Promoters/Catalog/Phage
A collection of all phage promoters available from the registry. The promoters are often used for very high expression of a protein. These promoters work in E. coli and other chassis but typically require a particular RNA polymerase to be present.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I712074 | T7 promoter (strong promoter from T7 bacteriophage) | . . . agggaatacaagctacttgttctttttgca | 46 | 1938 | In stock | ||
| BBa_I719005 | T7 Promoter | taatacgactcactatagggaga | 23 | 7912 | In stock | ||
| BBa_J34814 | T7 Promoter | gaatttaatacgactcactatagggaga | 28 | 1190 | Not in stock | ||
| BBa_J64997 | T7 consensus -10 and rest | taatacgactcactatagg | 19 | 10154 | It's complicated | ||
| BBa_J64998 | consensus -10 and rest from SP6 | atttaggtgacactataga | 19 | 1155 | Not in stock | ||
| BBa_K113010 | overlapping T7 promoter | . . . gagtcgtattaatacgactcactatagggg | 40 | 1553 | It's complicated | ||
| BBa_K113011 | more overlapping T7 promoter | . . . agtgagtcgtactacgactcactatagggg | 37 | 1601 | It's complicated | ||
| BBa_K113012 | weaken overlapping T7 promoter | . . . gagtcgtattaatacgactctctatagggg | 40 | 1630 | It's complicated | ||
| BBa_K1614000 | T7 promoter for expression of functional RNA | taatacgactcactatag | 18 | 5219 | In stock | ||
| BBa_K2084000 | T3 Promoter | aattaaccctcactaaagggaga | 23 | 1348 | It's complicated | ||
| BBa_K2084004 | T3 Promoter with RBS site | . . . taaagggagatactagagaaagaggagaaa | 43 | 1484 | It's complicated | ||
| BBa_K3511008 | C62-T7 promoter | taatacgactcacaatcgcggag | 23 | Not in stock | |||
| BBa_K3633015 | T7 promoter | taatacgactcactatagg | 19 | It's complicated | |||
| BBa_K525998 | Promoter T7 and RBS | . . . atacgactcactatagggaaagaggagaaa | 32 | 3036 | In stock | ||
| BBa_R0085 | T7 Consensus Promoter Sequence | taatacgactcactatagggaga | 23 | 2072 | In stock | ||
| BBa_R0180 | T7 RNAP promoter | ttatacgactcactatagggaga | 23 | 1654 | Not in stock | ||
| BBa_R0181 | T7 RNAP promoter | gaatacgactcactatagggaga | 23 | 1651 | Not in stock | ||
| BBa_R0182 | T7 RNAP promoter | taatacgtctcactatagggaga | 23 | 1653 | Not in stock | ||
| BBa_R0183 | T7 RNAP promoter | tcatacgactcactatagggaga | 23 | 1653 | Not in stock | ||
| BBa_R0184 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1176 | Not in stock | ||
| BBa_R0185 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1888 | Not in stock | ||
| BBa_R0186 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1885 | Not in stock | ||
| BBa_R0187 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1885 | Not in stock | ||
| BBa_Z0251 | T7 strong promoter | . . . taatacgactcactatagggagaccacaac | 35 | 1887 | Not in stock | ||
| BBa_Z0252 | T7 weak binding and processivity | . . . taattgaactcactaaagggagaccacagc | 35 | 1667 | Not in stock | ||
| BBa_Z0253 | T7 weak binding promoter | . . . cgaagtaatacgactcactattagggaaga | 35 | 1400 | Not in stock |