Recombination/Salmonella typhimurium-derived Hin-hix
< Back to Recombination systems, DNA recombination sites, or Recombinases
 |
 |
Karmella Haynes, Malcolm Campbell and the [http://2006.igem.org/Davidson_2006 2006 Davidson College/Missouri Western iGEM team], designed and constructed a set of parts from the Salmonella typhimurium-derived DNA recombination system. You can read more about the 2006 Davidson/Missouri Western project in their open-access paper [http://www.jbioleng.org/content/2/1/8 Engineering bacteria to solve the Burnt Pancake Problem] published in the Journal of Biological Engineering Haynes. |
The following is derived from Haynes et al. but edited for clarity Haynes.
In the natural Salmonella system, the Hin DNA recombinase (BBa_J31000, BBa_J31001) catalyzes an inversion reaction that regulates the expression of alternative flagellin genes by switching the orientation of a promoter located on a 1 kb invertible DNA segment Zieg,Zieg80. The asymmetrical palindromic sequences hixL and hixR flank the invertible DNA segment and serve as the recognition sites for cleavage and strand exchange. A ~70 bp cis-acting recombinational enhancer (RE) increases efficiency of protein-DNA complex formation (BBa_J3101) Johnson.
We have reconstituted the genetic elements required for DNA inversion as a collection of modular genetic elements for use in E. coli. Our system is a proof-of-concept genetic computing device that manipulates plasmid DNA processors within living cells. Rather than hixL and hixR, our system uses hixC (BBa_J44000), a composite 26 bp symmetrical hix site that shows higher binding affinity for Hin and a 16-fold slower inversion rate than wild type sites hixL and hixR Lim,Moskowitz.
A modified Hin/hix DNA recombination system can be used in vivo to manipulate at least two adjacent hixC-flanked DNA segments. Hin recombinase fused to a C-terminus LVA degradation tag (BBa_J31001) and hixC (BBa_J44000) are sufficient for DNA inversion activity.
Recombination sites
| Name | Description | Sequence | Recombinase | Length |
|---|---|---|---|---|
| BBa_J3101 | Recombinational Enhancer (RE) for Hin/Hix inverting | . . . ctttctagtgcaaattgtgaccgcattttg | 77 | |
| BBa_J44000 | hixC binding site for Salmonella typhimurium Hin recombinase | ttatcaaaaaccatggtttttgataa | 26 |
Recombinases
| Name | Protein | Description | Direction | KEGG | UniProt | E.C. | Recombination site | Length |
|---|---|---|---|---|---|---|---|---|
| BBa_J31001 | Hin-LVA | DNA invertase Hin tagged with LVA | stm:STM2772 | P03013 | none | 612 | ||
| BBa_J31000 | Hin | DNA-invertase Hin from Salmonella typhimurium | stm:STM2772 | P03013 | none | 573 |
Composite parts
| Name | Type | Description | Length | Status |
|---|---|---|---|---|
| BBa_S03639 | Composite | (-1,-2) HixC-pBadrev-HixC : TetB-RBSrev-HixC | 1454 | It's complicated |
| BBa_J3107 | Generator | AraC-PC, pLac-Hin | 2198 | It's complicated |
| BBa_J3108 | Generator | AraC-PC, pLac-HinLVA | 2237 | It's complicated |
| BBa_J44003 | Composite | HixC-pBad-HixC-RBS-TetF | 1418 | It's complicated |
| BBa_J44010 | Reporter | HixC-pBAD-HixC-RBS-TetF-HixC | 1452 | It's complicated |
| BBa_J44012 | Reporter | HixC-pBAD-HixC-RBS-TetF-HixC | 1452 | It's complicated |
| BBa_J44011 | Reporter | HixC-pBAD-HixC-Tetrev-RBSrev-HixC | 1454 | It's complicated |
| BBa_J44013 | Composite | HixC-pBAD-HixC-Tetrev-RBSrev-HixC | 1454 | It's complicated |
| BBa_I715042 | Composite | HPP-A0 | 2132 | It's complicated |
| BBa_I715047 | Composite | HPP-A0 + Hin | 3118 | It's complicated |
| BBa_I715043 | Composite | HPP-A1 | 2132 | It's complicated |
| BBa_I715049 | Composite | HPP-A1 + Hin | 3118 | It's complicated |
| BBa_I715044 | Composite | HPP-A2 | 2132 | It's complicated |
| BBa_I715051 | Composite | HPP-A2 + Hin | 3118 | It's complicated |
| BBa_I715037 | Composite | HPP-B1 | 2513 | It's complicated |
| BBa_J3103 | Generator | pBad-HixC-RBS-TetF-HixC-TT-RE | 1640 | It's complicated |
| BBa_J44009 | Device | pBAD-hixC-RBS-TetF-TT-RE | 1606 | It's complicated |
| BBa_J3106 | Generator | pBad-HixC-TetB-RBSrev-HixC-TT-RE | 1608 | It's complicated |
| BBa_J3105 | Generator | pBad-RBS-HixC-TetB-HixC-TT-RE | 1642 | It's complicated |
| BBa_J3104 | Generator | pBad-RBS-HixC-TetF-HixC-TT-RE | 1640 | It's complicated |
References
<biblio>
- Zieg pmid=322276
- Zieg80 pmid=6933466
- Johnson pmid=2548848
- Haykinson pmid=8508775
- PerkinsBalding pmid=9244261
- Haynes pmid=18492232
- Ham pmid=18665232
- Nanassy pmid=9691026
- Moswitz pmid=1885005
- Lim pmid=1597453
</biblio>