Help:Prefix-Suffix
- Registry Help Pages:
- TOC
- At-a-Glance
- FAQ
Parts | Plasmid Backbones | BioBrick Prefix and Suffix | Standards | Assembly Standards | Assembly Methods
Prefix and Suffix
The Prefix and Suffix flank the part on either side:
- the part does not include the prefix and suffix
- The sequence of a coding region part would begin with the start codon and end with the stop codon (ATG - - - - - - - - - TAATAA). It does not include the prefix and suffix.
- the plasmid backbone is defined as the sequence starting with the suffix and ending at the prefix
- The sequence of the pSB1C3 plasmid backbone starts with the suffix and ends with the prefix
Prefix
- The standard prefix depends on the part that follows it:
- 5' GAATTCGCGGCCGCTTCTAG '3 - for coding region parts, and parts that start with ATG. Why?
- 5' GAATTCGCGGCCGCTTCTAGAG '3 - for all other parts
Suffix
- The standard suffix is always:
- 5' TACTAGTAGCGGCCGCTGCAG '3
This prefix and suffix is used in 3A Assembly and belongs to BioBrick RFC 10. It is the standard prefix and suffix for shipping your parts to the Registry. There are other prefixes and suffixes that belong to alternate Assembly Standards.
Restriction Sites
The prefix and suffix contain restriction enzyme cut sites, that can be used to transfer and assemble your parts.
Prefix
Suffix
Prefix (for ATG parts)
Compatibility
- A part's sequence must not contain the restriction sites of the prefix and suffix that will flank the part.
- Parts that are shipped to the Registry must not contain the following restriction sites: EcoRI, XbaI, SpeI, PstI Read More...