Part:BBa_K4197010

OmpA_DARPin_sfGFP fusion

Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.

Introduction

This part is composed of the gene coding for the DARPin E2_79 protein (see BBa_K4197019) in fusion with the lpp-ompA-N gene (see BBa_K1694002) and with the sfGFP protein gene (see BBa_K515005). This part was designed to link IgE at the surface of E. coli with the sfGFP as a reporter of the localisation of the fusion proteins.

The DARPin E2_79 protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was merged to the membrane protein Lpp-OmpA-N of E. coli (see BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in the membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display proteins on the surface of bacteria (Yang and al. 2016). The sfGFP was chosen because it keeps its fluorescence even in extra-cellular conditions (see BBa_K515005).

Construction

The fusion protein OmpA_DARPin_sfGFP was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part).

OmpA_DARPin-sfGFP fragment from IDT was amplified by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. The expected size of the amplicon was 1468 bp (Figure 1).

Figure 1: OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel).

The DARPin-sfGFP construction was then inserted into our linearized pET-21 b (+) by In-Fusion to assemble the pET-21 b (+)_OmpA_DARPin-sfGFP plasmid.
The In-Fusion mixture was first transformed into chemically competent E. coli Stellar cells. Transformants were selected on LB-ampicillin plates. Resulting colonies were checked by a colony PCR using the primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Expected size of positive colonies was 1885 bp (Figure 2).
Plasmids colonies containing the insert were extracted by Miniprep.

Figure 2: identifying strains that bear pET-21 b (+)_Ompa_DARPin-sfGFP by colony PCR. The expected size of the amplicon was 1885 bp. The positive clones were colonies 13, 14, 15 and 16. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gels (note that a different ladder is presented on the theoretical gel).

Finally, the pET-21 b (+)_OmpA_DARPin_sfGFP plasmid was used to transform E. coli Tuner (DE3) cells. The expression of the OmpA_DARPin-sfGFP encoding gene in E. coli Tuner cells was induced with a concentration of 50 µM of IPTG. The empty pET-21 b (+) plasmid was used as a negative control. After 4 hours of incubation at 37°C, fluorescence was observed on an epifluorescence microscope as shown on Figure 3.

Figure 3: fluorescence of E. coli Tuner cells containing the pET-21 b (+)_OmpA_DARPin-sfGFP vector (A) or the empty pET-21 b (+) plasmid (B) as a negative control. Each image represents an observation in phase contrast (on the left) and in the GFP fluorescence channel (microscope parameters for GFP).

Some fluorescence emission was clearly observed with pET-21 b (+)_OmpA_DARPin-sfGFP whereas none was seen with the empty plasmid. This suggests that the construction indeed allowed expressing the OmpA_DARPin-sfGFP fusion. The fluorescence seemed to be localized in the cytoplasm as it colored the entire cell. However, the resolution of the microscope could not allow us to determine if the membrane was fluorescent as well. To determine where the OmpA_DARPin-sfGFP fusion proteins were situated in the E. coli Tuner cells, a fractionation protocol that allowed the separation of the different parts of the cells (cytoplasm and periplasm versus membrane) was designed. Briefly, after induction with 25 µM of IPTG at 37°C, sonication was used to break up the cells, resuspension in separating buffers and differential centrifugation steps. The fluorescence emission from each fraction on a microplate reader was then measured. A strain with an empty plasmid was induced at 50 µM of IPTG as a negative control. Curves of fluorescence depending on the dilution factor were established as shown on Figure 4.

Figure 4: fluorescence of the cytoplasm/periplasm and membrane fractions. The negative control (empty plasmid induced at 50 µM of IPTG) is represented in blue and the actual assay (construction induced at 25 µM of IPTG) in orange. The excitation wavelength of the microplate reader was 485 nm. Emission was observed at a wavelength of 528 nm.

As expected, the control fractions were considerably less fluorescent than the samples (approximately a hundred times). This indicates that the OmpA_DARPin-sfGFP fusion protein was present in both the cytoplasm and surrounding membranes. The fluorescence in the membranes was twice lower than in the cytoplasm.
The conclusion was that the protein was mainly present in the cytoplasm, but also in the membranes as wanted. A hypothesized was made: the pET-21 b (+)_OmpA_DARPin-sfGFP plasmid led to too high expression levels, leading to saturation of the membrane and expression in the cytoplasm as well.
Even if the presence of at least some OmpA_DARPin-sfGFP protein in the membrane fraction was confirmed, the exposition of the protein at the very surface of the bacteria or inside the membrane (facing inwards) was unclear. Another experiment to investigate this last point was conducted.
To make sure that the OmpA_DARPin-sfGFP was exposed at the surface of the cells and to quantify more precisely the fluorescence emission from each fraction, the experiment was later on repeated with the addition of a TEV treatment after breaking the cells. The TEV protease should allow releasing the DARPin-sfGFP fusion from OmpA, meaning that after the TEV treatment the fluorescence emission from the membrane fraction should decrease (Figure 5). This time again an empty vector control was included.

Figure 5: fluorescence of the cytoplasm/periplasm and membrane fractions. The negative control (empty plasmid induced at 50 µM of IPTG) is represented in blue and the assay (construction induced at 25 µM of IPTG) in orange. Each fraction was treated with TEV protease and compared with a non-treated sample. The excitation wavelength of the microplate reader was 485 nm. Emission was observed at a wavelength of 528 nm.

Similarly to the precedent experiment, the control fractions were considerably less fluorescent than the samples (approximately a hundred times), indicating that GFP was well present in both the cytoplasm and membrane fractions of the induced sample. The fluorescence in the membrane appeared to be 2 to 3 times lower than in the cytoplasm, corroborating results from the precedent experiment.
There was no difference between samples whether any TEV treatment was included or not. This could have been expected since we treated here the proteins alone and not bound to the membrane, meaning that compared DARPin-sfGFP alone if isolated after TEV treatment versus OmpA_DARPin-sfGFP, i.e, the same quantity of sfGFP in both. A more meaningful experiment would have been to purify the membrane before or after TEV treatment and to compare sfGFP fluorescence.

The pET-21 b (+)_OmpA_DARPin-sfGFP plasmid was then linearized and assembled with the missing DARPin* fragment by In-Fusion. The product was transformed in competent E. Coli Stellar cells and transformants were selected on Ampicillin. Plasmids from the resulting colonies were extracted by Miniprep. The presence of the insert was assessed by PCR screening with primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Amplification product sizes were checked on EtBr stained agarose gel [data not shown].
The plasmids were finally used to transform E. coli Tuner cells to hopefully express the DARPin*-sfGFP construction at the cell membrane.

Validation

To determine where the DARPin*-sfGFP fusion proteins were expressed in the E. coli Tuner cells, the same fractionation protocol was conducted. The fluorescence of each fraction on a microplate reader was measured (Figure 6). The DARPin* strain was induced at 25 µM of IPTG as a negative control.

Figure 6: fluorescence of cytoplasm/periplasm and membrane fractions The negative control (DARPin* strain inducted at 25 µM of IPTG) is represented in blue and the assay (construction inducted at 25 µM of IPTG) in orange. Each fraction was treated with TEV protease and compared with a non-treated sample. The excitation wavelength of the microplate reader was 485 nm. Emission was observed at a wavelength of 528 nm..

The results were the same as before the insertion of the missing fragment: the control fractions were considerably less fluorescent than the samples, indicating the accumulation of the fusion protein in both the cytoplasm and membrane. The fluorescence in the membrane still appeared to be 2 to 3 times lower than in the cytoplasm. There still was no difference in samples whether the TEV treatment was applied or not, so no conclusion could be made on whether the protein was exposed at the outer surface of the cell. In conclusion, the integration of the missing DARPin fragment did not alter the expression of the protein, which was still expressed in the membrane as wanted. The correct exposition at the surface could not be determined.

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts of OmpA fusion proteins associated with a DARPin:
- DARPin
- OmpA_DARPin
- OmpA_DARPin fusion + ihfB800-mTagBFP

1. Baumann, M. J., Eggel, A., Amstutz, P., Stadler, B. M., & Vogel, M. (2010). DARPins against a functional IgE epitope. Immunology Letters, 133(2), 78–84. https://doi.org/10.1016/j.imlet.2010.07.005
2. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
3. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal EcoRI site found at 130
  Illegal XbaI site found at 47
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal EcoRI site found at 130
  Illegal NheI site found at 92
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal EcoRI site found at 130
  Illegal BamHI site found at 124
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal EcoRI site found at 130
  Illegal XbaI site found at 47
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal EcoRI site found at 130
  Illegal XbaI site found at 47
  Illegal AgeI site found at 832
  
• 1000
  COMPATIBLE WITH RFC[1000]