Difference between revisions of "DNA/Recombination"

Revision as of 22:37, 20 April 2009

Recombination sites are DNA sequences at which recombination events take place. For details on the different recombination systems available via the Registry, see Recombination.

*More...*
Name	Description	Sequence	Length
BBa_I11022	Lambda attB, reverse complement	accactttgtacaagaaagctgggt	25
BBa_I11023	Lambda attP	. . . tcactatcagtcaaaataaaatcattattt	232
BBa_I11032	P22 ''attB'', reverse complement	acgaccttcgcattacgaatgcgctgc	27
BBa_I11033	P22 ''attP''	. . . gggacatatttgggacagaagtaccaaaaa	260
BBa_I718016	lox66	. . . cttggtatagcatacattatacgaacggta	34
BBa_I718017	lox71	. . . gttcgtatacgatacattatacgaagttat	34
BBa_I742101	dif site with forward orientation	. . . tcggtgcgcataatgtatattatgttaaat	31
BBa_I742102	dif site with reverse orientation	. . . tcatttaacataatatacattatgcgcacc	31
BBa_J3101	Recombinational Enhancer (RE) for Hin/Hix inverting	. . . ctttctagtgcaaattgtgaccgcattttg	77
BBa_J44000	hixC binding site for Salmonella typhimurium Hin recombinase	ttatcaaaaaccatggtttttgataa	26
BBa_J61020	[FRT]	. . . ttcctatactttttagagaataggaacttc	34
BBa_J61046	[Lox] site for recombination	. . . cttcgtataatgtatgctatacgaagttat	34
BBa_J72001	{FRT} recombination site for flp recombinase in BBb	. . . ttcctatactttctagagaataggaacttc	36
BBa_K112141	attR2 recombination site	. . . gttcagctttcttgtacaaagtggttgatc	136
BBa_K112142	attR2 recombination site-reverse orientation	. . . aacacaacatatccagtcactatggtcgac	136
BBa_K137008	fimE IRR	. . . gaaacatttggggccaaactgtccatatta	35
BBa_K137010	fimE IRL	. . . gagtcaaaatggccccaattgtcttgtatt	35
BBa_K1680005	loxP Site	. . . cttcgtatagcatacattatacgaagttat	34
BBa_K315011	Variant reverse lox N	. . . cttcgtatagtataccttatacgaagttat	34
BBa_K3697003	Homology Arms for KanR integration in B. Subtilis	. . . gcttgcaaacaaaaaaaccaccgctaccag	1103
BBa_K416002	36 Base Pair LoxP	. . . tcgtataatgtatgctatacgaagttatcg	36
BBa_K863201	3' UTR site of alcohol oxidase 1 gene (aox1)	. . . tcatcaacttgaggggcactatcttgtttt	676
BBa_K886000	Fixed lox71	. . . gttcgtatagcatacattatacgaagttat	34

@@ Line 1: / Line 1: @@
 [[DNA|< Back to DNA parts]]
-{{:Recombination/Overview}}
+<html>
+<style>
+#assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;}
+#assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;}
+#assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;}
+</style>
+</html>
-Site-specific recombination systems derived from ''Salmonella'', different bacteriophages, yeast, and ''E. coli'' are all available from the Registry.  For more details on individual DNA recombination systems including DNA recombination sites, click the links below.
+Recombination sites are DNA sequences at which recombination events take place.  For details on the different recombination systems available via the Registry, see [[Recombination]].
-*[[Recombination/Salmonella typhimurium-derived Hin-hix|'''''Salmonella typhimurium''-derived Hin/''hix'' DNA recombination system''']]
-*[[Recombination/Bacteriophage P1-derived Cre-lox|'''Bacteriophage P1-derived Cre/''lox'' DNA recombination system''']]
-*[[Recombination/Bacteriophage lambda-derived att|'''Bacteriophage &lambda;-derived ''att'' DNA recombination system''']]
-*[[Recombination/Bacteriophage P22-derived att|'''Bacteriophage P22 ''att'' DNA recombination system''']]
-*[[Recombination/Saccharomyces cerevisiae-derived Flp-FRT|'''Yeast Flp/''FRT'' DNA recombination system''']]
-*[[Recombination/Escherichia coli-derived XerCD-dif|'''''Escherichia coli'' XerCD/''dif'' DNA recombination system''']]
-*[[Recombination/Escherichia coli-derived FimBE-fimS|'''''Escherichia coli'' FimBE/''fimS'' DNA recombination system''']]
-Recombination sites are DNA sequences at which recombination events take place.
-For details on the different recombination systems available via the Registry, see [[Recombination]].
 <parttable>recombination_site_DNA</parttable>