Difference between revisions of "DNA/Assembly"

Line 79: Line 79:
  
 
<!-- To include a part in this table, include the categories "//DNA/origami" under the Hard Information tab of the part. -->
 
<!-- To include a part in this table, include the categories "//DNA/origami" under the Hard Information tab of the part. -->
 
__NOTOC__ __NOEDITSECTION__
 

Revision as of 11:52, 26 October 2008

< Back to DNA parts

BioBrick cloning sites

BioBrickprefix.png
To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site. The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site.
BioBricksuffix.png
Note that in most BioBrick plasmid backbones, the BioBrick prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information.


There are no parts for this table


Other cloning sites


More...
NameDescriptionSequenceLength
BBa_G00000BioBrick cloning site prefixgaattcgcggccgcttctagag22
BBa_G00001BioBrick cloning site suffixtactagtagcggccgctgcag21
BBa_I13450Removes BioBrick End . . . agagtaataaactgtgataatcaatgcatg74
BBa_I13452Adds another BioBrick site . . . agattagtcacacgcgatccattgcagtgg52
BBa_I13455Insertion site plus RNAse E cut site . . . taggtcttcgaatccgatccattgcagtgg78
BBa_I13456Insertion site plus RNAse E . . . taggtcttcgaatccgatccattgcagtgg55
BBa_I13457Improved insertion site with two RNAse E cut sites . . . tctctcgagagattagtacctttggagatc111
BBa_I732007BglII + BamHIgaagatcttccggatccgg19
BBa_J56011MCSIIttaattaaggaaggaaactagt22


BioBrick restriction enzyme sites


There are no parts for this table


Other restriction enzyme sites


More...
NameDescriptionSequenceLength
BBa_B0045NheI restriction enzyme site (XbaI, SpeI compatible overhang)gctagc6
BBa_B0046NsiI restriction enzyme site (PstI compatible overhang)atgcat6
BBa_B0047MfeI restriction enzyme site (EcoRI compatible overhang)caattg6
BBa_B0048AvrII restriction enzyme site (XbaI, SpeI compatible overhang)cctagg6
BBa_B0102SapI restriction enzyme site (offset cutter)gctcttct8
BBa_B0103SapI restriction enzyme site, reversed (offset cutter)atgtgaagagctg13
BBa_I11071KpnI restriction enzyme site with extra flanking nucleotidesatcggtaccgca12
BBa_I11072AclI restriction enzyme site with extra nucleotidesgcaaacgttcga12
BBa_I11073PvuI restriction enzyme site with extra flanking nucleotidesacacgatcggta12
BBa_I11074XmaI restriction enzyme site with extra flanking nucleotidesattcccgggtca12
BBa_I11075BmtI restriction enzyme site with extra flanking nucleotidescttgctagc9
BBa_I11076HindIII restriction enzyme site with extra flanking nucleotidestacaagcttct11
BBa_I11077SalI restriction enzyme site with extra flanking nucleotidesatcgtcgacgca12
BBa_I11078SacII restriction enzyme site with extra flanking nucleotidesgcaccgcggcga12
BBa_I11079MluI restriction enzyme site with flanking nucleotidesacaacgcgtgta12
BBa_I11080ApaI restriction site with extra flanking nucleotidescgtgggccctca12
BBa_I11081BamHI restriction site with extra flanking nucleotidescaaggatcc9
BBa_I11082XbaI restriction site with extra flanking nucleotidesggatctagacc11
BBa_K150008BamHI restriction enzyme siteggatcc6
BBa_K175002I-PpoI homing endonuclease sitectctcttaaggtagc15
BBa_K175027I-SceI restriction siteagttacgctagggataacagggtaatatag30
BBa_K259002BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ctagctcctcagtggcagcggtgaggaggc88
BBa_K259004BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . tatgtaagtagtaacaagtagcgtggggca81
BBa_K259008BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ggtatgtaagtagtacaagtagcgtggggc79
BBa_K259009BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . atgtaagtagtaacaagtagcgtggggcag82
BBa_K4816001napA primer forwardcagtcacatatgatgaccatctcgcggc28
BBa_K792013BamHI restriction site (standalone)ggatcc6
BBa_M31950HpaI restriction enzyme sitegtt3
BBa_M31952AatII restriction enzyme sitegacgtc6
BBa_M31953Acc65I restriction enzyme siteggtacc6
BBa_M31955ApaI restriction enzyme sitegggccc6
BBa_M31956AfeI restriction enzyme siteagcgct6
BBa_M31958AseI restriction enzyme siteattaat6
BBa_M31961BbvCI restriction enzyme sitecctcagc7
BBa_M31962BccI restriction enzyme siteccatc5
BBa_M31964BciVI restriction enzyme sitegtatcc6
BBa_M31965BclI restriction enzyme sitetgatca6
BBa_M31967BfaI restriction enzyme sitectag4
BBa_M31968BfuAI restriction enzyme siteacctgc6
BBa_M31982NotI restriction enzyme sitegcggccgc8
BBa_M31983EcoRI restriction enzyme sitegaattc6
BBa_M31984PspOMI restriction enzyme sitegggccc6
BBa_M31985BglII restriction enzyme siteagatct6
BBa_M31986EagI restriction enzyme sitecggccg6
BBa_M31987BclI restriction enzyme sitetgatca6
BBa_M31988MluI restriction enzyme siteacgcgt6
BBa_M31989BssHII restriction enzyme sitegcgcgc6
BBa_M31990AscI restriction enzyme siteggcgcgcc8
BBa_M31991XbaI restriction enzyme sitetctaga6
BBa_M31992SpeI restriction enzyme siteactagt6
BBa_M31995BsrGI restriction enzyme sitetgtaca6
BBa_M31996BsiWI restriction enzyme sitecgtacg6
BBa_M31997Acc65I restriction enzyme siteggtacc6


BioBrick scars


There are no parts for this table


Other scars


More...
NameDescriptionSequenceLength
BBa_B0104AvrII/XbaI mixed sitecctaga6
BBa_B0105RFC 25 Scar Sequenceaccggc6
BBa_G0000SpeI/XbaI scar for RBS-CDS junctionstactag6
BBa_G0001XbaI/SpeI mixed site, reversectctagta8
BBa_G0002SpeI/XbaI mixed sitetactagag8
BBa_G0003NheI/XbaI mixed sitegctagag7
BBa_G0004SpeI/NheI mixed sitetactagc7
BBa_G0005NheI/SpeI mixed sitegctagta7
BBa_G0006XbaI/NheI mixed sitectctagc7
BBa_K106015AarI "A" site scar sequenceatgctcgagggagct15
BBa_K106016AarI "B" site scar sequenceggtagttcccta12
BBa_K106017AarI "D" site scar sequencetgcgggatcctgagtaaataagcggccgc29
BBa_K112999BBb1 scar sequenceggatct6
BBa_K1319106RFC 25 Translation Start Scar Sequencetactagatggccggc15
BBa_K1319107RFC 25 Translation Stop Scar Sequenceaccggttaatactagag17
BBa_K245009RFC 37 Scar Sequencetccggc6


Primer binding sites

ForwardPrimerBindingSite.png
Primer binding sites are DNA sequences specifically designed for oligo annealing. For example, most BioBrick plasmid backbones include binding sites for the VF2 and VR primers.
ReversePrimerBindingSite.png


More...
NameDescriptionSequenceLength
BBa_G00000BioBrick cloning site prefixgaattcgcggccgcttctagag22
BBa_G00001BioBrick cloning site suffixtactagtagcggccgctgcag21
BBa_G00100Forward primer for sequencing/amplifying BioBrick parts (VF2)tgccacctgacgtctaagaa20
BBa_G00102Reverse BioBrick primer annealing site (VR binding site)gctcactcaaaggcggtaat20
BBa_K3464000Forward Primer for the detection of ancestral allele of the rs4149056tctgggtcatacatgtggatatatgt26
BBa_K3464001Forward Primer for the detection of alternative allele of the rs4149056tctgggtcatacatgtggatatatgc26
BBa_K3464002Reverse Primer for the detection of the rs4149056agcaaaggactattgaaagagtgaat26
BBa_K4816001napA primer forwardcagtcacatatgatgaccatctcgcggc28


Spacer


More...
NameDescriptionSequenceLength
BBa_B0040Spacer.1 (generic) . . . cttacctcttaagaggtcactgacctaaca70
BBa_K2483005sgRNA target site couples facing each other with 6 bp spacer . . . cgtctgtaatcgccctttgtacgtgaacgg850
BBa_K2483006sgRNA target site couples facing each other with 18 bp spacer . . . ttgaccgcggtcttcctccacattcctgtc955
BBa_K259002BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ctagctcctcagtggcagcggtgaggaggc88
BBa_K259004BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . tatgtaagtagtaacaagtagcgtggggca81
BBa_K259008BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . ggtatgtaagtagtacaagtagcgtggggc79
BBa_K259009BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker . . . atgtaagtagtaacaagtagcgtggggcag82
BBa_K3831010Spacer_0 . . . cttactctgttgaaaacgaatagataggtt40
BBa_K3831011Spacer_1tgctcgtagtttacc15
BBa_K3831012Spacer_5 . . . agaatagtcaatcttcggaaatcccaggtg40
BBa_K3831015Spacer_7taataaaaggtcccg15
BBa_K3831023Spacer 03aaggaacggttattt15
BBa_K3831026Spacer 02agattactactgata15
BBa_K3831027Spacer 06ccgattctgagacgg15
BBa_K3831028Spacer 04 . . . aatacaggacccgaatcgtttcagttgcct40
BBa_K3831038Spacer_SP1 . . . ttaccacggatacagacagtgataatctta40


Single nucleotides


More...
NameDescriptionSequenceLength
BBa_G0009The nucleotide Aa1
BBa_G0010The nucleotide Cc1
BBa_G0011The nucleotide Gg1
BBa_G0012The nucleotide Tt1
BBa_K1402010Lac Promoter . . . ccactagaaataattttgtttaactttaag79
BBa_K361001Message gene template . . . caagatagactaatagtcggatccctcgag438
BBa_K4105001DNAzyme . . . ttaggcccagtcctggcgccctctgtttga100
BBa_K4105002a region of mif23 gene . . . aatccgggtcaggaccgcgggagacaaact88
BBa_K649204lox2272 . . . cttcgtataggatactttatacgaagttat34
BBa_M34014Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana . . . ttttctttttgtttttaaataaatatttag2646


DNA origami parts


More...
NameDescriptionSequenceLength
BBa_J35000Rothemund DNA origami parttcctcttttgaggaacaagttttcttgt28
BBa_J35001fork hairpin . . . ccgcagttttctgcctcgttttcgaggggc32
BBa_J35002dumbbell hairpingcctcttttgaggcgcaagttttcttgc28
BBa_J350033-fingers arm . . . gcctcgttttcgagggagttttctccgggc44
BBa_J350044-fingers arm . . . gagttttctcctctggttttccagtcggcg63
BBa_J350055-fingers arm . . . gagttttctcctctggttttccagtcggcg76
BBa_J350066-fingers arm . . . gagttttctcctctggttttccagtcggcg89
BBa_J350077-fingers arm . . . gagttttctcctctggttttccagtcggcg102
BBa_J35120B-Z DNA switchertggacactaagctattcatc20
BBa_K1479005 -- No description -- aattccggaattccgg16