Difference between revisions of "DNA/Recombination"
Line 1: | Line 1: | ||
[[DNA|< Back to DNA parts]] | [[DNA|< Back to DNA parts]] | ||
− | {{: | + | <html> |
+ | <style> | ||
+ | #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} | ||
+ | #assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;} | ||
+ | #assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;} | ||
+ | </style> | ||
+ | </html> | ||
− | + | Recombination sites are DNA sequences at which recombination events take place. For details on the different recombination systems available via the Registry, see [[Recombination]]. | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | Recombination sites are DNA sequences at which recombination events take place. | + | |
− | + | ||
− | For details on the different recombination systems available via the Registry, see [[Recombination]]. | + | |
<parttable>recombination_site_DNA</parttable> | <parttable>recombination_site_DNA</parttable> |
Revision as of 22:37, 20 April 2009
Recombination sites are DNA sequences at which recombination events take place. For details on the different recombination systems available via the Registry, see Recombination.
Name | Description | Sequence | Length |
---|---|---|---|
BBa_I11022 | Lambda attB, reverse complement | accactttgtacaagaaagctgggt | 25 |
BBa_I11023 | Lambda attP | . . . tcactatcagtcaaaataaaatcattattt | 232 |
BBa_I11032 | P22 ''attB'', reverse complement | acgaccttcgcattacgaatgcgctgc | 27 |
BBa_I11033 | P22 ''attP'' | . . . gggacatatttgggacagaagtaccaaaaa | 260 |
BBa_I718016 | lox66 | . . . cttggtatagcatacattatacgaacggta | 34 |
BBa_I718017 | lox71 | . . . gttcgtatacgatacattatacgaagttat | 34 |
BBa_I742101 | dif site with forward orientation | . . . tcggtgcgcataatgtatattatgttaaat | 31 |
BBa_I742102 | dif site with reverse orientation | . . . tcatttaacataatatacattatgcgcacc | 31 |
BBa_J3101 | Recombinational Enhancer (RE) for Hin/Hix inverting | . . . ctttctagtgcaaattgtgaccgcattttg | 77 |
BBa_J44000 | hixC binding site for Salmonella typhimurium Hin recombinase | ttatcaaaaaccatggtttttgataa | 26 |
BBa_J61020 | [FRT] | . . . ttcctatactttttagagaataggaacttc | 34 |
BBa_J61046 | [Lox] site for recombination | . . . cttcgtataatgtatgctatacgaagttat | 34 |
BBa_J72001 | {FRT} recombination site for flp recombinase in BBb | . . . ttcctatactttctagagaataggaacttc | 36 |
BBa_K112141 | attR2 recombination site | . . . gttcagctttcttgtacaaagtggttgatc | 136 |
BBa_K112142 | attR2 recombination site-reverse orientation | . . . aacacaacatatccagtcactatggtcgac | 136 |
BBa_K137008 | fimE IRR | . . . gaaacatttggggccaaactgtccatatta | 35 |
BBa_K137010 | fimE IRL | . . . gagtcaaaatggccccaattgtcttgtatt | 35 |
BBa_K1680005 | loxP Site | . . . cttcgtatagcatacattatacgaagttat | 34 |
BBa_K315011 | Variant reverse lox N | . . . cttcgtatagtataccttatacgaagttat | 34 |
BBa_K3697003 | Homology Arms for KanR integration in B. Subtilis | . . . gcttgcaaacaaaaaaaccaccgctaccag | 1103 |
BBa_K416002 | 36 Base Pair LoxP | . . . tcgtataatgtatgctatacgaagttatcg | 36 |
BBa_K863201 | 3' UTR site of alcohol oxidase 1 gene (aox1) | . . . tcatcaacttgaggggcactatcttgtttt | 676 |
BBa_K886000 | Fixed lox71 | . . . gttcgtatagcatacattatacgaagttat | 34 |