Bacteriophage T7
The following is rewritten based on Chan, Kosuri and Endy, 2005 Chan.
Bacteriophage T7, an obligate lytic phage that infects Escherichia coli (Dunn and Studier, 1983; Studier and Dunn, 1983), offers an attractive model system for genome design and engineering for several reasons.
- Genetics, and then biochemistry, enabled the discovery and characterization of some of the individual elements that participate in T7 development (Molineux, 2005).
- Compared to other phage, T7 is relatively independent of complex host physiology. For example, the optical density of T7-infected cultures stops increasing at the time of infection. T7 encodes phage-specific RNA and DNA polymerases, and E. coli mRNA and protein synthesis is inhibited within the first 6 min of T7 infection.
- RNA polymerase pulls most of the T7 genome into the newly infected cell (Zavriev and Shemyakin, 1982; Garcia and Molineux, 1995). Polymerase-mediated genome entry is a relatively slow process that results in the direct physical coupling of gene expression dynamics to gene position. For example, a gene cannot be expressed until its coding domain enters the newly infected cell.
| Promoters (?) | Primers (?) |
| Help: Want to know more about Bacteriophage T7? See the help pages for more information. |
Promoters
Constitutive
These promoters are recognized by the T7 RNA Polymerase and are constitutive meaning that their activity is dependent on the availability of RNA polymerase, but is not affected by any transcription factors. T7 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I712074 | T7 promoter (strong promoter from T7 bacteriophage) | . . . agggaatacaagctacttgttctttttgca | 46 | 1938 | In stock | ||
| BBa_I719005 | T7 Promoter | taatacgactcactatagggaga | 23 | 7912 | In stock | ||
| BBa_J34814 | T7 Promoter | gaatttaatacgactcactatagggaga | 28 | 1190 | Not in stock | ||
| BBa_J64997 | T7 consensus -10 and rest | taatacgactcactatagg | 19 | 10154 | It's complicated | ||
| BBa_K113010 | overlapping T7 promoter | . . . gagtcgtattaatacgactcactatagggg | 40 | 1553 | It's complicated | ||
| BBa_K113011 | more overlapping T7 promoter | . . . agtgagtcgtactacgactcactatagggg | 37 | 1601 | It's complicated | ||
| BBa_K113012 | weaken overlapping T7 promoter | . . . gagtcgtattaatacgactctctatagggg | 40 | 1630 | It's complicated | ||
| BBa_K1614000 | T7 promoter for expression of functional RNA | taatacgactcactatag | 18 | 5219 | In stock | ||
| BBa_K3633015 | T7 promoter | taatacgactcactatagg | 19 | It's complicated | |||
| BBa_R0085 | T7 Consensus Promoter Sequence | taatacgactcactatagggaga | 23 | 2072 | In stock | ||
| BBa_R0180 | T7 RNAP promoter | ttatacgactcactatagggaga | 23 | 1654 | Not in stock | ||
| BBa_R0181 | T7 RNAP promoter | gaatacgactcactatagggaga | 23 | 1651 | Not in stock | ||
| BBa_R0182 | T7 RNAP promoter | taatacgtctcactatagggaga | 23 | 1653 | Not in stock | ||
| BBa_R0183 | T7 RNAP promoter | tcatacgactcactatagggaga | 23 | 1653 | Not in stock | ||
| BBa_Z0251 | T7 strong promoter | . . . taatacgactcactatagggagaccacaac | 35 | 1887 | Not in stock | ||
| BBa_Z0252 | T7 weak binding and processivity | . . . taattgaactcactaaagggagaccacagc | 35 | 1667 | Not in stock | ||
| BBa_Z0253 | T7 weak binding promoter | . . . cgaagtaatacgactcactattagggaaga | 35 | 1400 | Not in stock |
Repressible
All the promoters on this page are recognized by the T7 RNA Polymerase and are negatively regulated meaning that increased levels of at least one transcription factor will decrease the activity of these promoters. T7 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K921000 | T7 RNAP + IPTG->PoPs (Mutant I) | . . . aggacaattgtgggcggacaacaattccaa | 46 | 6465 | In stock | ||
| BBa_K921001 | T7 RNAP + IPTG->PoPs (Mutant II) | . . . ggcggaattgtgagcggataacaattccaa | 48 | 6782 | It's complicated | ||
| BBa_K921002 | T7 RNAP + IPTG->PoPs (Mutant III) | . . . gagagaattgtgagcggataacaattccaa | 47 | 6400 | In stock | ||
| BBa_R0184 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1176 | Not in stock | ||
| BBa_R0185 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1888 | Not in stock | ||
| BBa_R0186 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1885 | Not in stock | ||
| BBa_R0187 | T7 promoter (lacI repressible) | . . . ataggggaattgtgagcggataacaattcc | 44 | 1885 | Not in stock |
Primers
| Name | Description | Sequence | Direction | Target | %GC | Tm | Length |
|---|---|---|---|---|---|---|---|
| BBa_G00113 | T7 promoter sequencing primer, 20-mer | taatacgactcactataggg | F | 40 | 56C | 20 | |
References
<biblio>
- Dunn pmid=6864790
- Studier79a pmid=375582
- Studier79b pmid=231684
- Studier81 pmid=7338920
- Chan pmid=16729055
</biblio>