RNA

Part:BBa_K4811011

Designed by: Kasper Krunderup Jakobsen   Group: iGEM23_DTU-Denmark   (2023-09-25)


TMS(Theo2)

This is a tRNA Mimicking Structure (TMS). It is a novel piece of synthetically designed RNA, which folds in the same manner as tRNA, developed by Paul et al. It is a trans-encoded genetic switch, which binds to the Ribosome Binding Site (RBS) BBa_K4811000, repressing translation. The binding regions are flanking the RBS, and no binding happens in the RBS consensus sequence. This means that there are very few limitations on both the possible TMSs and repressible RBSs which could be engineered.

In this particular part, the D-loop of BBa_K4811002 has been exchanged for a Theophylline-sensitive aptamer with the sequence AAGATGATACCAGCCGAAAGGCCCTTGGCAGCTCTCGT

This is the full theophylline aptamer from Suess et al (see Design).

tms-theo2.png

Figure 1. Prediction of folding of the RNA using ViennaRNA. The figure is colored by base-pairing probabilities. For paired regions, the color denotes the probability of being paired. For unpaired regions the color denotes the probability of being unpaired. The following parameters were used: minimum free energy (MFE) and partition function, avoid isolated base pairs, Incorporate G–Quadruplex formation into the structure prediction algorithm, dangling energies on both sides of a helix in any case, RNA parameters (Andronescu model, 2007)

Lorenz, R. and Bernhart, S.H. and Höner zu Siederdissen, C. and Tafer, H. and Flamm, C. and Stadler, P.F. and Hofacker, I.L. "ViennaRNA Package 2.0", Algorithms for Molecular Biology, 6:1 page(s): 26, 2011.

Characterization

The part was tested as the composite part BBa_K4811021 in E. coli BL21(DE3), where the TMS is induced by IPTG. This construct was USER cloned into the high copy number pUC19 backbone for testing. A reporter, consisting of BBa_K4811003 was USER cloned into the low copy number pACYC184 backbone. This has mCherry, under control of the pBAD promoter, meaning L-arabinose will induce mCherry transcription. The mCherry transcript has the RBS BBa_K4811000 incorporated, meaning that translation of mCherry should be inhibited by the TMS, if the inhibiting capabilities are conserved upon changing the D-loop.

A general schematic of the system to be tested can be seen below: pu01-pu0x.png

Figure 2. mCherry is induced by L-ara, and the TMS is induced by IPTG. The hypothesis is, that the TMS is able to repress translation of mCherry, by binding to the RBS, and that a ligand is able to bind to the TMS, releasing the mCherry RBS of the TMS, allowing translation to begin.

The two plasmids were co-transformed into the same BL21(DE3) and transformants were verified by PCR. The culture was grown overnight in LB + Cam + Amp. In the morning, the culture was reinoculated to an OD600 of 0.05, and set to incubate for 2 h, to achieve an OD600 of 0.4-0.6. For each ligand concentration to be tested, 100 ul E. coli culture was added 1 mM IPTG and 0.1 % w/v L-ara, ligand in varying concentrations, and then MQ water for a total volume of 200 ul, to try to make the ligand concentration the only variable. As control there was a uninduced culture, which was just 100 ul E. coli and 100 ul MQ (uninduced), as well as a culture only induced by 1 mM IPTG, with no L-arabinose (IPTG), and one only induced by 0.1 % w/v L-arabinose, with no IPTG (L-ara).

Induction was allowed for 5 h at 37 degrees Celcius.

OD660 was measured for 100 ul of each culture in a see-through microtiter plate, and mCherry fluorescence was measured using 561 nm excitation and 617 nm emission in black UV microtiter plates. Measurements were done using a SpectraMax iD3.

The following graph shows the data obtained:

Figure 3. OD normalized relative mCherry fluorescence, 561 nm excitation/617 nm emission, as a function of PFOA concentration. All measurements were with 1 mM IPTG and 0.1 % w/v L-arabinose, except the controls. As controls there is a culture induced with only 1 mM IPTG (IPTG), one only induced by 0.1 % w/v L-arabinose (L-ara), and one with no inducers present (uninduced)

The observed results are the opposite of what is reported by A. Paul with the GFP aptamer tested by them, see BBa_K4811006. Here, GFP was reported to release the TMS from the RBS, allowing translation to happen.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 87
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
Parameters
None