Part:BBa_K4197001

OmpA_DARPin fusion + mTagBFP

Gene fusion to express the DARPin protein on the surface of blue fluorescent E. coli.

Introduction

This part is composed of the gene coding for the DARPin E2_79 protein (see BBa_K4197019) in fusion with the lpp-ompA-N gene (see BBa_K1694002) and carrying the gene coding for the mTagBFP fluorescent protein under control of the ihfB promoter (see BBa_K4197013). This part was designed to bind Immunoglobulins E at the surface of E. coli and to give a blue fluorescent property to the cells for FACS sorting.

The DARPin E2_79 protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was merged to the membrane protein Lpp-OmpA-N of E. coli (see BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in the membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016). The fusion protein is described in Part: BBa_K4197011.
This part is also composed of the gene coding for the mTagBFP (BBa_K592100) bright blue fluorescent protein under the control of the 800 first base pairs of the ihfB promoter. This promoter has been identified as a constitutive E. coli promoter (Weglenska et al., 1996). It was used for constitutive expression of fluorescent proteins in E. coli (Barthe et al., 2020) and appears as strong enough to permit sufficient expression of mTagBFP without inclusion bodies.

Construction

The fusion protein OmpA_DARPin was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part).
The pET-21 b (+)_OmpA_DARPin obtained (first version) was linearized by PCR using the primers FORWARD: gccgagatcgctaccgctctgaaaatacaggttttcactg and REVERSE: ctgcatcttgcagccatgctaggccatctggaaattg. Amplification product sizes were checked on EtBr stained agarose gel. Expected size was 6317 bp. Figure 1 shows amplicon matching expected size.

Figure 1: PCR linearization of pET-21 b (+)_OmpA_DARPin. The PCR product of linearization was checked with 0.8% agarose electrophoresis gel and revealed with EtBr. The hybridization temperature was 58°C and the elongation time was 7 min. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The ihfb800-mTagBFP construction provided by Manon Barthe (researcher at Toulouse Biotechnology Institute) was amplified by PCR with a high-fidelity Phusion polymerase using primers FORWARD: cgcgggatcgagatctatcacgaggcagaatttcagat and REVERSE: tagaggatcgagatctctgaaacagtgcaaagctaaccc. Amplification product sizes were checked on EtBr stained agarose gel. The expected size of the amplicon was 1595 bp. Figure 2 shows amplicon matching expected size.

Figure 2: PCR amplification of ihfb800-BFP from the psb1c3 plasmid. ihfb800-BFP PCR amplicon size of 1595 bp was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. The elongation time used is 2’ and the hybridization temperature was tested from 55°C to 62°C. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels. (note that a different ladder is presented on the theoretical gel).

The linearized pET-21 b (+)_OmpA_DARPin plasmid and the ihfb800-BFP fragment were extracted from gel and purified with the PCR clean-up protocol, then assembled by In-Fusion. The product was transformed in Stellar cells and transformants were selected on Ampicillin. Plasmids from the resulting colonies were extracted by Miniprep. The presence of BFP was assessed by PCR screening with primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Amplification product sizes were checked on EtBr stained agarose gel. The expected size of the amplicon was 2892 bp. Figure 3 shows amplicon matching expected size.

Figure 3: PCR screening of pET-21 b (+)_OmpA_DARPin. The electrophoresis gel was revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colony 2 presented the correct profile.

Finally, the pET-21 b (+)_OmpA_DARPin_mTagBFP plasmid was used to transform E. coli Tuner (DE3) cells. An overnight preculture of the transformed cells was performed to control the blue fluorescence on a microscope (Figure 4). A colony containing the pET-21 b (+)_OmpA_DARPin without ihfb800-BFP was used as a negative control. The microscope parameters to observe BFP were the following: excitation filter 360/40, dichroic beamsplitter 400 nm, emission filter 470/40.

Figure 4: Observation on microscope of pET-21 b (+)_OmpA_DARPin strain with ihfb800-BFP (A) pET-21 b (+)_OmpA_DARPin strain with ihfb800-BFP were used a negative control (B). Colonies showed significant blue fluorescence. Observations were made in phase contrast (left of each panel) and at the microscope parameters for BFP (right of each panel).

The sample was considerably more fluorescent than the negative control, indicating a correct expression of the mTagBFP.

The pET-21 b (+)_OmpA_DARPin_mTagBFP plasmid was then linearized and assembled with the missing DARPin* fragment by In-Fusion. The product was transformed in Stellar cells and transformants were selected on Ampicillin. Plasmids from the resulting colonies were extracted by Miniprep. The presence of BFP was assessed by PCR screening with primers FORWARD: tggtgatgcagtttctgcaaaatttccgcc and REVERSE: ggtagcgatctcggcaagaaattac. Amplification product sizes were checked on EtBr stained agarose gel. The expected size of the amplicon was 384 bp. Figure 5 shows amplicon matching expected size.

Figure 5: PCR screening of pET-21 b (+)_OmpA_DARPin_BFP. Expected size was 384 bp. The electrophoresis gel was revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

Plasmid from positive transformants were extracted by Miniprep and digested to assess the assembly (data not shown). Sequences were validated by sequencing, thus completing the pET-21 b (+)_OmpA_DARPin*_BFP construction.

Validation

The plasmids were finally used to transform E. coli Tuner cells to express the pET-21 b (+)_OmpA_DARPin_BFP correct construction at the cell membrane. We were not able during the course of this project to assess the correct localization of the DARPin protein at the membrane surface. This construction was used by the iGEM Toulouse 2022 team in a Fluorescence-Activated Cell Sorting (FACS) platform. The FACS successfully isolated the cells expressing OmpA_DARPin*_BFP (data not shown).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts of OmpA fusion proteins associated with an ihfB800-induced fluorescent protein:
- OmpA_Ara h 2_mScarlet-I
- OmpA_Ana o 3_mScarlet-I

1. Baumann, M. J., Eggel, A., Amstutz, P., Stadler, B. M., & Vogel, M. (2010). DARPins against a functional IgE epitope. Immunology Letters, 133(2), 78–84. https://doi.org/10.1016/j.imlet.2010.07.005
2. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
3. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
4. Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4
5. Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal EcoRI site found at 1526
  Illegal EcoRI site found at 1740
  Illegal XbaI site found at 1511
  Illegal XbaI site found at 1657
  Illegal PstI site found at 213
  Illegal PstI site found at 224
  Illegal PstI site found at 342
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal EcoRI site found at 1526
  Illegal EcoRI site found at 1740
  Illegal NheI site found at 1702
  Illegal PstI site found at 213
  Illegal PstI site found at 224
  Illegal PstI site found at 342
  Illegal NotI site found at 1518
  Illegal NotI site found at 2510
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal EcoRI site found at 1526
  Illegal EcoRI site found at 1740
  Illegal BglII site found at 1591
  Illegal BamHI site found at 1734
  Illegal XhoI site found at 2519
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal EcoRI site found at 1526
  Illegal EcoRI site found at 1740
  Illegal XbaI site found at 1511
  Illegal XbaI site found at 1657
  Illegal PstI site found at 213
  Illegal PstI site found at 224
  Illegal PstI site found at 342
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal EcoRI site found at 1526
  Illegal EcoRI site found at 1740
  Illegal XbaI site found at 1511
  Illegal XbaI site found at 1657
  Illegal PstI site found at 213
  Illegal PstI site found at 224
  Illegal PstI site found at 342
  Illegal AgeI site found at 329
  Illegal AgeI site found at 2307
  
• 1000
  COMPATIBLE WITH RFC[1000]