik Lundin6879 . . . attgcacgcaaacctgtggtcgcctaataa
BBa_K1033931amilGFP, yellow chromoprotein (incl RBS)ReporterErik Lundin71710 . . . catgttaaccctttgaaggttaaataataa
BBa_K1033932spisPink, pink chromoproteinCodingErik Lundin6785 . . . gctgttgcccgtgtgctggaagtgtaataa
BBa_K1033933asPink, pink chromoproteinCodingErik Lundin7026 . . . gcaccgagcaagctgggtcataattaataa
BBa_K1073023Chromoprotein eforRed with RBSIntermediateiGEM Team Braunschweig 20137002 . . . catttctcaccgctgccgaaggctctccca
BBa_K2455005CPP-mTag BFPCodingJon Fugl786  . . . ttcttacatcatcaccatcaccattaataa
BBa_K592009amilCP, blue chromoproteinCodingLei Sun66999 . . . attgcacgcaaacctgtggtcgcctaataa
BBa_K592010amilGFP, yellow chromoproteinCodingLei Sun69927 . . . catgttaaccctttgaaggttaaataataa
BBa_K592011cjBlue, green chromoproteinCodingAntonio Ascue Avalos70214 . . . tgcccgagcaaacttggtcataattaataa
BBa_K592012eforRed, red chromoprotein CodingLei Sun68122 . . . catttctcaccgctgccgaaggctctccca
BBa_K592023B0032-BFPReporterLei Sun7246 . . . agcaagctgggtcataaactgaattaataa
BBa_K592024B0034-BFPReporterLei Sun7233 . . . agcaagctgggtcataaactgaattaataa
BBa_K592025B0034-amilCPReporterLei Sun68714 . . . attgcacgcaaacctgtggtcgcctaataa
BBa_K592100Blue Fluorescent Protein (mTagBFP)CodingErik Gullberg70541 . . . agcaagctgggtcataaactgaattaataa
BBa_K592101Yellow Fluorescent Protein (YFP)CodingErik Lundin7205 . . . catggcatggatgaactatacaaataataa
BBa_K864100Super Yellow Fluorescent Protein 2 (SYFP2)CodingErik Gullberg7238 . . . ctgggtatggatgagctgtataaataataa
BBa_K864101B0032-SYFP2CompositeArvid Hedén Gynnå7422 . . . ctgggtatggatgagctgtataaataataa
BBa_K864102B0034-SYFP2CompositeArvid Hedén Gynnå741  . . . ctgggtatggatgagctgtataaataataa
BBa_K864401aeBlue blue chromoproteinCodingErik Lundin6998 . . . gcaccgagtaaattagggcatcactaataa