Promoters/Catalog/Negative
All the promoters on this page are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.
Negatively regulated E. coli promoters
Negatively regulated E. coli σ70 promoters
This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_I1051 | Lux cassette right promoter | . . . tgttatagtcgaatacctctggcggtgata | 68 | 1735 | In stock | ||
BBa_I12001 | Promoter (PRM+) | . . . gatttaacgtatcagcacaaaaaagaaacc | 96 | 1424 | Not in stock | ||
BBa_I12006 | Modified lamdba Prm promoter (repressed by 434 cI) | . . . attacaaactttcttgtatagatttaacgt | 82 | 5124 | In stock | ||
BBa_I12036 | Modified lamdba Prm promoter (cooperative repression by 434 cI) | . . . tttcttgtatagatttacaatgtatcttgt | 91 | 2153 | In stock | ||
BBa_I12040 | Modified lambda P(RM) promoter: -10 region from P(L) and cooperatively repressed by 434 cI | . . . tttcttgtagatacttacaatgtatcttgt | 91 | 2572 | In stock | ||
BBa_I12212 | TetR - TetR-4C heterodimer promoter (negative) | . . . actctgtcaatgatagagtggattcaaaaa | 61 | 1774 | Not in stock | ||
BBa_I14015 | P(Las) TetO | . . . ttttggtacactccctatcagtgatagaga | 170 | 1524 | In stock | ||
BBa_I14016 | P(Las) CIO | . . . ctttttggtacactacctctggcggtgata | 168 | 1523 | In stock | ||
BBa_I14032 | promoter P(Lac) IQ | . . . aaacctttcgcggtatggcatgatagcgcc | 37 | 3527 | In stock | ||
BBa_I714889 | OR21 of PR and PRM | . . . tattttacctctggcggtgataatggttgc | 101 | 1491 | It's complicated | ||
BBa_I714924 | RecA_DlexO_DLacO1 | . . . actctcggcatggacgagctgtacaagtaa | 862 | 2343 | It's complicated | ||
BBa_I715003 | hybrid pLac with UV5 mutation | . . . ttgtgagcggataacaatatgttgagcaca | 55 | 1595 | Not in stock | ||
BBa_I718018 | dapAp promoter | . . . cattgagacacttgtttgcacagaggatgg | 81 | 1841 | In stock | ||
BBa_I731004 | FecA promoter | . . . ttctcgttcgactcatagctgaacacaaca | 90 | 814 | Not in stock | ||
BBa_I732200 | NOT Gate Promoter Family Member (D001O1wt1) | . . . gaattgtgagcggataacaattggatccgg | 125 | 1107 | Not in stock | ||
BBa_I732201 | NOT Gate Promoter Family Member (D001O11) | . . . ggaattgtgagcgctcacaattggatccgg | 124 | 1545 | Not in stock | ||
BBa_I732202 | NOT Gate Promoter Family Member (D001O22) | . . . ggaattgtaagcgcttacaattggatccgg | 124 | 1435 | Not in stock | ||
BBa_I732203 | NOT Gate Promoter Family Member (D001O33) | . . . ggaattgtaaacgtttacaattggatccgg | 124 | 1435 | Not in stock | ||
BBa_I732204 | NOT Gate Promoter Family Member (D001O44) | . . . ggaattgtgaacgttcacaattggatccgg | 124 | 1435 | Not in stock | ||
BBa_I732205 | NOT Gate Promoter Family Member (D001O55) | . . . ggaattttgagcgctcaaaattggatccgg | 124 | 1435 | In stock | ||
BBa_I732206 | NOT Gate Promoter Family Member (D001O66) | . . . ggaattatgagcgctcataattggatccgg | 124 | 1291 | Not in stock | ||
BBa_I732207 | NOT Gate Promoter Family Member (D001O77) | . . . gggacgactgtatacagtcgtcggatccgg | 124 | 1294 | Not in stock | ||
BBa_I732270 | Promoter Family Member with Hybrid Operator (D001O12) | . . . ggaattgtgagcgcttacaattggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732271 | Promoter Family Member with Hybrid Operator (D001O16) | . . . ggaattgtgagcgctcataattggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732272 | Promoter Family Member with Hybrid Operator (D001O17) | . . . ggaattgtgagctacagtcgtcggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732273 | Promoter Family Member with Hybrid Operator (D001O21) | . . . ggaattgtaagcgctcacaattggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732274 | Promoter Family Member with Hybrid Operator (D001O24) | . . . ggaattgtaagcgttcacaattggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732275 | Promoter Family Member with Hybrid Operator (D001O26) | . . . ggaattgtaagcgctcataattggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732276 | Promoter Family Member with Hybrid Operator (D001O27) | . . . ggaattgtaagctacagtcgtcggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732277 | Promoter Family Member with Hybrid Operator (D001O46) | . . . ggaattgtgaacgctcataattggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732278 | Promoter Family Member with Hybrid Operator (D001O47) | . . . ggaattgtgaactacagtcgtcggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732279 | Promoter Family Member with Hybrid Operator (D001O61) | . . . ggaattatgagcgctcacaattggatccgg | 124 | 1351 | Not in stock | ||
BBa_I732301 | NAND Candidate (U073O26D001O16) | . . . ggaattgtgagcgctcataattggatccgg | 120 | 1336 | Not in stock | ||
BBa_I732302 | NAND Candidate (U073O27D001O17) | . . . ggaattgtgagctacagtcgtcggatccgg | 120 | 1362 | Not in stock | ||
BBa_I732303 | NAND Candidate (U073O22D001O46) | . . . ggaattgtgaacgctcataattggatccgg | 120 | 1330 | Not in stock | ||
BBa_I732304 | NAND Candidate (U073O22D001O47) | . . . ggaattgtgaactacagtcgtcggatccgg | 120 | 1159 | Not in stock | ||
BBa_I732305 | NAND Candidate (U073O22D059O46) | . . . taaattgtgaacgctcataattggatccgg | 178 | 1193 | Not in stock | ||
BBa_I732306 | NAND Candidate (U073O11D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 121 | 1323 | Not in stock | ||
BBa_I732351 | NOR Candidate (U037O11D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 85 | 1333 | Not in stock | ||
BBa_I732352 | NOR Candidate (U035O44D001O22) | . . . ggaattgtaagcgcttacaattggatccgg | 82 | 1326 | Not in stock | ||
BBa_I732400 | Promoter Family Member (U097NUL+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 165 | 2515 | Not in stock | ||
BBa_I732401 | Promoter Family Member (U097O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 185 | 1233 | Not in stock | ||
BBa_I732402 | Promoter Family Member (U085O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 173 | 1271 | Not in stock | ||
BBa_I732403 | Promoter Family Member (U073O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 161 | 1271 | Not in stock | ||
BBa_I732404 | Promoter Family Member (U061O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 149 | 1275 | Not in stock | ||
BBa_I732405 | Promoter Family Member (U049O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 137 | 1271 | Not in stock | ||
BBa_I732406 | Promoter Family Member (U037O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 125 | 1273 | Not in stock | ||
BBa_I732407 | Promoter Family Member (U097NUL+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 125 | 1275 | Not in stock | ||
BBa_I732408 | Promoter Family Member (U097NUL+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 137 | 1275 | Not in stock | ||
BBa_I732409 | Promoter Family Member (U097NUL+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 149 | 1275 | Not in stock | ||
BBa_I732410 | Promoter Family Member (U097NUL+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 161 | 1297 | Not in stock | ||
BBa_I732411 | Promoter Family Member (U097NUL+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 173 | 1297 | Not in stock | ||
BBa_I732412 | Promoter Family Member (U097NUL+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 185 | 1297 | Not in stock | ||
BBa_I732413 | Promoter Family Member (U097O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
BBa_I732414 | Promoter Family Member (U097O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
BBa_I732415 | Promoter Family Member (U097O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
BBa_I732416 | Promoter Family Member (U097O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 181 | 1233 | Not in stock | ||
BBa_I732417 | Promoter Family Member (U097O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 193 | 1233 | Not in stock | ||
BBa_I732418 | Promoter Family Member (U097O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 205 | 1233 | Not in stock | ||
BBa_I732419 | Promoter Family Member (U085O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
BBa_I732420 | Promoter Family Member (U085O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
BBa_I732421 | Promoter Family Member (U085O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
BBa_I732422 | Promoter Family Member (U085O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
BBa_I732423 | Promoter Family Member (U085O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 181 | 1233 | Not in stock | ||
BBa_I732424 | Promoter Family Member (U085O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 193 | 1233 | Not in stock | ||
BBa_I732425 | Promoter Family Member (U073O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
BBa_I732426 | Promoter Family Member (U073O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
BBa_I732427 | Promoter Family Member (U073O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
BBa_I732428 | Promoter Family Member (U073O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
BBa_I732429 | Promoter Family Member (U073O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
BBa_I732430 | Promoter Family Member (U073O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 181 | 1233 | Not in stock | ||
BBa_I732431 | Promoter Family Member (U061O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 109 | 1233 | Not in stock | ||
BBa_I732432 | Promoter Family Member (U061O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
BBa_I732433 | Promoter Family Member (U061O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
BBa_I732434 | Promoter Family Member (U061O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
BBa_I732435 | Promoter Family Member (U061O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
BBa_I732436 | Promoter Family Member (U061O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
BBa_I732437 | Promoter Family Member (U049O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 97 | 1233 | Not in stock | ||
BBa_I732438 | Promoter Family Member (U049O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 109 | 1233 | Not in stock | ||
BBa_I732439 | Promoter Family Member (U049O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
BBa_I732440 | Promoter Family Member (U049O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
BBa_I732441 | Promoter Family Member (U049O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
BBa_I732442 | Promoter Family Member (U049O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
BBa_I732443 | Promoter Family Member (U037O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 85 | 1233 | Not in stock | ||
BBa_I732444 | Promoter Family Member (U037O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 97 | 1233 | Not in stock | ||
BBa_I732445 | Promoter Family Member (U037O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 109 | 1233 | Not in stock | ||
BBa_I732446 | Promoter Family Member (U037O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
BBa_I732447 | Promoter Family Member (U037O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
BBa_I732448 | Promoter Family Member (U037O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
BBa_I732450 | Promoter Family Member (U073O26+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 161 | 1233 | Not in stock | ||
BBa_I732451 | Promoter Family Member (U073O27+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 161 | 1233 | Not in stock | ||
BBa_I732452 | Promoter Family Member (U073O26+D062O61) | . . . caaattatgagcgctcacaattggatccgg | 181 | 1233 | It's complicated | ||
BBa_I739101 | Double Promoter (constitutive / TetR, negative) | . . . tgatagagattccctatcagtgatagagat | 83 | 3196 | Not in stock | ||
BBa_I739102 | Double Promoter (cI, negative / TetR, negative) | . . . tgatagagattccctatcagtgatagagat | 97 | 3216 | Not in stock | ||
BBa_I739103 | Double Promoter (lacI, negative / P22 cII, negative) | . . . gttctttaattatttaagtgttctttaatt | 87 | 3188 | Not in stock | ||
BBa_I739104 | Double Promoter (LuxR/HSL, positive / P22 cII, negative) | . . . gttctttaattatttaagtgttctttaatt | 101 | 3261 | Not in stock | ||
BBa_I739105 | Double Promoter (LuxR/HSL, positive / cI, negative) | . . . cgtgcgtgttgataacaccgtgcgtgttga | 99 | 3259 | Not in stock | ||
BBa_I739106 | Double Promoter (TetR, negative / P22 cII, negative) | . . . gtgttctttaatatttaagtgttctttaat | 84 | 3245 | Not in stock | ||
BBa_I739107 | Double Promoter (cI, negative / LacI, negative) | . . . ggaattgtgagcggataacaatttcacaca | 78 | 3009 | Not in stock | ||
BBa_I746665 | Pspac-hy promoter | . . . tgtgtgtaattgtgagcggataacaattaa | 58 | 2958 | Not in stock | ||
BBa_I751500 | pcI (for positive control of pcI-lux hybrid promoter) | . . . ttttacctctggcggtgataatggttgcag | 77 | 1165 | Not in stock | ||
BBa_I751501 | plux-cI hybrid promoter | . . . gtgttgatgcttttatcaccgccagtggta | 66 | 1222 | Not in stock | ||
BBa_I751502 | plux-lac hybrid promoter | . . . agtgtgtggaattgtgagcggataacaatt | 74 | 4200 | Not in stock | ||
BBa_I756014 | LexAoperator-MajorLatePromoter | . . . agggggtgggggcgcgttggcgcgccacac | 229 | 1516 | Not in stock | ||
BBa_I761011 | CinR, CinL and glucose controlled promotor | . . . acatcttaaaagttttagtatcatattcgt | 295 | 2080 | It's complicated | ||
BBa_J05209 | Modifed Pr Promoter | . . . tattttacctctggcggtgataatggttgc | 49 | 1265 | In stock | ||
BBa_J05210 | Modifed Prm+ Promoter | . . . atttataaatagtggtgatagatttaacgt | 82 | 1268 | In stock | ||
BBa_J07019 | FecA Promoter (with Fur box) | . . . acccttctcgttcgactcatagctgaacac | 86 | 1545 | It's complicated | ||
BBa_J15301 | Pars promoter from Escherichia coli chromosomal ars operon. | . . . tgacttatccgcttcgaagagagacactac | 127 | 2472 | Not in stock | ||
BBa_J22052 | Pcya | . . . aggtgttaaattgatcacgttttagaccat | 65 | 1885 | Not in stock | ||
BBa_J22106 | rec A (SOS) Promoter | . . . caatttggtaaaggctccatcatgtaataa | 192 | 1439 | In stock | ||
BBa_J22126 | Rec A (SOS) promoter | . . . gagaaacaatttggtaaaggctccatcatg | 186 | 1263 | Not in stock | ||
BBa_J31013 | pLac Backwards [cf. BBa_R0010] | . . . aacgcgcggggagaggcggtttgcgtattg | 200 | 1364 | Not in stock | ||
BBa_J34800 | Promoter tetracyclin inducible | . . . cagtgatagagatactgagcacatcagcac | 94 | 1154 | Not in stock | ||
BBa_J34806 | promoter lac induced | . . . ttatgcttccggctcgtataatgtttcaaa | 112 | 1197 | Not in stock | ||
BBa_J34809 | promoter lac induced | . . . ggctcgtatgttgtgtcgaccgagctgcgc | 125 | 1202 | Not in stock | ||
BBa_J54016 | promoter_lacq | . . . aaacctttcgcggtatggcatgatagcgcc | 54 | 1188 | Not in stock | ||
BBa_J54120 | EmrR_regulated promoter | . . . atttgtcactgtcgttactatatcggctgc | 46 | 1204 | Not in stock | ||
BBa_J54130 | BetI_regulated promoter | . . . gtccaatcaataaccgctttaatagataaa | 46 | 1203 | Not in stock | ||
BBa_J56012 | Invertible sequence of dna includes Ptrc promoter | . . . actttattatcaataagttaaatcggtacc | 409 | 1339 | Not in stock | ||
BBa_J64065 | cI repressed promoter | . . . gtgttgactattttacctctggcggtgata | 74 | 1530 | Not in stock | ||
BBa_J64067 | LuxR+3OC6HSL independent R0065 | . . . gtgttgactattttacctctggcggtgata | 98 | 1810 | Not in stock | ||
BBa_J64068 | increased strength R0051 | . . . atacctctggcggtgatatataatggttgc | 49 | 1442 | Not in stock | ||
BBa_J64069 | R0065 with lux box deleted | . . . gtgttgactattttacctctggcggtgata | 84 | 1383 | Not in stock | ||
BBa_J64712 | LasR/LasI Inducible & RHLR/RHLI repressible Promoter | . . . gaaatctggcagtttttggtacacgaaagc | 157 | 1866 | Not in stock | ||
BBa_J64800 | RHLR/RHLI Inducible & LasR/LasI repressible Promoter | . . . tgccagttctggcaggtctaaaaagtgttc | 53 | 1631 | Not in stock | ||
BBa_J64981 | OmpR-P strong binding, regulatory region for Team Challenge03-2007 | . . . agcgctcacaatttaatacgactcactata | 82 | 1868 | Not in stock | ||
BBa_J64987 | LacI Consensus Binding Site in sigma 70 binding region | . . . taataattgtgagcgctcacaattttgaca | 32 | 1154 | Not in stock | ||
BBa_J72005 | {Ptet} promoter in BBb | . . . atccctatcagtgatagagatactgagcac | 54 | 1802 | In stock | ||
BBa_K086017 | unmodified Lutz-Bujard LacO promoter | . . . ttgtgagcggataacaagatactgagcaca | 55 | 1209 | In stock | ||
BBa_K091100 | pLac_lux hybrid promoter | . . . ggaattgtgagcggataacaatttcacaca | 74 | 4885 | In stock | ||
BBa_K091101 | pTet_Lac hybrid promoter | . . . ggaattgtgagcggataacaatttcacaca | 83 | 2516 | It's complicated | ||
BBa_K091104 | pLac/Mnt Hybrid Promoter | . . . ggaattgtgagcggataacaatttcacaca | 87 | 1938 | It's complicated | ||
BBa_K091105 | pTet/Mnt Hybrid Promoter | . . . agaactgtaatccctatcagtgatagagat | 98 | 1238 | It's complicated | ||
BBa_K091106 | LsrA/cI hybrid promoter | . . . tgttgatttatctaacaccgtgcgtgttga | 141 | 2013 | It's complicated | ||
BBa_K091107 | pLux/cI Hybrid Promoter | . . . acaccgtgcgtgttgatatagtcgaataaa | 57 | 4524 | It's complicated | ||
BBa_K091110 | LacI Promoter | . . . cctttcgcggtatggcatgatagcgcccgg | 56 | 1299 | It's complicated | ||
BBa_K091111 | LacIQ promoter | . . . cctttcgcggtatggcatgatagcgcccgg | 56 | 1435 | It's complicated | ||
BBa_K091112 | pLacIQ1 promoter | . . . cctttcgcggtatggcatgatagcgcccgg | 56 | 3059 | It's complicated | ||
BBa_K091143 | pLas/cI Hybrid Promoter | . . . ggttctttttggtacctctggcggtgataa | 164 | 1530 | It's complicated | ||
BBa_K091146 | pLas/Lux Hybrid Promoter | . . . tgtaggatcgtacaggtataaattcttcag | 126 | 4661 | In stock | ||
BBa_K091157 | pLux/Las Hybrid Promoter | . . . ctatctcatttgctagtatagtcgaataaa | 55 | 2254 | Not in stock | ||
BBa_K093000 | pRecA with LexA binding site | . . . gtatatatatacagtataattgcttcaaca | 48 | 2580 | It's complicated | ||
BBa_K093008 | reverse BBa_R0011 | . . . cacaatgtcaattgttatccgctcacaatt | 55 | 1227 | Not in stock | ||
BBa_K094120 | pLacI/ara-1 | . . . aattgtgagcggataacaatttcacacaga | 103 | 1330 | It's complicated | ||
BBa_K094140 | pLacIq | . . . ccggaagagagtcaattcagggtggtgaat | 80 | 1326 | Not in stock | ||
BBa_K101000 | Dual-Repressed Promoter for p22 mnt and TetR | . . . acggtgacctagatctccgatactgagcac | 61 | 2039 | Not in stock | ||
BBa_K101001 | Dual-Repressed Promoter for LacI and LambdacI | . . . tggaattgtgagcggataaaatttcacaca | 116 | 1807 | Not in stock | ||
BBa_K101002 | Dual-Repressed Promoter for p22 cII and TetR | . . . tagtagataatttaagtgttctttaatttc | 66 | 1947 | Not in stock | ||
BBa_K101017 | MioC Promoter (DNAa-Repressed Promoter) | . . . ccaacgcgttcacagcgtacaattactagt | 319 | 2004 | It's complicated | ||
BBa_K109200 | AraC and TetR promoter (hybrid) | . . . aacaaaaaaacggatcctctagttgcggcc | 132 | 1535 | It's complicated | ||
BBa_K112118 | rrnB P1 promoter | . . . ataaatgcttgactctgtagcgggaaggcg | 503 | 2103 | In stock | ||
BBa_K112318 | {< bolA promoter>} in BBb format | . . . atttcatgatgatacgtgagcggatagaag | 436 | 2044 | It's complicated | ||
BBa_K112401 | Promoter for recA gene - SOS and Ultrasound Sensitive | . . . caaacagaaagcgttggcggcagcactggg | 286 | 4420 | It's complicated | ||
BBa_K112402 | promoter for FabA gene - Membrane Damage and Ultrasound Senstitive | . . . gtcaaaatgaccgaaacgggtggtaacttc | 256 | 4451 | It's complicated | ||
BBa_K112405 | Promoter for CadA and CadB genes | . . . agtaatcttatcgccagtttggtctggtca | 370 | 4281 | It's complicated | ||
BBa_K112406 | cadC promoter | . . . agtaatcttatcgccagtttggtctggtca | 2347 | 1785 | It's complicated | ||
BBa_K112701 | hns promoter | . . . aattctgaacaacatccgtactcttcgtgc | 669 | 2559 | Not in stock | ||
BBa_K112708 | PfhuA | . . . tttacgttatcattcactttacatcagagt | 210 | 1858 | Not in stock | ||
BBa_K113009 | pBad/araC | . . . gtttctccatacccgtttttttgggctagc | 1210 | 1793 | In stock | ||
BBa_K116001 | nhaA promoter, that can be regulated by pH and nhaR protein. | . . . cgatctattcacctgaaagagaaataaaaa | 274 | 5780 | It's complicated | ||
BBa_K116500 | OmpF promoter that is activated or repressesed by OmpR according to osmolarity. | . . . aaacgttagtttgaatggaaagatgcctgc | 126 | 1250 | It's complicated | ||
BBa_K119002 | RcnR operator (represses RcnA) | . . . attgccgaattaatactaagaattattatc | 83 | 1387 | It's complicated | ||
BBa_K121011 | promoter (lacI regulated) | . . . acaggaaacagctatgaccatgattacgcc | 232 | 1333 | Not in stock | ||
BBa_K121014 | promoter (lambda cI regulated) | . . . actggcggttataatgagcacatcagcagg | 90 | 1400 | Not in stock | ||
BBa_K137046 | 150 bp inverted tetR promoter | . . . caccgacaaacaacagataaaacgaaaggc | 150 | 1739 | It's complicated | ||
BBa_K137047 | 250 bp inverted tetR promoter | . . . agtgttattaagctactaaagcgtagtttt | 250 | 1740 | It's complicated | ||
BBa_K137048 | 350 bp inverted tetR promoter | . . . gaataagaaggctggctctgcaccttggtg | 350 | 1741 | It's complicated | ||
BBa_K137049 | 450 bp inverted tetR promoter | . . . ttagcgacttgatgctcttgatcttccaat | 450 | 1741 | It's complicated | ||
BBa_K137050 | 650 bp inverted tetR promoter | . . . acatctaaaacttttagcgttattacgtaa | 650 | 1741 | It's complicated | ||
BBa_K137051 | 850 bp inverted tetR promoter | . . . ttccgacctcattaagcagctctaatgcgc | 850 | 1740 | It's complicated | ||
BBa_K137125 | LacI-repressed promoter B4 | . . . caatttttaaaattaaaggcgttacccaac | 103 | 1347 | It's complicated | ||
BBa_K145150 | Hybrid promoter: HSL-LuxR activated, P22 C2 repressed | . . . tagtttataatttaagtgttctttaatttc | 66 | 2130 | It's complicated | ||
BBa_K145152 | Hybrid promoter: P22 c2 , LacI NOR gate | . . . gaaaatgtgagcgagtaacaacctcacaca | 142 | 1431 | Not in stock | ||
BBa_K1520005 | Plac-rbs-rfp-Ter | . . . caccttcgggtgggcctttctgcgtttata | 1077 | 1495 | It's complicated | ||
BBa_K1520014 | Ptet-rbs-rfp-Ter | . . . caccttcgggtgggcctttctgcgtttata | 931 | 1467 | It's complicated | ||
BBa_K1520025 | Ptet-rbs-rfp-Ter-Plac-rbs-tetR-Ter | . . . caccttcgggtgggcctttctgcgtttata | 1987 | 1290 | Not in stock | ||
BBa_K1520026 | Ptet-rbs-rfp-Ter-Plac-rbs-tetR-Ter-Pcons2-rbs-lacI-Ter | . . . caccttcgggtgggcctttctgcgtttata | 3346 | 1309 | Not in stock | ||
BBa_K1520509 | PgolTS-golS-PgolB-rbs-tetR-Ter-PtetO-rbs-rfp-Ter-Plac-rbs-tetR-Ter-Pcons2-rbs-lacI-Ter | . . . caccttcgggtgggcctttctgcgtttata | 4955 | 2083 | Not in stock | ||
BBa_K1682002 | PkdpF[-15, T>A] | . . . tctttgcagccagaaatctacccttccggt | 78 | 9539 | It's complicated | ||
BBa_K1682003 | PkdpF[-15, T>C] | . . . tctttgcagccagaactctacccttccggt | 78 | 9541 | It's complicated | ||
BBa_K1682004 | PkdpF[-15, T>G] | . . . tctttgcagccagaagtctacccttccggt | 78 | 11751 | In stock | ||
BBa_K1682012 | PphoA promoter | . . . gctttgtttttattttttaatgtatttgta | 85 | 3467 | It's complicated | ||
BBa_K1824895 | Ptet + RBS | . . . gcactactagagaaagaggagaaatactag | 80 | 1348 | It's complicated | ||
BBa_K1886017 | broken_Ptet | . . . tactgagcacatcagcaggacgcactgacc | 49 | 1947 | Not in stock | ||
BBa_K256028 | placI:CHE | . . . caccttcgggtgggcctttctgcgtttata | 1305 | 3383 | Not in stock | ||
BBa_K259005 | AraC Rheostat Promoter | . . . ttttatcgcaactctctactgtttctccat | 340 | 1934 | It's complicated | ||
BBa_K259007 | AraC Promoter fused with RBS | . . . gtttctccattactagagaaagaggggaca | 360 | 6988 | It's complicated | ||
BBa_K266001 | Inverter TetR -> LuxR | . . . caccttcgggtgggcctttctgcgtttata | 1890 | 1766 | It's complicated | ||
BBa_K266003 | POPS -> Lac Inverter -> LasR | . . . caccttcgggtgggcctttctgcgtttata | 2315 | 1392 | It's complicated | ||
BBa_K266004 | Const Lac Inverter -> LasR | . . . caccttcgggtgggcctttctgcgtttata | 2358 | 1418 | It's complicated | ||
BBa_K266005 | PAI+LasR -> LasI & AI+LuxR --| LasI | . . . aataactctgatagtgctagtgtagatctc | 819 | 1498 | It's complicated | ||
BBa_K266006 | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | . . . caccttcgggtgggcctttctgcgtttata | 1705 | 1471 | It's complicated | ||
BBa_K266007 | Complex QS -> LuxI & LasI circuit | . . . caccttcgggtgggcctttctgcgtttata | 2676 | 1513 | It's complicated | ||
BBa_K266008 | J23100 + Lac inverter | . . . ttgtgagcggataacaagatactgagcaca | 1414 | 1444 | It's complicated | ||
BBa_K266009 | J23100 + Lac inverter + RBS | . . . actgagcacatactagagaaagaggagaaa | 1434 | 1310 | It's complicated | ||
BBa_K266011 | Lac Inverter and strong RBS | . . . actgagcacatactagagaaagaggagaaa | 1391 | 1291 | Not in stock | ||
BBa_K292002 | pLac (LacI regulated) + Strong RBS | . . . tcacacatactagagattaaagaggagaaa | 223 | 2924 | In stock | ||
BBa_K3040501 | Lipase-Pseudomonas sp 7323. | . . . atgactcagcgcacgctaacgcgacagttc | 2227 | 9863 | Not in stock | ||
BBa_K873002 | HSP promoter | . . . ggcgaagcctcatccccatttctctggtca | 47 | 4496 | In stock | ||
BBa_M31370 | tacI Promoter | . . . ggaattgtgagcggataacaatttcacaca | 68 | 1406 | Not in stock | ||
BBa_R0010 | promoter (lacI regulated) | . . . ggaattgtgagcggataacaatttcacaca | 200 | 46722 | In stock | ||
BBa_R0011 | Promoter (lacI regulated, lambda pL hybrid) | . . . ttgtgagcggataacaagatactgagcaca | 55 | 23492 | In stock | ||
BBa_R0040 | TetR repressible promoter | . . . atccctatcagtgatagagatactgagcac | 54 | 25578 | In stock | ||
BBa_R0050 | Promoter (HK022 cI regulated) | . . . ccgtcataatatgaaccataagttcaccac | 55 | 2361 | It's complicated | ||
BBa_R0051 | promoter (lambda cI regulated) | . . . tattttacctctggcggtgataatggttgc | 49 | 9224 | In stock | ||
BBa_R0052 | Promoter (434 cI regulated) | . . . attgtatgaaaatacaagaaagtttgttga | 46 | 2587 | In stock | ||
BBa_R0053 | Promoter (p22 cII regulated) | . . . tagtagataatttaagtgttctttaatttc | 54 | 2610 | In stock | ||
BBa_R0061 | Promoter (HSL-mediated luxR repressor) | ttgacacctgtaggatcgtacaggtataat | 30 | 9023 | In stock | ||
BBa_R0063 | Promoter (luxR & HSL regulated -- lux pL) | . . . cacgcaaaacttgcgacaaacaataggtaa | 151 | 4614 | In stock | ||
BBa_R0065 | Promoter (lambda cI and luxR regulated -- hybrid) | . . . gtgttgactattttacctctggcggtgata | 97 | 3065 | In stock | ||
BBa_R0073 | Promoter (Mnt regulated) | . . . tagatctcctatagtgagtcgtattaattt | 67 | 2760 | In stock | ||
BBa_R0074 | Promoter (PenI regulated) | . . . tactttcaaagactacatttgtaagatttg | 77 | 2872 | In stock | ||
BBa_R0075 | Promoter (TP901 cI regulated) | . . . cataaagttcatgaaacgtgaactgaaatt | 117 | 1455 | It's complicated | ||
BBa_R1050 | Promoter, Standard (HK022 cI regulated) | . . . ccgtgatactatgaaccataagttcaccac | 56 | 2482 | In stock | ||
BBa_R1051 | Promoter, Standard (lambda cI regulated) | . . . aattttacctctggcggtgatactggttgc | 49 | 3091 | In stock | ||
BBa_R1052 | Promoter, Standard (434 cI regulated) | . . . attgtatgatactacaagaaagtttgttga | 46 | 1981 | It's complicated | ||
BBa_R1053 | Promoter, Standard (p22 cII regulated) | . . . tagtagatactttaagtgttctttaatttc | 55 | 2014 | It's complicated | ||
BBa_R2000 | Promoter, Zif23 regulated, test: between | . . . tggtcccacgcgcgtgggatactacgtcag | 45 | 1824 | In stock | ||
BBa_R2001 | Promoter, Zif23 regulated, test: after | . . . attacggtgagatactcccacgcgcgtggg | 52 | 1886 | In stock | ||
BBa_R2002 | Promoter, Zif23 regulated, test: between and after | . . . acgcgcgtgggatactcccacgcgcgtggg | 52 | 1948 | In stock | ||
BBa_R2108 | Promoter with operator site for C2003 | . . . gattagattcataaatttgagagaggagtt | 72 | 1357 | Not in stock | ||
BBa_R2109 | Promoter with operator site for C2003 | . . . acttagattcataaatttgagagaggagtt | 72 | 1350 | In stock | ||
BBa_R2110 | Promoter with operator site for C2003 | . . . ggttagattcataaatttgagagaggagtt | 72 | 1347 | Not in stock | ||
BBa_R2111 | Promoter with operator site for C2003 | . . . acttagattcataaatttgagagaggagtt | 72 | 1342 | Not in stock | ||
BBa_R2112 | Promoter with operator site for C2003 | . . . aattagattcataaatttgagagaggagtt | 72 | 1347 | Not in stock | ||
BBa_R2113 | Promoter with operator site for C2003 | . . . acttagattcataaatttgagagaggagtt | 72 | 1347 | Not in stock | ||
BBa_R2114 | Promoter with operator site for C2003 | . . . atttagattcataaatttgagagaggagtt | 72 | 1444 | It's complicated | ||
BBa_R2201 | C2006-repressible promoter | . . . cacgcgcgtgggaatgttataatacgtcag | 45 | 1533 | Not in stock | ||
BBa_S03385 | Cold-sensing promoter (hybB) | 1759 | No part sequence | ||||
BBa_S04209 | R0051:Q04121:B0034:C0079:B0015 | . . . actgagcacatactagagaaagaggagaaa | 1434 | 1169 | It's complicated |
Negatively regulated E. coli σS promoters
This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K086030 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . cagtgagcgagtaacaactacgctgtttta | 55 | 1294 | Not in stock | ||
BBa_K086031 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . cagtgagcgagtaacaactacgctgtttta | 55 | 1296 | Not in stock | ||
BBa_K086032 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . atgtgagcggataacactataattaataga | 55 | 1294 | Not in stock | ||
BBa_K086033 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . atgtgagcggataacactataattaataga | 55 | 1294 | Not in stock | ||
BBa_K112318 | {< bolA promoter>} in BBb format | . . . atttcatgatgatacgtgagcggatagaag | 436 | 2044 | It's complicated |
Negatively regulated E. coli σ32 promoters
This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K086026 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtggcaccattaagtacgta | 55 | 1294 | Not in stock | ||
BBa_K086027 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtgacaccattaagtacgta | 55 | 1294 | Not in stock | ||
BBa_K086028 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtaacaccattaagtacgta | 55 | 1294 | Not in stock | ||
BBa_K086029 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtaacaccattaagtacgta | 55 | 1294 | Not in stock |
Negatively regulated E. coli σ54 promoters
This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_J64979 | glnAp2 | . . . agttggcacagatttcgctttatctttttt | 151 | 1249 | Not in stock |
The promoters here are B. subtilis promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.
Negatively regulated B. subtilis promoters
Repressible B. subtilis σA promoters
This section lists promoters that are recognized by B. subtilis σA RNAP. σA is the major B. subtilis sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).
Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
---|---|---|---|---|---|---|---|
BBa_K090501 | Gram-Positive IPTG-Inducible Promoter | . . . tggaattgtgagcggataacaattaagctt | 107 | 2054 | It's complicated | ||
BBa_K143014 | Promoter Xyl for B.subtilis | . . . agtttgtttaaacaacaaactaataggtga | 82 | 2112 | Not in stock | ||
BBa_K143015 | Promoter hyper-spank for B. subtilis | . . . aatgtgtgtaattgtgagcggataacaatt | 101 | 2527 | Not in stock |
Repressible B. subtilis σB promoters
This section lists promoters that are recognized by B. subtilis σB RNAP. σB is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation.
There are no parts for this table