Primer
pT_tal-fwd

Part:BBa_K4047000:Hard Information

Designed by: Hope Kirby, Avery Imes   Group: iGEM21_MiamiU_OH   (2021-09-01)

This is the forward primer for transaldolase. The overlap sequence (acacaggaaacagaccatgg) allows proper Gibson assembly with the pGEM-tal backbone. The intermediate aattc sequence preserves the EcoRI restriction digest site for confirmation testing. The annealing portion (ATGGCAGCGAATTTACTCGAAC) allows annealing to the WT S. elongatus PCC 7942 genome for proper amplification.

This was also the forward primer for amplification of transaldolase prior to the assembly of pGEM-tal+fbp. Once again, the overlap sequence (red) allows proper Gibson assembly with the pGEM-tal+fbp backbone. The annealing portion (all caps) allows annealing to the WT S. elongatus PCC 7942 genome for proper amplification.