Difference between revisions of "Bacillus subtilis"

Line 10: Line 10:
 
</style>
 
</style>
 
</html>
 
</html>
 +
 +
==Plasmid backbone==
 +
 +
<parttable>bsubtilis_plasmid_backbone</parttable>
  
 
==Constitutive promoters==
 
==Constitutive promoters==

Revision as of 01:45, 13 December 2008

< Back to Registry

Bacillus subtilis is gram-positive model organism. Thus, much is known about this organism. The genome of Bacillus subtilis strain 168 has been sequenced.

Although the current part collection for B. subtilis is small, many are now using B. subtilis as a candidate host for synthetic devices and systems. Please read more about the advantages and disadvantages of using B. subtilis as a chassis.

Plasmid backbone


More...
NameDescriptionResistanceRepliconCopy
number
ChassisLength
BBa_I742123Multi-host vector pTG262 converted to BioBrick vectorCMulti-host Multi-host5564
BBa_J179000pBS1C: Bacillus subtilis vector, amyE integration, CAM-resistanceA(E. coli) C(B. subtilis)  B. subtilis + E. coli6105
BBa_J179001pBS2E: Bacillus subtilis vector, lacA integration, MLS resistanceA(E. coli) E(B. subtilis)  B. subtilis + E. coli6258
BBa_J179002pBs4S: Bacillus subtilis vector, thrC integration, spec resistanceA(E. coli) S(B. subtilis)pDG1731integrative in B. subtilisB. subtilis + E. coli4573
BBa_K090402B. subtilis Episomal Vector with Constitutive GFP     6337
BBa_K090403Gram-positive Shuttle Vector for Chromosomal Integration    5632
BBa_K1065204Efe+Bba_B0015 in BBa_K823024 (pXyl) A(E. coli) S(B. subtilis)  B. subtilis + E. coli6017
BBa_K1085014pSB1AC3-HySp: Integrational backbone into B. subtilis amyE locus with IPTG inducible promoter    7625
BBa_K1185004Integration vector for Bacillus subtilis derived from pSac-CmACmulti-host multi-host5210
BBa_K1364021Integrative plasmid for Bacillus subtilis (pSBbs4E)    5760
BBa_K818000Integration vector for Bacillus subtilis derived from pSac-CmACMulti host Multi host5223
BBa_K823021pSBBs1C-lacZ (lacZ reporter vector for B. subtilis)A(E. coli) C(B. subtilis)pAC6integrative in B. subtilisE.coli and B. subtilis9792
BBa_K823022pSBBs4S: Empty backbone for integration into Bacillus subtilis thrC locusA(E. coli) S(B. subtilis)pDG1731integrative in B. subtilisB. subtilis + E. coli4573
BBa_K823023pSBBs1C: Empty backbone for integration into Bacillus subtilis amyE locusA(E. coli) C(B. subtilis)  B. subtilis + E. coli6105
BBa_K823024pSBBs4S-Pxyl: Integrative expression vector for Bacillus subtilisA(E. coli) S(B. subtilis)  B. subtilis + E. coli4794
BBa_K823025pSBBs3C-luxABCDE (lux reporter vector for B.subtilis)A(E. coli) + C(B. subtilis)pAH328integrative in B. subtilisB. subtilis + E. coli10640
BBa_K823027pSBBs2E: Empty backbone for integration into Bacillus subtilis lacA locusA(E. coli) E(B. subtilis)  B. subtilis + E. coli6193

Constitutive promoters

ConstitutivePromoter.png

The promoters here are B. subtilis promoters that are constitutive meaning that the activity of these promoters should only be regulated by the levels of RNA polymerase and the appropriate σ factor.

The sequence of these promoter are adapted to the σ factor of B. subtilis. However, some of these promoter also works in E. coli. Generally speaking, standard E. coli promoters don't work (or are very weak) in B. subtilis strains, whereas the contrary generally works. However, it doesn't mean that the efficiency will be the same in both strains. The pVeg promoter, for instance, works fine at a high level of expression in both E. coli and B. subtilis strains - Contribution from User: Cyrpaut (31 October 2011)

Constitutive B. subtilis σA promoters

This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143012Promoter veg a constitutive promoter for B. subtilis . . . aaaaatgggctcgtgttgtacaataaatgt976561In stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock
BBa_K780003Strong constitutive promoter for Bacillus subtilis . . . aattgcagtaggcatgacaaaatggactca361559It's complicated
BBa_K823000PliaG . . . caagcttttcctttataatagaatgaatga1217765In stock
BBa_K823002PlepA . . . tctaagctagtgtattttgcgtttaatagt1577245In stock
BBa_K823003Pveg . . . aatgggctcgtgttgtacaataaatgtagt23714126In stock

Constitutive B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K143010Promoter ctc for B. subtilis . . . atccttatcgttatgggtattgtttgtaat564297Not in stock
BBa_K143011Promoter gsiB for B. subtilis . . . taaaagaattgtgagcgggaatacaacaac382765Not in stock
BBa_K143013Promoter 43 a constitutive promoter for B. subtilis . . . aaaaaaagcgcgcgattatgtaaaatataa5611873Not in stock

Positively regulated promoters

PositivePromoter.png

The B. subtilis promoters of this section is the ones that are said to be positively regulated. It means that meaning their expression level increase with the help of another third party protein called transcription activator (This category exclude the sigma factor protein itself). With the appropriate protein, you would be able to increase the activity of your promoter. Please read the description and characterization of each parts for more details.

Positively regulated B. subtilis σA promoters

This section lists the promoters recognized by B. subtilis σA RNA polymerase sub-unit. σA is the major B. subtilis sigma factor that is present under most growth conditions (but maximal during exponential growth phase).


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K090504Gram-Positive Strong Constitutive Promoter . . . acatgggaaaactgtatgtatttgatcctc2392275It's complicated

Positively regulated B. subtilis σB promoters

This section lists promoters that are recognized by B. subtilis σB RNA polymerase. σB is the polymerase subunit that is the most present during the stationary growth phase. You can use these promoters if you want your construct to be mostly expressed during stationary growth phase or under starvation conditions.


There are no parts for this table

Repressible promoters

NegativePromoter.png

The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI E. coli promoter.

In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a σA type contitutive promoter.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_K090501Gram-Positive IPTG-Inducible Promoter . . . tggaattgtgagcggataacaattaagctt1072054It's complicated
BBa_K143014Promoter Xyl for B.subtilis . . . agtttgtttaaacaacaaactaataggtga822112Not in stock
BBa_K143015Promoter hyper-spank for B. subtilis . . . aatgtgtgtaattgtgagcggataacaatt1012527Not in stock


In the future, we may also find promoters builded with the σB promoter.


There are no parts for this table

References

Given the number of available articles on B. subtilis, we only include some review articles here.

<biblio>

  1. Earl pmid=18467096
  2. Pavlendova pmid=18450217
  3. Sonenshein pmid=17982469
  4. Lopez pmid=17981078
  5. Aguilar pmid=17977783
  6. Irnov pmid=17381303

</biblio>