Promoters/Catalog/T7/Constitutive
These promoters are recognized by the T7 RNA Polymerase and are constitutive meaning that their activity is dependent on the availability of RNA polymerase, but is not affected by any transcription factors. T7 promoters are known to have high activity levels and are also highly orthogonal to bacterial promoters since the respective RNA Polymerases are unrelated.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I712074 | T7 promoter (strong promoter from T7 bacteriophage) | . . . agggaatacaagctacttgttctttttgca | 46 | 1938 | In stock | ||
| BBa_I719005 | T7 Promoter | taatacgactcactatagggaga | 23 | 7912 | In stock | ||
| BBa_J34814 | T7 Promoter | gaatttaatacgactcactatagggaga | 28 | 1190 | Not in stock | ||
| BBa_J64997 | T7 consensus -10 and rest | taatacgactcactatagg | 19 | 10154 | It's complicated | ||
| BBa_K113010 | overlapping T7 promoter | . . . gagtcgtattaatacgactcactatagggg | 40 | 1553 | It's complicated | ||
| BBa_K113011 | more overlapping T7 promoter | . . . agtgagtcgtactacgactcactatagggg | 37 | 1601 | It's complicated | ||
| BBa_K113012 | weaken overlapping T7 promoter | . . . gagtcgtattaatacgactctctatagggg | 40 | 1630 | It's complicated | ||
| BBa_K1614000 | T7 promoter for expression of functional RNA | taatacgactcactatag | 18 | 5219 | In stock | ||
| BBa_K3633015 | T7 promoter | taatacgactcactatagg | 19 | It's complicated | |||
| BBa_R0085 | T7 Consensus Promoter Sequence | taatacgactcactatagggaga | 23 | 2072 | In stock | ||
| BBa_R0180 | T7 RNAP promoter | ttatacgactcactatagggaga | 23 | 1654 | Not in stock | ||
| BBa_R0181 | T7 RNAP promoter | gaatacgactcactatagggaga | 23 | 1651 | Not in stock | ||
| BBa_R0182 | T7 RNAP promoter | taatacgtctcactatagggaga | 23 | 1653 | Not in stock | ||
| BBa_R0183 | T7 RNAP promoter | tcatacgactcactatagggaga | 23 | 1653 | Not in stock | ||
| BBa_Z0251 | T7 strong promoter | . . . taatacgactcactatagggagaccacaac | 35 | 1887 | Not in stock | ||
| BBa_Z0252 | T7 weak binding and processivity | . . . taattgaactcactaaagggagaccacagc | 35 | 1667 | Not in stock | ||
| BBa_Z0253 | T7 weak binding promoter | . . . cgaagtaatacgactcactattagggaaga | 35 | 1400 | Not in stock |