Part:BBa_K4811002
TMS: tRNA Mimicking Structure
This is a tRNA Mimicking Structure (TMS). It is a novel piece of synthetically designed RNA, which folds in the same manner as tRNA, developed by Paul et al. It is a trans-encoded genetic switch, which binds to the Ribosome Binding Site(RBS) BBa_K4811001, repressing translation. The binding regions are flanking the RBS, and no binding happens in the RBS consensus sequence. This means that there are very few limitations on both the possible TMSs and repressible RBSs which could be engineered.
Figure 1. Prediction of folding of the RNA using ViennaRNA. The figure is colored by base-pairing probabilities. For paired regions, the color denotes the probability of being paired. For unpaired regions the color denotes the probability of being unpaired.
Using the following parameters: minimum free energy (MFE) and partition function, avoid isolated base pairs, Incorporate G–Quadruplex formation into the structure prediction algorithm, dangling energies on both sides of a helix in any case, RNA parameters (Andronescu model, 2007).
Lorenz, R. and Bernhart, S.H. and Höner zu Siederdissen, C. and Tafer, H. and Flamm, C. and Stadler, P.F. and Hofacker, I.L. "ViennaRNA Package 2.0", Algorithms for Molecular Biology, 6:1 page(s): 26, 2011.
Reported by A. Paul, the TMS is supposed to be highly modular, allowing for control of an RBS, without altering the sequence of mRNA, since the TMS is engineered to bind to the flanking regions of the RBS, so that a change in the binding region of the RBS can alter it to inhibit translation of a completely new gene.
Also, the D-loop of the TMS can be exchanged for an aptamer, allowing binding of a ligand to control the TMS, with the hypothesis being, that binding of the ligand will be in competition of binding to the RBS, allowing translation to begin in presence of the ligand.
The sequence of the D-loop, which can be exchanged for an aptamer is the following: GCTCAGTCGGTAGAGCAGCGGAAAATAAG
This was tested by A. Paul using a GFP aptamer, as well as a neomycin aptamer, giving the results seen below:
Figure 3. Controlling gene expression by the NeoB-TMS-IBE (BBa_K4811008) and GFP-TMS-IBE (BBa_K4811006) switches (1). Binding of the switches prevents ribosome binding (2), which is reversed by binding of the corresponding aptamer ligand (3). The GFP-TMS-IBE switch controls mCherry expression. b) Titration of azide-conjugated neomycin B leads to increased GFP production. c) Inducing GFP expression with anhydrotetracycline leads to increasing mCherry fluorescence.
These results showed a clear repression of mCherry translation by the TMS with both the neomycin. and GFP aptamers. It also showed NeomycinB-azide and GFP interfering with this control, with the respective ligand leading to higher mCherry fluorescence.
The versatility of this system was tested by our team, with the goal being to explore the possibility of using it for a biosensor, with the environmental pollutant PFOA being the ligand.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 77
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |