Difference between revisions of "DNA/Assembly"

Revision as of 07:20, 26 October 2008

BioBrick cloning sites

	To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site. The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site.
	Note that in most BioBrick plasmid backbones, the BioBrick prefix and suffix sequences are not adjacent to one another. Instead, the BioBrick prefix and suffix flank what is a called a default plasmid insert or default insert for short. There are several different default inserts available in the Registry. See default plasmid inserts for more information.

There are no parts for this table

Other cloning sites

*More...*
Name	Description	Sequence	Length
BBa_G00000	BioBrick cloning site prefix	gaattcgcggccgcttctagag	22
BBa_G00001	BioBrick cloning site suffix	tactagtagcggccgctgcag	21
BBa_I13450	Removes BioBrick End	. . . agagtaataaactgtgataatcaatgcatg	74
BBa_I13452	Adds another BioBrick site	. . . agattagtcacacgcgatccattgcagtgg	52
BBa_I13455	Insertion site plus RNAse E cut site	. . . taggtcttcgaatccgatccattgcagtgg	78
BBa_I13456	Insertion site plus RNAse E	. . . taggtcttcgaatccgatccattgcagtgg	55
BBa_I13457	Improved insertion site with two RNAse E cut sites	. . . tctctcgagagattagtacctttggagatc	111
BBa_I732007	BglII + BamHI	gaagatcttccggatccgg	19
BBa_J56011	MCSII	ttaattaaggaaggaaactagt	22

BioBrick restriction enzyme sites

There are no parts for this table

Other restriction enzyme sites

*More...*
Name	Description	Sequence	Length
BBa_B0045	NheI restriction enzyme site (XbaI, SpeI compatible overhang)	gctagc	6
BBa_B0046	NsiI restriction enzyme site (PstI compatible overhang)	atgcat	6
BBa_B0047	MfeI restriction enzyme site (EcoRI compatible overhang)	caattg	6
BBa_B0048	AvrII restriction enzyme site (XbaI, SpeI compatible overhang)	cctagg	6
BBa_B0102	SapI restriction enzyme site (offset cutter)	gctcttct	8
BBa_B0103	SapI restriction enzyme site, reversed (offset cutter)	atgtgaagagctg	13
BBa_I11071	KpnI restriction enzyme site with extra flanking nucleotides	atcggtaccgca	12
BBa_I11072	AclI restriction enzyme site with extra nucleotides	gcaaacgttcga	12
BBa_I11073	PvuI restriction enzyme site with extra flanking nucleotides	acacgatcggta	12
BBa_I11074	XmaI restriction enzyme site with extra flanking nucleotides	attcccgggtca	12
BBa_I11075	BmtI restriction enzyme site with extra flanking nucleotides	cttgctagc	9
BBa_I11076	HindIII restriction enzyme site with extra flanking nucleotides	tacaagcttct	11
BBa_I11077	SalI restriction enzyme site with extra flanking nucleotides	atcgtcgacgca	12
BBa_I11078	SacII restriction enzyme site with extra flanking nucleotides	gcaccgcggcga	12
BBa_I11079	MluI restriction enzyme site with flanking nucleotides	acaacgcgtgta	12
BBa_I11080	ApaI restriction site with extra flanking nucleotides	cgtgggccctca	12
BBa_I11081	BamHI restriction site with extra flanking nucleotides	caaggatcc	9
BBa_I11082	XbaI restriction site with extra flanking nucleotides	ggatctagacc	11
BBa_K150008	BamHI restriction enzyme site	ggatcc	6
BBa_K175002	I-PpoI homing endonuclease site	ctctcttaaggtagc	15
BBa_K175027	I-SceI restriction site	agttacgctagggataacagggtaatatag	30
BBa_K259002	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ctagctcctcagtggcagcggtgaggaggc	88
BBa_K259004	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . tatgtaagtagtaacaagtagcgtggggca	81
BBa_K259008	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ggtatgtaagtagtacaagtagcgtggggc	79
BBa_K259009	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . atgtaagtagtaacaagtagcgtggggcag	82
BBa_K4816001	napA primer forward	cagtcacatatgatgaccatctcgcggc	28
BBa_K792013	BamHI restriction site (standalone)	ggatcc	6
BBa_M31950	HpaI restriction enzyme site	gtt	3
BBa_M31952	AatII restriction enzyme site	gacgtc	6
BBa_M31953	Acc65I restriction enzyme site	ggtacc	6
BBa_M31955	ApaI restriction enzyme site	gggccc	6
BBa_M31956	AfeI restriction enzyme site	agcgct	6
BBa_M31958	AseI restriction enzyme site	attaat	6
BBa_M31961	BbvCI restriction enzyme site	cctcagc	7
BBa_M31962	BccI restriction enzyme site	ccatc	5
BBa_M31964	BciVI restriction enzyme site	gtatcc	6
BBa_M31965	BclI restriction enzyme site	tgatca	6
BBa_M31967	BfaI restriction enzyme site	ctag	4
BBa_M31968	BfuAI restriction enzyme site	acctgc	6
BBa_M31982	NotI restriction enzyme site	gcggccgc	8
BBa_M31983	EcoRI restriction enzyme site	gaattc	6
BBa_M31984	PspOMI restriction enzyme site	gggccc	6
BBa_M31985	BglII restriction enzyme site	agatct	6
BBa_M31986	EagI restriction enzyme site	cggccg	6
BBa_M31987	BclI restriction enzyme site	tgatca	6
BBa_M31988	MluI restriction enzyme site	acgcgt	6
BBa_M31989	BssHII restriction enzyme site	gcgcgc	6
BBa_M31990	AscI restriction enzyme site	ggcgcgcc	8
BBa_M31991	XbaI restriction enzyme site	tctaga	6
BBa_M31992	SpeI restriction enzyme site	actagt	6
BBa_M31995	BsrGI restriction enzyme site	tgtaca	6
BBa_M31996	BsiWI restriction enzyme site	cgtacg	6
BBa_M31997	Acc65I restriction enzyme site	ggtacc	6

BioBrick scars

There are no parts for this table

Other scars

*More...*
Name	Description	Sequence	Length
BBa_B0104	AvrII/XbaI mixed site	cctaga	6
BBa_B0105	RFC 25 Scar Sequence	accggc	6
BBa_G0000	SpeI/XbaI scar for RBS-CDS junctions	tactag	6
BBa_G0001	XbaI/SpeI mixed site, reverse	ctctagta	8
BBa_G0002	SpeI/XbaI mixed site	tactagag	8
BBa_G0003	NheI/XbaI mixed site	gctagag	7
BBa_G0004	SpeI/NheI mixed site	tactagc	7
BBa_G0005	NheI/SpeI mixed site	gctagta	7
BBa_G0006	XbaI/NheI mixed site	ctctagc	7
BBa_K106015	AarI "A" site scar sequence	atgctcgagggagct	15
BBa_K106016	AarI "B" site scar sequence	ggtagttcccta	12
BBa_K106017	AarI "D" site scar sequence	tgcgggatcctgagtaaataagcggccgc	29
BBa_K112999	BBb1 scar sequence	ggatct	6
BBa_K1319106	RFC 25 Translation Start Scar Sequence	tactagatggccggc	15
BBa_K1319107	RFC 25 Translation Stop Scar Sequence	accggttaatactagag	17
BBa_K245009	RFC 37 Scar Sequence	tccggc	6

Primer binding sites

	Primer binding sites are DNA sequences specifically designed for oligo annealing. For example, most BioBrick plasmid backbones include binding sites for the VF2 and VR primers.

*More...*
Name	Description	Sequence	Length
BBa_G00000	BioBrick cloning site prefix	gaattcgcggccgcttctagag	22
BBa_G00001	BioBrick cloning site suffix	tactagtagcggccgctgcag	21
BBa_G00100	Forward primer for sequencing/amplifying BioBrick parts (VF2)	tgccacctgacgtctaagaa	20
BBa_G00102	Reverse BioBrick primer annealing site (VR binding site)	gctcactcaaaggcggtaat	20
BBa_K3464000	Forward Primer for the detection of ancestral allele of the rs4149056	tctgggtcatacatgtggatatatgt	26
BBa_K3464001	Forward Primer for the detection of alternative allele of the rs4149056	tctgggtcatacatgtggatatatgc	26
BBa_K3464002	Reverse Primer for the detection of the rs4149056	agcaaaggactattgaaagagtgaat	26
BBa_K4816001	napA primer forward	cagtcacatatgatgaccatctcgcggc	28

Spacer

*More...*
Name	Description	Sequence	Length
BBa_B0040	Spacer.1 (generic)	. . . cttacctcttaagaggtcactgacctaaca	70
BBa_K2483005	sgRNA target site couples facing each other with 6 bp spacer	. . . cgtctgtaatcgccctttgtacgtgaacgg	850
BBa_K2483006	sgRNA target site couples facing each other with 18 bp spacer	. . . ttgaccgcggtcttcctccacattcctgtc	955
BBa_K259002	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ctagctcctcagtggcagcggtgaggaggc	88
BBa_K259004	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . tatgtaagtagtaacaagtagcgtggggca	81
BBa_K259008	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . ggtatgtaagtagtacaagtagcgtggggc	79
BBa_K259009	BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker	. . . atgtaagtagtaacaagtagcgtggggcag	82
BBa_K3831010	Spacer_0	. . . cttactctgttgaaaacgaatagataggtt	40
BBa_K3831011	Spacer_1	tgctcgtagtttacc	15
BBa_K3831012	Spacer_5	. . . agaatagtcaatcttcggaaatcccaggtg	40
BBa_K3831015	Spacer_7	taataaaaggtcccg	15
BBa_K3831023	Spacer 03	aaggaacggttattt	15
BBa_K3831026	Spacer 02	agattactactgata	15
BBa_K3831027	Spacer 06	ccgattctgagacgg	15
BBa_K3831028	Spacer 04	. . . aatacaggacccgaatcgtttcagttgcct	40
BBa_K3831038	Spacer_SP1	. . . ttaccacggatacagacagtgataatctta	40

Single nucleotides

*More...*
Name	Description	Sequence	Length
BBa_G0009	The nucleotide A	a	1
BBa_G0010	The nucleotide C	c	1
BBa_G0011	The nucleotide G	g	1
BBa_G0012	The nucleotide T	t	1
BBa_K1402010	Lac Promoter	. . . ccactagaaataattttgtttaactttaag	79
BBa_K361001	Message gene template	. . . caagatagactaatagtcggatccctcgag	438
BBa_K4105001	DNAzyme	. . . ttaggcccagtcctggcgccctctgtttga	100
BBa_K4105002	a region of mif23 gene	. . . aatccgggtcaggaccgcgggagacaaact	88
BBa_K649204	lox2272	. . . cttcgtataggatactttatacgaagttat	34
BBa_M34014	Nucleotide sequence of a cDNA clone of saxiphilin from the liver of Rana Catesbeiana	. . . ttttctttttgtttttaaataaatatttag	2646

DNA origami parts

*More...*
Name	Description	Sequence	Length
BBa_J35000	Rothemund DNA origami part	tcctcttttgaggaacaagttttcttgt	28
BBa_J35001	fork hairpin	. . . ccgcagttttctgcctcgttttcgaggggc	32
BBa_J35002	dumbbell hairpin	gcctcttttgaggcgcaagttttcttgc	28
BBa_J35003	3-fingers arm	. . . gcctcgttttcgagggagttttctccgggc	44
BBa_J35004	4-fingers arm	. . . gagttttctcctctggttttccagtcggcg	63
BBa_J35005	5-fingers arm	. . . gagttttctcctctggttttccagtcggcg	76
BBa_J35006	6-fingers arm	. . . gagttttctcctctggttttccagtcggcg	89
BBa_J35007	7-fingers arm	. . . gagttttctcctctggttttccagtcggcg	102
BBa_J35120	B-Z DNA switcher	tggacactaagctattcatc	20
BBa_K1479005	-- No description --	aattccggaattccgg	16

@@ Line 8: / Line 8: @@
 </style>
 </html>
-<center>
-'''[[Primers/Catalog#Sequencing of BioBrick parts|Sequencing parts]]''' &bull; '''[[Primers/Catalog#Amplification of BioBrick parts|Amplifying parts]]''' &bull; '''[[Primers/Catalog#Amplification of BioBrick plasmid backbones|Amplifying plasmid backbones]]''' &bull; '''[[Primers/Catalog#Sequencing of long composite BioBrick parts|GFP/YFP/CFP primers]]''' &bull; '''[[Primers/Catalog#Generic molecular biology vector primers|Common primers]]'''
-</center>
 ==BioBrick cloning sites==
@@ Line 17: / Line 13: @@
 {|
 |[[Image:BioBrickprefix.png|75px|center]]
-|To adhere to the BioBrick&reg; standard for physical composition of genetic parts, plasmid backbones must include a BioBrick&reg; cloning site.  The cloning site includes a BioBrick&reg; prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick&reg; suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site.
+|To adhere to the BioBrick standard for physical composition of genetic parts, plasmid backbones must include a BioBrick cloning site.  The cloning site includes a BioBrick prefix sequence composed of an EcoRI, NotI, and XbaI restriction enzyme recognition site and a BioBrick suffix sequence composed of a SpeI, NotI, and PstI restriction enzyme recognition site.
 |-
 |[[Image:BioBricksuffix.png|75px|center]]
-|In most BioBrick&reg; plasmid backbones, including those constructed from the BioBrick&reg; base vector, the BioBrick&reg; prefix and suffix sequences are not adjacent to one another.  Instead, the BioBrick&reg; prefix and suffix flank what is a called a '''default plasmid insert''' or '''default insert''' for short.  There are several different default inserts available in the Registry.  See [[Plasmids/Construction#Default plasmid inserts|default plasmid inserts]] for more information.
+|Note that in most BioBrick plasmid backbones, the BioBrick prefix and suffix sequences are not adjacent to one another.  Instead, the BioBrick prefix and suffix flank what is a called a '''default plasmid insert''' or '''default insert''' for short.  There are several different default inserts available in the Registry.  See [[Plasmids/Construction#Default plasmid inserts|default plasmid inserts]] for more information.
 |}
@@ Line 60: / Line 56: @@
 {|
 |[[Image:ForwardPrimerBindingSite.png|50px|center]]
-|rowspan="2"|A common operation with BioBrick&reg; plasmids is to verify the length or sequence of the cloned BioBrick&reg; part.  To verify the length of the BioBrick&reg; part, most people use [http://openwetware.org/wiki/Colony_PCR colony PCR] to amplify the BioBrick&reg; part and check the length using [http://openwetware.org/wiki/Agarose_gel_electrophoresis agarose gel electrophoresis].  To [http://openwetware.org/wiki/Sequencing_DNA sequence the part], most people use a core facility at their institution or send samples to commercial DNA sequencing services.  Regardless, both length and sequence verification require the use of primers (short synthetic DNA fragments usually ~20 nucleotides in length).  For convenience, most BioBrick&reg; plasmid backbones, including those constructed from the BioBrick&reg; base vector, include standard primer annealing sites for the VF2 and VR primers.  The VF2 and VR primers flank the BioBrick cloning site but are sufficiently distant from the cloning site to ensure high quality sequencing reads.  Or alternatively, you can also use the BioBrick-f and BioBrick-r primers which anneal to the BioBrick&reg; prefix and BioBrick&reg; suffix sequences, respectively.
+|rowspan="2"|Primer binding sites are DNA sequences specifically designed for oligo annealing.  For example, most BioBrick plasmid backbones include binding sites for the VF2 and VR primers.
 |-
 |[[Image:ReversePrimerBindingSite.png|50px|center]]