Promoters/Catalog/Yeast/Positive
All the promoters on this page are yeast promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K392001 | yeast ENO2 promoter | . . . aagcaactaatactataacatacaataata | 598 | 2244 | It's complicated | ||
| BBa_K106699 | Gal1 Promoter | . . . aaagtaagaatttttgaaaattcaatataa | 686 | 1216 | Not in stock | ||
| BBa_K110015 | A-Cell Promoter MFA1 (RtL) | . . . cttcatatataaaccgccagaaatgaatta | 436 | 1659 | Not in stock | ||
| BBa_K110014 | A-Cell Promoter MFA2 (backwards) | . . . atcttcatacaacaataactaccaacctta | 550 | 1304 | Not in stock | ||
| BBa_K110004 | Alpha-Cell Promoter Ste3 | . . . gggagccagaacgcttctggtggtgtaaat | 501 | 1372 | Not in stock | ||
| BBa_J24813 | URA3 Promoter from S. cerevisiae | . . . gcacagacttagattggtatatatacgcat | 137 | 1431 | Not in stock | ||
| BBa_K4706014 | Yeast Gal1 Kozak partly | . . . gtcaaggaggaaactagacccgccgccacc | 543 | ||||
| BBa_K4365000 | FIG1 inducible promoter | . . . aaacaaccaaccaaaaaaaaaaaaaaaaaa | 1000 | ||||
| BBa_K2601000 | Promoter-Tet07(Saccharomyces cerevisiae) | . . . cacacactaaattacccggatcaattcggg | 724 | 1597 | It's complicated | ||
| BBa_K2294007 | Synthtic minimal Galactose induced promoter + Kozak sequence | . . . atcgaaaaaagtctccatggtggcggcggg | 160 | 6028 | It's complicated | ||
| BBa_K753000 | Yeast FIG1 promoter | . . . aaacaaacaaacaaaaaaaaaaaaaaaaaa | 450 | 2409 | It's complicated | ||
| BBa_K586000 | Cup-1 Heavy metal sensor | . . . accaagaagtcatgctgctctgggaaatga | 186 | 1888 | It's complicated | ||
| BBa_J63006 | yeast GAL1 promoter | . . . gaggaaactagacccgccgccaccatggag | 549 | 11798 | In stock | ||
| BBa_K284003 | Partial DLD Promoter from Kluyveromyces lactis | . . . aagtgcaagaaagaccagaaacgcaactca | 463 | 1735 | It's complicated | ||
| BBa_K284002 | JEN1 Promoter from Kluyveromyces lactis | . . . gagtaaccaaaaccaaaacagatttcaacc | 998 | 1654 | It's complicated | ||
| BBa_K165041 | Zif268-HIV binding sites + TEF constitutive yeast promoter | . . . atacggtcaacgaactataattaactaaac | 457 | 1163 | It's complicated | ||
| BBa_K165034 | Zif268-HIV bs + LexA bs + mCYC promoter | . . . cacaaatacacacactaaattaataactag | 457 | 1431 | It's complicated | ||
| BBa_K165031 | mCYC promoter plus LexA binding sites | . . . cacaaatacacacactaaattaataactag | 403 | 1564 | It's complicated | ||
| BBa_K165030 | mCYC promoter plus Zif268-HIV binding sites | . . . cacaaatacacacactaaattaataactag | 307 | 1723 | It's complicated | ||
| BBa_K165001 | pGAL1+ w/XhoI sites | . . . atactttaacgtcaaggagaaaaaactata | 672 | 2730 | It's complicated | ||
| BBa_K110016 | A-Cell Promoter STE2 (backwards) | . . . accgttaagaaccatatccaagaatcaaaa | 500 | 2256 | It's complicated | ||
| BBa_K110006 | Alpha-Cell Promoter MF(ALPHA)1 | . . . tttcatacacaatataaacgattaaaagaa | 501 | 1773 | It's complicated | ||
| BBa_K110005 | Alpha-Cell Promoter MF(ALPHA)2 | . . . aaattccagtaaattcacatattggagaaa | 500 | 1771 | It's complicated | ||
| BBa_K2601001 | Promoter-PDH3(Saccharomyces cerevisiae) | . . . gtttcgaataaacacacataaacaaacaaa | 500 | 1762 | In stock |