User contributions
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 18:02, 6 October 2021 (diff | hist) . . (-1,201) . . Part:BBa K4047034:Design (→Design Notes)
- 18:55, 4 October 2021 (diff | hist) . . (+73) . . Part:BBa K4047017 (current)
- 18:54, 4 October 2021 (diff | hist) . . (+74) . . Part:BBa K4047016
- 18:45, 4 October 2021 (diff | hist) . . (+53) . . Part:BBa K4047015 (current)
- 18:42, 4 October 2021 (diff | hist) . . (+436) . . Part:BBa K4047014 (current)
- 18:42, 4 October 2021 (diff | hist) . . (+380) . . Part:BBa K4047014:Design (→Source) (current)
- 18:41, 4 October 2021 (diff | hist) . . (+448) . . Part:BBa K4047013 (current)
- 18:41, 4 October 2021 (diff | hist) . . (+380) . . Part:BBa K4047013:Design (→Source) (current)
- 18:40, 4 October 2021 (diff | hist) . . (+327) . . Part:BBa K4047012 (current)
- 18:40, 4 October 2021 (diff | hist) . . (+93) . . Part:BBa K4047012:Design (→Source) (current)
- 18:39, 4 October 2021 (diff | hist) . . (+326) . . Part:BBa K4047011 (current)
- 18:38, 4 October 2021 (diff | hist) . . (+93) . . Part:BBa K4047011:Design (→Source) (current)
- 18:38, 4 October 2021 (diff | hist) . . (+439) . . Part:BBa K4047010 (current)
- 18:38, 4 October 2021 (diff | hist) . . (-1) . . Part:BBa K4047010:Design (→Source) (current)
- 18:37, 4 October 2021 (diff | hist) . . (+381) . . Part:BBa K4047010:Design (→Source)
- 18:34, 4 October 2021 (diff | hist) . . (+427) . . Part:BBa K4047009 (current)
- 18:34, 4 October 2021 (diff | hist) . . (-2) . . Part:BBa K4047009:Design (→Source) (current)
- 18:34, 4 October 2021 (diff | hist) . . (+382) . . Part:BBa K4047009:Design (→Source)
- 18:33, 4 October 2021 (diff | hist) . . (+118) . . Part:BBa K4047008 (current)
- 18:33, 4 October 2021 (diff | hist) . . (+93) . . Part:BBa K4047008:Design (→Source) (current)
- 18:30, 4 October 2021 (diff | hist) . . (+92) . . Part:BBa K4047007:Design (→Source) (current)
- 18:30, 4 October 2021 (diff | hist) . . (+118) . . Part:BBa K4047007 (current)
- 18:29, 4 October 2021 (diff | hist) . . (-22) . . Part:BBa K4047004:Design (→Source)
- 18:28, 4 October 2021 (diff | hist) . . (-14) . . Part:BBa K4047004
- 18:27, 4 October 2021 (diff | hist) . . (+307) . . Part:BBa K4047005
- 18:26, 4 October 2021 (diff | hist) . . (+553) . . Part:BBa K4047005:Design (→Source)
- 18:13, 4 October 2021 (diff | hist) . . (+307) . . Part:BBa K4047004
- 18:12, 4 October 2021 (diff | hist) . . (+552) . . Part:BBa K4047004:Design (→Source)
- 18:12, 4 October 2021 (diff | hist) . . (+22) . . Part:BBa K4047002
- 18:11, 4 October 2021 (diff | hist) . . (+23) . . Part:BBa K4047001
- 18:11, 4 October 2021 (diff | hist) . . (+1) . . Part:BBa K4047000 (→=Long Description)
- 18:10, 4 October 2021 (diff | hist) . . (+22) . . Part:BBa K4047000
- 18:10, 4 October 2021 (diff | hist) . . (+367) . . Part:BBa K4047003:Design (→Source)
- 18:10, 4 October 2021 (diff | hist) . . (+1) . . Part:BBa K4047003 (→=Long Description)
- 18:09, 4 October 2021 (diff | hist) . . (+631) . . Part:BBa K4047003
- 18:01, 4 October 2021 (diff | hist) . . (+1) . . Part:BBa K4047001:Design (→Source)
- 18:00, 4 October 2021 (diff | hist) . . (+383) . . Part:BBa K4047001
- 17:59, 4 October 2021 (diff | hist) . . (+1) . . Part:BBa K4047000:Design (→Source)
- 17:59, 4 October 2021 (diff | hist) . . (+384) . . Part:BBa K4047000
- 17:58, 4 October 2021 (diff | hist) . . (+367) . . Part:BBa K4047002:Design (→Source)
- 17:57, 4 October 2021 (diff | hist) . . (-26) . . Part:BBa K4047002
- 17:56, 4 October 2021 (diff | hist) . . (+410) . . Part:BBa K4047002
- 17:55, 4 October 2021 (diff | hist) . . (-103) . . Part:BBa K4047002
- 17:54, 4 October 2021 (diff | hist) . . (+12) . . Part:BBa K4047000:Design
- 17:54, 4 October 2021 (diff | hist) . . (+345) . . Part:BBa K4047001:Design (→Source)
- 17:53, 4 October 2021 (diff | hist) . . (-149) . . Part:BBa K4047001
- 17:53, 4 October 2021 (diff | hist) . . (+185) . . Part:BBa K4047000:Design (→Design Notes)
- 17:52, 4 October 2021 (diff | hist) . . (+339) . . Part:BBa K4047000
- 17:52, 4 October 2021 (diff | hist) . . (+702) . . N Part:BBa K4047000:Hard Information (Created page with "This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequ...") (current)
- 17:47, 4 October 2021 (diff | hist) . . (+123) . . Part:BBa K4047000:Design (adding info)
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)