Part:BBa_K4811030
TMS(PFOA2)
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 80
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
This is a tRNA Mimicking Structure (TMS). It is a novel piece of synthetically designed RNA, which folds in the same manner as tRNA, initially developed by Paul et al as a novel trans-encoded genetic switch. It binds to the Ribosome Binding Site (RBS) BBa_K4811000, repressing translation. The binding regions are flanking the RBS, and no binding happens in the RBS consensus sequence. This means that there are very few limitations on both the possible TMSs and repressible RBSs which could be engineered.
This TMS is based on the original TMS developed by A. Paul, BBa_K4811002, and in this particular part, the D-loop has been exchanged for a PFOA-sensitive aptamer, in this case CGGCGTGGGGTGGTAGGCTGTAAAGGGGGTCG
This is the full aptamer, JYP_2, from J. Park, but only including a small part of the stem region.
Figure 1. Prediction of folding of the RNA using ViennaRNA. The figure is colored by base-pairing probabilities. For paired regions, the color denotes the probability of being paired. For unpaired regions, the color denotes the probability of being unpaired. The following parameters were used: minimum free energy (MFE) and partition function, avoid isolated base pairs, Incorporate G–Quadruplex formation into the structure prediction algorithm, dangling energies on both sides of a helix in any case, RNA parameters (Andronescu model, 2007) Lorenz, R. and Bernhart, S.H. and Höner zu Siederdissen, C. and Tafer, H. and Flamm, C. and Stadler, P.F. and Hofacker, I.L. "ViennaRNA Package 2.0", Algorithms for Molecular Biology, 6:1 page(s): 26, 2011.
Characterization
The part was tested as the composite part BBa_K4811028 in E. coli BL21(DE3), where the TMS is induced by IPTG. This construct was USER cloned into the high copy number pUC19 backbone for testing. A reporter, consisting of BBa_K4811003 was USER cloned into the low copy number pACYC184 backbone. This has mCherry, under control of the pBAD promoter, meaning L-arabinose will induce mCherry transcription. The mCherry transcript has the RBS BBa_K4811000 incorporated, meaning that translation of mCherry should be inhibited by the TMS, if the inhibiting capabilities are conserved upon changing the D-loop.
A general schematic of the system to be tested can be seen below:
Figure 2. mCherry is induced by L-ara, and the TMS is induced by IPTG. The hypothesis is, that the TMS is able to repress translation of mCherry, by binding to the RBS, and that a ligand, in this case PFOA is able to bind to the TMS, releasing the mCherry RBS of the TMS, allowing translation to begin.
The two plasmids were co-transformed into the same BL21(DE3) and transformants were verified by PCR and named BL21(DE3).pU01.pU12. The culture was grown overnight in LB + Cam + Amp. In the morning, the culture was reinoculated to an OD600 of 0.05, and set to incubate for 2 h, to achieve an OD600 of 0.4-0.6. Induction was done in quadruplicates. For each PFOA concentration to be tested, 100 ul E. coli culture was added 1 mM IPTG and 0.1 % w/v L-ara, PFOA in varying concentrations, and then MQ water for a total volume of 200 ul, to try to make the PFOA concentration the only variable. As control there was a uninduced culture, which was just 100 ul E. coli and 100 ul MQ (uninduced), as well as a culture only induced by 1 mM IPTG, with no L-arabinose (IPTG), and one only induced by 0.1 % w/v L-arabinose, with no IPTG (L-ara).
Induction was allowed for 5 h at 37 degrees Celcius, however, the OD had not changed much. Therefore, the cultures were allowed to be induced for an additional 13 h overnight, for a total induction time of 18 h.
OD660 was measured for 100 ul of each culture in a see-through microtiter plate, and mCherry fluorescence was measured using 561 nm excitation and 617 nm emission in black UV microtiter plates. Measurements were done using a SpectraMax iD3.
The following graph shows the data obtained:
Figure 3. OD normalized relative mCherry fluorescence, 561 nm excitation/617 nm emission, as a function of PFOA concentration. All measurements were with 1 mM IPTG and 0.1 % w/v L-arabinose, except the controls. As controls there is a culture induced with only 1 mM IPTG (IPTG), one only induced by 0.1 % w/v L-arabinose (L-ara), and one with no inducers present (uninduced)
The observed results are the opposite of what is reported by A. Paul with the GFP aptamer tested by them. Here, GFP was reported to stabilize the TMS, releasing it from the RBS, allowing translation to happen. What we showed with this data is, that for the TMS(PFOA2), it seems that addition of PFOA leads to a decrease in mCherry fluorescence.
One model explaining this could be, that PFOA changes the conformation of the TMS to one where it is able to bind to the RBS, and therefore an increase in PFOA concentration leads to a lower mCherry fluorescence.
Figure 4. The results showed PFOA concentration leading to a lower fluorescence, possibly by TMS binding to the RBS BBa_K4811000. The model show here would explain these results.
Validation of existing data from A. Paul
The TMS is based upon the design from A. Paul, who tested the function of a GFP and Neomycin aptamer insertion into the D-loop, BBa_K4811006 and BBa_K4811008 respectively. Here, the parts were tested in E. coli BL21(DE3), where the TMS is induced by IPTG. A reporter was incorporated into the low copy number pACYC184 backbone. The reporter had mCherry under control of the pBAD promoter, meaning L-arabinose will induce mCherry transcription. The mCherry transcript has the RBS BBa_K4811000 incorporated, meaning that translation of mCherry should be inhibited by the TMS. For testing of the GFP aptamer, the reporter plasmid also had GFP under control of Ptet promoter, and therefore induced by aTc.
A general schematic of the TMS(GFP) system can be seen below:
Figure 5. GFP is induced by aTc, mCherry is induced by L-ara, and the TMS is induced by IPTG. The hypothesis is, that the TMS is able to repress translation of mCherry, by binding to the RBS, and that GFP is able to bind to the TMS, releasing the mCherry RBS of the TMS, allowing translation to begin.
A. Paul, who created the system during their PhD, got the following results:
Figure 6. Controlling gene expression by the NeoB-TMS-IBE (BBa_K4811008) and GFP-TMS-IBE (BBa_K4811006) switches (1). Binding of the switches prevents ribosome binding (2), which is reversed by binding of the corresponding aptamer ligand (3). The GFP-TMS-IBE switch controls mCherry expression. b) Titration of azide-conjugated neomycin B leads to increased GFP production. c) Inducing GFP expression with anhydrotetracycline leads to increasing mCherry fluorescence.
From "Modular and Versatile Trans-Encoded Genetic Switches", A. Paul, E. M. Warszawik, M. Loznik, A. J. Boersma, A. Herrmann, Angew. Chem. Int. Ed. 2020, 59, 20328.
We tried to recreate these results, see BBa_K4811006, but were unable to see the same mCherry control by GFP. We did not have access to neomycinB-azide, so were unable to test the TMS(Neo). The following graphs show the results of the TMS(GFP):
Figure 7. OD normalized relative GFP fluorescence, 488 nm excitation/545 nm emission, as a function of anhydrotetracycline (aTc) concentration. All measurements were with 1 mM IPTG and 0.1 % w/v L-arabinose, except the controls. As controls there is a culture induced with 1 mM IPTG only (IPTG), one induced by L-arabinose only (L-ara), and one with no inducers present (uninduced)
Figure 8. OD normalized relative mCherry fluorescence, 561 nm excitation/617 nm emission, as a function of anhydrotetracycline (aTc) concentration. All measurements were with 1 mM IPTG and 0.1 % w/v L-arabinose, except the controls. As controls there is a culture induced with only 1 mM IPTG (IPTG), one only induced by L-arabinose (L-ara), and one with no inducers present (uninduced)
The results clearly showed that aTc induced GFP, with 0.5 uM having the highest fluorescence. We would have expected 1 uM GFP to have even higher fluorescence, however it seems to be lower, but with a much higher standard deviation associated with the data.
When looking at the corresponding mCherry fluorescence, there seems to be no significant difference when varying the amount of aTc. Therefore, we were not able to recreate the results of A. Pual, where GFP led to an increase in mCherry fluorescence. However, comparing the L-ara control with 0 uM aTc, where there is 1 mM IPTG and 0.1 % w/v L-arabinose, there is no significant difference between the mCherry fluorescence between these two measurements. This leads us to believe that possibly the TMS ability to inhibit mCherry was somehow altered in this experimental setup.
| None |