Search results (Hint: Try the special 'Search Parts' system on the main page)

Create the page "Assembly standard 65/References" on this wiki! See also the search results found.

• Part:BBa K1763444
  ...ge domains proves to be highly difficult, especially when it comes to gene assembly and oligo synthesis. ...s work suggests that the NTD-CTD structures are critical features of fiber assembly, and may allow for the delivery of internally inserted domains into the sil
  34 KB (4,992 words) - 03:39, 19 September 2015
• Part:BBa K4170045
  ...was developed in accordance with standardization, modularity and standard assembly rules aiming to enhance the CRISPR/crRNA applicability in synthetic biology According to literature references, the crRNA stability is significantly enhanced when it binds to Cas13a enzy
  12 KB (1,886 words) - 11:51, 10 October 2022
• Part:BBa K4170048
  ...was developed in accordance with standardization, modularity and standard assembly rules aiming to enhance the CRISPR/crRNA applicability in synthetic biology According to literature references, the crRNA stability is significantly enhanced when it binds to Cas13a enzy
  12 KB (1,865 words) - 11:53, 10 October 2022
• Part:BBa K4170046
  ...was developed in accordance with standardization, modularity and standard assembly rules aiming to enhance the CRISPR/crRNA applicability in synthetic biology According to literature references, the crRNA stability is significantly enhanced when it binds to Cas13a enzy
  12 KB (1,883 words) - 11:52, 10 October 2022
• Part:BBa K4170047
  ...was developed in accordance with standardization, modularity and standard assembly rules aiming to enhance the CRISPR/crRNA applicability in synthetic biology According to literature references, the crRNA stability is significantly enhanced when it binds to Cas13a enzy
  12 KB (1,876 words) - 11:52, 10 October 2022
• Part:BBa K4170049
  ...was developed in accordance with standardization, modularity and standard assembly rules aiming to enhance the CRISPR/crRNA applicability in synthetic biology According to literature references, the crRNA stability is significantly enhanced when it binds to Cas13a enzy
  12 KB (1,875 words) - 11:53, 10 October 2022
• Part:BBa K4170050
  ...was developed in accordance with standardization, modularity and standard assembly rules aiming to enhance the CRISPR/crRNA applicability in synthetic biology According to literature references, the crRNA stability is significantly enhanced when it binds to Cas13a enzy
  12 KB (1,892 words) - 11:54, 10 October 2022
• Part:BBa K2201004
  ...> used an N-terminal truncated version of <i>Pt</i>NTT2, lacking the first 65 amino acids, since they observed some kind of toxicity resulting from the n ...ersions with new signal peptides were constructed using primers and Gibson Assembly.
  64 KB (10,011 words) - 08:18, 6 December 2017
• Part:BBa K3410001
  ...y (sample “P_K”) amplified by epPCR using the kit from JenaBioScience [65] and as a reference the estradiol nanobody amplificated by a OneTaq® High ...tion of the nanobodiies, the IMPACT kit will be used: Using Through Gibson assembly, the nanobody sequence of our affinity maturated nanobodies is cloned into
  56 KB (8,191 words) - 03:28, 28 October 2020
• Part:BBa K3410002
  ...y (sample “P_K”) amplified by epPCR using the kit from JenaBioScience [65] and as a reference the estradiol nanobody amplificated by a OneTaq® High ...tion of the nanobodiies, the IMPACT kit will be used: Using Through Gibson assembly, the nanobody sequence of our affinity maturated nanobodies is cloned into
  57 KB (8,247 words) - 03:32, 28 October 2020
• Part:BBa K3410004
  ...y (sample “P_K”) amplified by epPCR using the kit from JenaBioScience [65] and as a reference the estradiol nanobody amplificated by a OneTaq® High ...tion of the nanobodiies, the IMPACT kit will be used: Using Through Gibson assembly, the nanobody sequence of our affinity maturated nanobodies is cloned into
  57 KB (8,249 words) - 03:33, 28 October 2020
• Part:BBa J45014
  ...he ligation of the protein of interest into the pET-19b plasmid via Gibson Assembly. ...nd of the ATF1 sequence to allow for ligation to pET19b backbone by Gibson Assembly.
  20 KB (2,977 words) - 10:34, 12 October 2022
• Part:BBa K4927058
  ...e high-efficiency CE7-IM7 protein reaction pair, which can be used for the assembly of artificial complexes in multi-enzyme cascade reaction systems. ...chieved through organometallic frameworks, fusion protein expression, self-assembly microstructures, and artificial biological scaffolds (Figure 1) [7-9]. Amon
  21 KB (3,106 words) - 07:08, 9 October 2023
• Part:BBa K1150034
  |'''RFC standard''' Multiple target sites can be combined on one plasmid by using the BioBrick standard and enables targeting of multiple loci at once with a small amount of plasm
  6 KB (949 words) - 02:26, 29 October 2013
• Part:BBa E1010
  <b>References</b> ...sed a small amount of the sample into 12 PCR tubes, and a gradient test at 65-95℃ was conducted in a PCR machine for 10 minutes.<br>
  66 KB (8,421 words) - 06:22, 12 October 2022
• Part:BBa P1016
  |width='65%'| ...Positive selection markers prevent one of the most common problems during assembly of BioBrick parts: contamination of the ligation reaction with uncut plasmi
  4 KB (536 words) - 18:56, 9 July 2015
• Part:BBa K2082251
  ...ck-in strain was about 3000 bp in size. With the 1 kb ladder as the length standard, it is seen that the colonies 2, 6, 7, 9 and 13 have the expected result.</ Assembly of the guide RNA in pTarget:
  13 KB (2,163 words) - 17:58, 21 October 2016
• Part:BBa K2934000
  ...hed to the vector per the sequencing result, and Gox1 protein was found at 65 Kda by SDS-PAGE</figcaption> ...ell plate diagram of the GSH standard samples. Fig. 3B is the GSH activity standard curve. Fig. 3C shows the 96 well plate diagram of GSH experimental samples.
  11 KB (1,571 words) - 09:44, 10 October 2023
• Part:BBa K4130000
  The EibD biobrick was assembled into the pSB1C3 vector by 3A assembly and cloned into E. coli DH5a for storage and E. coli BL21 for expression ex ...calculated for each time point. The error ribbon on the graph represents 1 standard deviation from the mean (n=3). The addition of the anti-asparagine antibody
  28 KB (4,120 words) - 23:56, 13 October 2022
• Part:BBa K2005050
  ...d to minimize its susceptibility to oxidative DNA mutation. Compared with standard mCherry, this gene is therefore more stable and less likely to evolve out o ...ced it at similar levels. For this sequence, our algorithm could eliminate 65% of poly-guanine motifs and an overall reduction in oxidizable guanines.
  4 KB (555 words) - 06:38, 29 October 2017
• Part:BBa K4165009
  ...ion. For tau's interaction with tubulin and the enhancement of microtubule assembly, normal brain tau appears to require 2-3 moles of phosphate per mole of the ...llary tangles) is inert since it does not bind to tubulin or encourage its assembly into microtubules.
  17 KB (2,394 words) - 22:30, 13 October 2022
• Part:BBa K3151002
  ...We assembled these plasmids via standard BioBrick assembly, and confirmed assembly through restriction digestion and sequence confirmation. <h2>References:</h2>
  10 KB (1,507 words) - 03:42, 22 October 2019
• Part:BBa K3128008
  ...apted into the [http://2018.igem.org/Team:Valencia_UPV/Design Golden Braid assembly method]. Thus, this sequence is both compatible with the BioBrick and Golde ...ion with the [http://2018.igem.org/Team:Valencia_UPV/Protocols Golden Gate assembly protocol].
  42 KB (4,946 words) - 15:00, 1 October 2019
• Part:BBa K3151009
  ...We assembled these plasmids via standard BioBrick assembly, and confirmed assembly through restriction digestion and sequence confirmation. <h2>References:</h2>
  10 KB (1,531 words) - 03:48, 22 October 2019
• Part:BBa K3151011
  ...We assembled these plasmids via standard BioBrick assembly, and confirmed assembly through restriction digestion and sequence confirmation. <h2>References:</h2>
  10 KB (1,548 words) - 03:41, 22 October 2019
• Part:BBa K1150020
  |'''RFC standard''' ...ing this device we used HEK-293T cells, which were seeded at a densitiy of 65,000 cells/well in 24-well plates. After 24 hours RNA plasmids with crRNAs a
  8 KB (1,110 words) - 05:54, 12 October 2016
• Part:BBa K1150019
  |'''RFC standard''' ...ing this device we used HEK-293T cells, which were seeded at a densitiy of 65,000 cells/well in 24-well plates. After 24 hours RNA plasmids with crRNAs a
  7 KB (992 words) - 23:00, 4 October 2013
• Part:BBa K1722012
  |'''RFC standard''' ...uffix after amplification. We constructed the two genes in pSB1C3 using 3A Assembly as described in iGEM.org.
  11 KB (1,752 words) - 15:31, 16 October 2016
• Part:BBa K1722009
  |'''RFC standard''' ...enzyme cutting site and amplify it. Then assemble the three parts using 3A Assembly Method.
  5 KB (820 words) - 14:21, 17 September 2015
• Part:BBa K1722011
  |'''RFC standard''' ...primers and amplified the gene sequences from psi-Check2 vector. Using 3A Assembly method, we constructed hTERT and tRNA in pSB1C3.
  7 KB (1,160 words) - 14:22, 17 September 2015
• Part:BBa K1722013
  |'''RFC standard''' ...uffix after amplification. We constructed the two genes in pSB1C3 using 3A Assembly as described in iGEM.org.
  11 KB (1,744 words) - 14:23, 17 September 2015
• Part:BBa K4665170
  ...sDNA molecule, referred to as a scaffold, which acts as a backbone for the assembly of defined DNA nanostructures. The ssDNA scaffold will be folded into the d ...rn et al. (2022). First, the dsDNA scaffold sequence was amplified using a standard primer (5' GGGATTCATGGTGTATTGCTTCACC 3') in combination with a modified pri
  26 KB (2,931 words) - 22:08, 11 October 2023
• Part:BBa K404108
  |'''RFC standard''' assembly and genome encapsidation (pRC and pHelper) in a molar ratio of
  7 KB (1,018 words) - 19:59, 16 October 2019
• Part:BBa K1390019
  ...o be expressed correctly. Furthermore, the activity assay suggests correct assembly of the subunits. ...d with a calibration curve as a function of time. The error bars represent standard error (n=3).]]
  13 KB (1,961 words) - 14:32, 12 October 2023
• Part:BBa K1438025
  ...se chain reaction (PCR) for amplification of single light and heavy chain. Assembly PCR for combination of amplified light and heavy chain containing GS-Linker References:
  4 KB (521 words) - 23:14, 17 October 2014